Bacillus subtilis for homologous recombination of hermetia illucens CLP1 gene and construction method thereof

By integrating the black soldier fly CLP1 gene into Bacillus subtilis and inducing its expression with lactose and IPTG, the problem of insufficient inhibitory effect of Bacillus subtilis on Escherichia coli was solved, realizing the application of biotechnology for the effective prevention and control of diarrheal diseases in livestock and poultry.

CN121495967APending Publication Date: 2026-02-10YANGTZE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511657048.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-13
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

The existing Bacillus subtilis has a weak inhibitory effect on Escherichia coli and Salmonella, making it difficult to effectively prevent and treat diarrheal diseases in livestock and poultry. Furthermore, the use of antibiotics is limited, necessitating the development of natural biotechnology products.

Method used

By replacing the β-GAL gene coding region in Bacillus subtilis using homologous recombination technology, integrating the black soldier fly CLP1 gene, and inducing expression with lactose and IPTG, a recombinant Bacillus subtilis strain with inhibitory effects on Escherichia coli was constructed.

Benefits of technology

The study demonstrated a significant inhibitory effect of Bacillus subtilis on Escherichia coli, which can effectively prevent and treat gastrointestinal diarrheal diseases in livestock and poultry, providing a biotechnological solution as an alternative to antibiotics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495967A_ABST
    Figure CN121495967A_ABST
Patent Text Reader

Abstract

The invention discloses bacillus subtilis for homologous recombination of a hermetia illucens antibacterial peptide CLP1 gene and a construction method of the bacillus subtilis, and belongs to the technical field of genetic engineering. A bacillus subtilis 168 strain is taken as a starting strain, a beta-galactosidase (beta-GAL) gene coding region is knocked out, and a hermetia illucens CLP1 gene coding region is integrated, so that the homologous recombinant bacillus subtilis capable of remarkably inhibiting the growth of escherichia coli is obtained. The recombinant bacterium can be used as an animal health-care product and is used for preventing and treating pig and chicken intestinal diarrhea caused by escherichia coli.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a Bacillus subtilis strain with a homologous recombinant black soldier fly CLP1 gene and its construction method. Background Technology

[0002] Bacillus subtilis is a commonly used probiotic strain for livestock and humans.

[0003] Bacillus subtilis is a Gram-positive bacterium that inhibits other Gram-positive bacteria in the environment, but it does not inhibit Gram-negative bacteria such as Escherichia coli, which limits the application of Bacillus subtilis in the treatment of diarrheal diseases in animals.

[0004] Escherichia coli and Salmonella can cause diarrheal diseases in the digestive tract of livestock and poultry. Conventional Bacillus subtilis has a weak inhibitory effect on Escherichia coli and Salmonella, making it difficult to treat diarrheal diseases caused by these Gram-negative bacteria by killing Escherichia coli and Salmonella.

[0005] Antibiotics can kill E. coli and Salmonella, but under the background of "antibiotic ban" in livestock and poultry farming, the application of antibiotics is greatly restricted. There is an urgent need to develop "antibiotic alternatives" that can kill E. coli and Salmonella, such as antimicrobial peptides and traditional Chinese medicine.

[0006] Antimicrobial peptides are a class of basic polypeptides with antimicrobial activity produced in insects through induction. They have a molecular weight of 2000–7000 Da and are composed of 20–60 amino acid residues. Most of these active polypeptides are characterized by strong alkalinity, thermal stability, and broad-spectrum antimicrobial activity.

[0007] Black soldier flies are a globally distributed resource insect that can effectively convert organic waste such as kitchen waste and livestock manure into biomass and compost, which can be used as animal feed and biofertilizer. Black soldier flies contain more than 50 antimicrobial peptide genes, and the antimicrobial peptides produced within their bodies have highly effective antimicrobial capabilities.

[0008] Cecropin-like Peptide 1 (CLP1) is an α-helical antimicrobial peptide belonging to the black soldier fly cecropin class. It was initially induced from the hemolymph of black soldier fly larvae after immunization and purified by solid-phase extraction and reversed-phase chromatography. Its molecular weight is 4,840 Da.

[0009] Previous studies have found that the MIC and MBC of CLP1 against Escherichia coli, Enterobacter aerogenes, and Pseudomonas aeruginosa are 0.52–1.03 μM, 1.03–2.07 μM, and 1.03–2.07 μM, respectively, while it has no inhibitory effect on Staphylococcus aureus.

[0010] Although black soldier fly antimicrobial peptides have a good inhibitory effect on Gram-negative bacteria such as Escherichia coli, it is difficult to mass-produce black soldier flies as insects. Therefore, how to obtain large quantities of black soldier fly antimicrobial peptides is an important biotechnological problem. Summary of the Invention

[0011] The purpose of this invention is to provide a homologous recombinant Bacillus subtilis strain containing the CLP1 gene from the black soldier fly larvae and its construction method, thereby addressing the problems existing in the prior art. This invention uses the integrative plasmid pHY300PLK for homologous recombination, replacing the β-GAL gene coding region with the CLP1 gene in Bacillus subtilis, and inducing expression using lactose and its analogue IPTG to obtain a recombinant Bacillus subtilis strain with inhibitory function against Escherichia coli. This recombinant strain can be used as a feed additive for treating gastrointestinal diarrheal diseases in livestock and poultry caused by Escherichia coli and other pathogens.

[0012] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is a recombinant expression cassette of the homologous recombinant black soldier fly CLP1 gene, comprising an upstream homologous arm sequence of the coding region of the β-galactosidase gene, the CLP1 gene sequence, and a downstream homologous arm sequence of the coding region of the endonuclease-1,4-β-D-glucanase gene.

[0013] The second technical solution of the present invention is a recombinant expression vector of the homologous recombinant black soldier fly CLP1 gene, wherein the recombinant expression vector uses pHY300PLK as a backbone and includes the recombinant expression cassette.

[0014] The third technical solution of the present invention is a recombinant Bacillus subtilis with a homologous recombinant black soldier fly CLP1 gene, using Bacillus subtilis 168 as the starting strain, and containing the recombinant expression cassette or the recombinant expression vector.

[0015] The fourth technical solution of the present invention is the application of the recombinant expression cassette, the recombinant expression vector, or the recombinant Bacillus subtilis in the preparation of drugs for preventing and treating diseases caused by Escherichia coli.

[0016] The fifth technical solution of the present invention is a drug for preventing and treating diseases caused by Escherichia coli, comprising the recombinant Bacillus subtilis.

[0017] Based on the above technical solution, the present invention has the following technical effects: This invention utilizes homologous recombination to replace the downstream coding region of the signal peptide in the Bacillus subtilis β-GAL gene with the CLP1 gene. This homologous recombinant CLP1 gene can be induced to express using lactose and IPTG substrates under the control of the β-GAL promoter and signal peptide sequence, resulting in a homologous recombinant Bacillus subtilis that inhibits Escherichia coli. The homologous recombinant Bacillus subtilis obtained by this invention possesses a novel function of inhibiting Escherichia coli.

[0018] This homologous recombinant Bacillus subtilis can be used to prevent and treat gastrointestinal diarrheal diseases in livestock and poultry caused by Escherichia coli, and has great application prospects. This invention endows Bacillus subtilis with a novel function of inhibiting Escherichia coli.

[0019] This invention establishes a method for efficient expression and secretion of exogenous proteins in Bacillus subtilis based on lactose and IPTG substrate-induced homologous recombination targeting the β-GAL coding region. This method has important theoretical and practical guiding significance for subsequent expression of exogenous proteins using homologous recombination of Bacillus subtilis-specific metabolic enzyme genes. Attached Figure Description

[0020] Figure 1 The results of PCR amplification of the upstream homologous arm of the β-GAL coding region of Bacillus subtilis 168 are shown. M: Takara DL1000 DNA Marker; Empty: Blank control, H2O; Negative: Negative control, E. coli amplification product; 1–3: Genomic DNA amplification product (644 bp).

[0021] Figure 2 The results of PCR amplification of the signal peptide-black soldier fly cephalosporin-based antimicrobial peptide CLP1 ligation fragment are shown. In the figures, M: TakaraDL1000 DNA Marker; Empty: Blank control, H2O; Negative: Negative control, E. coli amplification product; 1–3: Genomic DNA amplification product (643 bp).

[0022] Figure 3 The results of PCR amplification of the downstream homologous arm of the β-GAL coding region of Bacillus subtilis 168 are shown. M: TakaraDL1000 DNA Marker; Empty: Blank control, H2O; Negative: Escherichia coli; 1–3: amplified products of pUC57-CLP1 plasmid (265 bp).

[0023] Figure 4 Agarose gel electrophoresis results of homologous recombination expression cassettes constructed for overlap PCR. M: Takara DL2000 DNA Marker; empty: blank control; H2O; 1-6: homologous recombination expression cassettes of fusion PCR products (1492 bp).

[0024] Figure 5 PCR validation of the recombinant vector pHY300PLK-CLP1. M: TakaraDL10000 DNA Marker; negative: empty pHY300PLK vector; 1-4: homologous recombinant expression vector pHY300PLK-CLP1.

[0025] Figure 6 Sequence alignment of the sequencing results of the homologous recombination expression vector pHY300PLK-CLP1.

[0026] Figure 7 The results of electroporation of Bacillus subtilis competent cells on plate culture.

[0027] Figure 8 The results are PCR identification of Bacillus subtilis transformed by recombinant plasmids. M: TakaraDL2,000 DNA Marker; Negative: Bacillus subtilis 168; Positive: pHY300PLK300-CLP1 recombinant vector; 1-5: Positive recombinants of Bacillus subtilis transformed by recombinant plasmids.

[0028] Figure 9 The results show the homologous recombination identification of single colonies from generations 15 (A), 20 (B), 25 (C), 30 (D), and 35 (E). Specifically, A, M: Takara DL5000 DNA Marker, negative: Bs2750, 1-7: PCR identification of homologous recombination results using primer pair 1 for single colonies of the 15th generation electroporated bacteria, 8-14: PCR identification of homologous recombination results using primer pair 1 for single colonies of the 15th generation electroporated bacteria. BE, M: Takara DL5000 DNA Marker, negative: H2O, 1: Bacillus subtilis 168 not electroporated, 2-22: single colonies of the 20th generation (C) and 20th generation (C) electroporated bacteria.

[0029] Figure 10 The gene sequencing results are for a single colony of homologous recombinant bacteria with double crossover.

[0030] Figure 11 This is a preliminary screening for homologous recombinant Bacillus subtilis clones without antibiotic-resistant vectors. In the image, a represents LB plates without tetracycline, b represents plates with tetracycline, and the colonies within the blue circle are those to be passaged further.

[0031] Figure 12 Further screening of homologous recombinant Bacillus subtilis clones without antibiotic resistance vectors. In the figures, a represents LB plates without tetracycline, and b represents plates with tetracycline.

[0032] Figure 13 PCR validation of Bacillus subtilis clones homologous recombinant without antibiotic resistance vectors. M: TakaraDL5000 DNA Marker; Empty: Blank control, H2O; Negative: Wild-type genome PCR amplification product (3261 bp); Positive: Recombinant vector containing antibiotic resistance gene; 1–14: PCR product of homologous recombinant bacteria without antibiotic resistance vector (1445 bp).

[0033] Figure 14The growth curve of homologous recombinant bacteria was determined.

[0034] Figure 15 The results show the stability of the CLP1 gene after passage of the homologous recombinant bacteria. In section a, a represents the PCR amplification result of the CLP1 gene in the homologous recombinant bacteria after 40 passages, and b represents the sequencing result of the CLP1 gene in the homologous recombinant bacteria after 40 passages. In section a, M: TakaraDL1000 DNA Marker; negative: wild-type Bacillus subtilis 168; positive: primary homologous recombinant bacteria; 1–10: bacterial cultures of recombinant bacteria from passages 1, 2, 5, 10, 15, 20, 25, 30, 35, and 40.

[0035] Figure 16 This study analyzed the concentration and time of IPTG-induced β-GAL enzyme activity in wild-type fungi. Different letters indicate significant differences between groups (P < 0.05, n = 3), and the same applies below.

[0036] Figure 17 To analyze the concentration and time of β-GAL mRNA expression induced by IPTG in wild-type bacteria.

[0037] Figure 18 To analyze the concentration and time of β-GAL enzyme activity induced by lactose in wild-type fungi.

[0038] Figure 19 To analyze the concentration and time of β-GAL mRNA expression induced by lactose in wild-type bacteria.

[0039] Figure 20 To analyze the concentration and time of CLP1 mRNA expression induced by IPTG in homologous bacteria.

[0040] Figure 21 To analyze the concentration and time of CLP1 mRNA expression in lactose-induced homologous bacteria.

[0041] Figure 22 This study investigated the inhibitory effect of homologous recombinant bacteria on *Clostridium perfringens*. In the diagram, *a* represents the supernatant of the homologous recombinant bacterial culture, and *b* represents the lysed bacterial cells. In *a*, 1: ampicillin sodium indicator; 2: LB medium; 3: supernatant of uninduced wild-type bacteria; 4: supernatant of wild-type bacteria induced with 0.8 μM IPTG for 6 h; 5: supernatant of uninduced recombinant bacteria; 6: supernatant of recombinant bacteria induced with 0.8 μM IPTG. In *b*, 1: ampicillin sodium indicator; 2: PBS buffer; 3: lysed cells of uninduced wild-type bacteria; 4: lysed cells of homologous recombinant bacteria induced with 0.8 μM IPTG for 6 h; 5: lysed cells of uninduced recombinant bacteria; 6: lysed cells of recombinant bacteria induced with 0.8% lactose for 6 h. The same applies below.

[0042] Figure 23 The inhibitory effect of homologous recombinant bacteria on Listeria monocytogenes is shown. In this diagram, a represents the supernatant of the homologous recombinant bacterial culture, and b represents the lysate of the homologous recombinant bacterial cells.

[0043] Figure 24 The inhibitory effect of homologous recombinant bacteria on Escherichia coli is shown. In this figure, a represents the supernatant of the homologous recombinant bacterial culture, and b represents the lysate of the homologous recombinant bacterial cells.

[0044] Figure 25 The effect of homologous recombinant bacteria on the growth curve of Escherichia coli is shown. In the figure, a represents the supernatant of the homologous recombinant bacterial culture, and b represents the homologous recombinant bacterial cell lysate.

[0045] Figure 26 The inhibitory effect of homologous recombinant bacteria on Salmonella is shown. In this diagram, a represents the supernatant of the homologous recombinant bacterial culture, and b represents the lysate of the homologous recombinant bacterial cells.

[0046] Figure 27 The effect of homologous recombinant bacteria on the growth curve of Salmonella is shown. In the figure, a represents the supernatant of the homologous recombinant bacterial culture, and b represents the homologous recombinant bacterial cell lysate. Detailed Implementation

[0047] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0048] Bacillus subtilis exhibits no significant codon bias, making it an excellent choice for expressing exogenous proteins. Efficient expression of black soldier fly antimicrobial peptide genes in Bacillus subtilis represents a potentially important approach to obtaining black soldier fly antimicrobial peptide proteins for the treatment of gastrointestinal diseases caused by Gram-negative bacteria such as Escherichia coli.

[0049] Conventional techniques for expressing heterologous proteins using Bacillus subtilis as the starting strain involve using free plasmids to carry foreign genes for expression within bacteria. However, this method of introducing plasmids into the bacterial cells has drawbacks such as plasmid instability, reliance on antibiotics, and easy loss of plasmids after bacterial passage.

[0050] Homologous recombination technology involves the homologous recombination of exogenous DNA with chromosomal DNA, resulting in the inactivation (or deletion) or sequence alteration of specific genes in cells. This achieves precise site-specific modification and gene editing, making it the most widely used gene editing technology. It also has broad application prospects in medical research and agricultural breeding. In recent years, domestic and international research has found that using integrative plasmids to express heterologous proteins through homologous recombination in Bacillus subtilis offers advantages in terms of higher efficiency and stability.

[0051] The challenge in expressing heterologous proteins in Bacillus subtilis using homologous recombination technology lies in identifying which genes can be replaced by exogenous genes without affecting bacterial growth, and ensuring efficient expression of heterologous proteins undergoing homologous recombination. In model organisms such as Escherichia coli, the efficiency of spontaneous homologous recombination is at the part-in-a-million level. Therefore, after transforming the homologous recombination vector into Bacillus subtilis, effective screening is necessary to obtain homologous recombination strains from strains that have never undergone homologous recombination.

[0052] Under natural and artificial cultivation conditions, Bacillus subtilis can selectively utilize surrounding nitrogen and carbon sources. As a result, some genes that decompose nutrient substrates can become non-essential genes and can be knocked out by homologous recombination without affecting bacterial growth and reproduction.

[0053] β-galactosidase (β-GAL) is a glycosidic hydrolase, officially named β-D-galactoside galactohydrolase (EC3.2.1.23), commonly known as lactase. It catalyzes the hydrolysis of β-1,4 glycosidic bonds and the conversion to galactosylation. Under natural and artificial culture conditions, when lactose is absent but other carbon sources are present, this gene does not need to be expressed, suggesting that it can be knocked out by homologous recombination without affecting bacterial growth and reproduction.

[0054] To adapt to their environment, microorganisms possess metabolic enzyme genes that decompose nutrient substrates, which can be induced to be expressed in large quantities by the nutrient substrates. Previous transcriptomic studies by the inventors have shown that β-GAL exhibits higher expression levels compared to other metabolic enzymes such as lactate dehydrogenase in the presence of lactose in the culture medium. It is hypothesized that lactose and its analogues (such as isopropyl-β-D-thiogalactopyranoside, i.e., IPTG) can induce activation of the β-GAL gene promoter, leading to the high expression of its downstream coding sequence.

[0055] Further speculation suggests that by using homologous recombination technology to replace the coding region of the β-GAL gene with exogenous genes such as CLP1, lactose and its analogue IPTG can still induce a large expression of exogenous genes such as CLP1.

[0056] This invention relates to a homologous recombinant Bacillus subtilis strain with the CLP1 gene from the black soldier fly larvae and its construction method: By using homologous recombination, the coding region of the CLP1 gene from the black soldier fly larvae is replaced with the coding region of the β-galactosidase (β-GAL) gene from Bacillus subtilis 168. A method for producing homologous recombinant Bacillus subtilis strain that significantly inhibits the growth of Escherichia coli was obtained by induction with lactose and IPTG.

[0057] This invention provides a recombinant expression cassette of the homologous recombinant black soldier fly CLP1 gene, comprising an upstream homologous arm sequence of the coding region of the β-galactosidase gene, the CLP1 gene sequence, and a downstream homologous arm sequence of the coding region of the endonuclease-1,4-β-D-glucanase gene.

[0058] In some specific implementations, the nucleotide sequence is shown in SEQ ID NO.5.

[0059] This invention also provides a recombinant expression vector for the homologous recombinant black soldier fly CLP1 gene, wherein the recombinant expression vector uses pHY300PLK as a backbone and includes the recombinant expression cassette.

[0060] This invention also provides a recombinant Bacillus subtilis gene containing the homologous recombinant black soldier fly CLP1 gene, using Bacillus subtilis 168 as the starting strain, and containing the recombinant expression cassette or the recombinant expression vector.

[0061] The present invention also provides the application of the recombinant expression cassette, the recombinant expression vector, or the recombinant Bacillus subtilis in the preparation of drugs for preventing and treating diseases caused by Escherichia coli.

[0062] This invention also provides a drug for preventing and treating diseases caused by Escherichia coli, including the recombinant Bacillus subtilis.

[0063] This invention uses Bacillus subtilis strain 168 as the starting strain, knocks out the coding region of the β-galactosidase (β-GAL) gene, and integrates the coding region of the black soldier fly CLP1 gene. Using lactose and IPTG induction, a homologous recombinant Bacillus subtilis strain that significantly inhibits the growth of Escherichia coli was obtained. This recombinant bacterium can be used as an animal health product for the prevention and treatment of intestinal diarrhea in pigs and chickens caused by Escherichia coli.

[0064] To achieve stable and efficient expression of the CLP1 gene in Bacillus subtilis, this invention utilizes homologous recombination to replace the coding region of the β-galactosidase (β-GAL) gene in Bacillus subtilis 168 with the CLP1 gene while retaining the signal peptide sequence of the coding region. This resulted in a genetically engineered Bacillus subtilis strain that expressed a large amount of the CLP1 gene induced by lactose and IPTG.

[0065] CLP1 is a mature peptide of the antimicrobial peptide (NCBI Genebank Accession: XP_037920142) with codon-optimized sequence containing a transcription terminator sequence, as shown in SEQ ID NO.4.

[0066] This invention provides a method for constructing the above-mentioned homologous recombinant Bacillus subtilis, comprising the following steps: The upstream and downstream homologous arms of the signal peptide downstream coding region of the β-GAL gene were artificially synthesized, as were the signal peptide sequence of Bacillus subtilis endo-β-1,3-1,4 glucanase and the recombinant fragment of the coding region of the CLP1 gene, a black soldier fly cephalosporin-like antimicrobial peptide. The sequences were ligated using overlap PCR to obtain the homologous recombination expression cassette sequence (upstream homologous arm-signal peptide-CLP1-downstream homologous arm).

[0067] Using the seamless splicing PCR method, the above homologous recombination expression cassette was ligated into the BamHI site of the Escherichia coli-Bacillus subtilis shuttle expression vector pHY300PLK to construct the homologous recombination expression vector, named pHY300PLK-CLP1.

[0068] The homologous recombinant expression vector pHY300PLK-CLP1 was electrotransformed into competent Bacillus subtilis using conventional methods.

[0069] The electroporated competent Bacillus subtilis was further passaged in LB liquid medium and agar medium containing tetracycline. At the same time, the pHY300PLK-CLP1 recombinant sequence was amplified by PCR. After multiple rounds of streak plate culture, positive transformed clones were obtained through screening.

[0070] Positive transformed clones were further passaged in LB liquid medium and agar medium containing antibiotics. At the same time, the genome-CLP1 recombination sequence was amplified by PCR. After multiple rounds of streak plate culture and sequence determination, homologous recombination positive clones were obtained (these clones have undergone the target homologous recombination but still contain the pHY300PLK-CLP1 plasmid).

[0071] Homologous recombination positive clones containing the pHY300PLK-CLP1 plasmid were further passaged in antibiotic-free LB liquid medium and agar medium. At the same time, the genome-CLP1 recombination sequence was amplified by PCR. After multiple rounds of streak plate culture and sequence determination, homologous recombination positive clones without the pHY300PLK-CLP1 plasmid were obtained, which were the target strains.

[0072] Wild-type Bacillus subtilis strain 168 and target homologous recombination positive clones were cultured to screen for optimal conditions for inducing β-GAL gene mRNA expression and enzyme activity enhancement, as well as CLP1 mRNA expression, using lactose and IPTG substrates. The optimal concentrations and induction times of lactose and IPTG substrates for inducing β-GAL expression were: 0.6 μM IPTG for 6 h and 1% lactose for 2 h.

[0073] The Oxford cup inhibition assay and growth inhibition assay were used to detect the inhibitory effects of the target homologous recombinant positive clone on *Escherichia coli*, *Clostridium perfringens*, *Listeria monocytogenes*, and *Salmonella*. The results showed that the recombinant bacteria had a significant inhibitory effect on *Escherichia coli*.

[0074] The starting strain of this invention, Bacillus subtilis 168 (ATCC 23857), was purchased from the Shanghai Center for Microbial Culture Collection (SHBCC), strain number SHBCC D25186.

[0075] Example 1 Construction of the integration expression vector pHY300PLK-CLP1 for homologous recombination double exchange (1) Design and artificially synthesize a 600bp upstream homologous arm sequence for replacing the coding region of the β-galactosidase (β-GAL) gene of Bacillus subtilis 168, as shown in SEQ ID NO.1 (NCBIGenebankAccession: NC_000964, Region: 3502420-3503019).

[0076] SEQ ID NO.1:

[0077] Using Bacillus subtilis 168 genomic DNA as a template, the upstream homologous arm of β-GAL was amplified by PCR using primers. This sequence contained the upstream portion of the BamHI restriction endonuclease site of the pHY300PLK vector, a 600 bp upstream homologous arm of β-GAL, a partial signal peptide, and the CLP1 coding region sequence (this sequence is a partial sequence used for primer synthesis in the next step). After confirming the band size by electrophoresis, the band was excised from the gel and sequenced, yielding the upstream homologous arm, which was 644 bp in size. Figure 1 ).

[0078] (2) Design and artificially synthesize a 600bp downstream homologous arm sequence to replace the coding region of the Bacillus subtilis endonuclease-1,4-β-D-glucanase gene (genebank ID: 938607), as shown in SEQ ID NO.2 (NCBIGenebankAccession: NC_000964, Region: 3505081-3505680).

[0079] SEQ ID NO.2:

[0080] Using Bacillus subtilis 168 genomic DNA as a template, the downstream homologous arm was amplified by PCR using primers. This sequence contained a portion of the CLP1 coding region (this sequence was used for primer synthesis in the next step), a 600 bp β-GAL downstream homologous arm, and a portion of the downstream sequence of the BamHI restriction endonuclease site of pHY300PLK. After confirming the band size by electrophoresis, the band was excised and sequenced. The results showed that the downstream homologous arm was successfully amplified, with a size of 643 bp. Figure 2 ).

[0081] (3) Design the signal peptide sequence (NCBI Genebank Accession: NC_000964, Region: 4012487-4012570), as shown in SEQ ID NO.3.

[0082] SEQ ID NO. 3: atgccttatctgaaacgagtgttgctgcttcttgtcactggattgtttatgagtttgtttgcagtcacttctactgcctcggct.

[0083] (4) The mature peptide of antimicrobial peptide CLP1 (NCBI Genebank Accession: XP_037920142) was designed and the sequence containing the transcription terminator sequence was optimized by codons, as shown in SEQ ID NO.4.

[0084] SEQ ID NO. 4: agttggttcaaaaaagtgttcaagccagtggaaaaagtcggtcagagagttcgagatgctggaattcaagggctaaccatagcccagcaaggagctaatgttttggctacggctcgaggaggaccaccgcattaa.

[0085] (5) The company artificially synthesized the signal peptide-CLP1 tandem sequence to obtain the pUC57-signal peptide-CLP1 plasmid. Using this plasmid as a template, the signal peptide-CLP1 gene ligation fragment was amplified by PCR using primers to obtain the exogenous gene for homologous recombination. This sequence contains part of the upstream homologous arm sequence of β-GAL, the target gene signal peptide-CLP1 gene ligation fragment, and part of the downstream homologous arm sequence of β-GAL. After confirming the band size by electrophoresis, the band was excised and recovered by gel extraction and sequencing analysis to obtain the target sequence, which is 265 bp in size. Figure 3 ).

[0086] (6) The upstream homologous arm-signal peptide-CLP1-downstream homologous arm tandem sequence was obtained by overlap extension PCR, and a homologous recombination expression cassette was constructed. This sequence has a pHY300PLK (4872 bp) BamHI restriction site and its upstream and downstream homologous sequences at both ends. Agarose gel electrophoresis results showed that a 1492 bp homologous recombination expression cassette and its upstream and downstream homologous adapter sequences were successfully amplified, and the homologous recombination expression cassette was 1419 bp in size, as shown in SEQ ID NO. 5. Figure 4 ).

[0087]

[0088] The linearized plasmid pHY300PLK and its upstream homologous arm-signal peptide-CLP1-downstream homologous arm tandem sequence (1419 bp) were seamlessly cloned to construct a homologous recombination expression vector, named pHY300PLK-CLP1. After transforming this vector into competent E. coli cells, the plasmid was extracted and subjected to agarose gel electrophoresis. The electrophoresis results are shown below. Figure 5 As shown, the successfully ligated recombinant expression vector pHY300PLK-CLP1 is the same size as expected (6297 bp). Sequencing and alignment of the recombinant vector pHY300PLK-CLP1 confirmed sequence identity, indicating successful construction of the homologous recombinant expression vector pHY300PLK-CLP1. Figure 6 ).

[0089] Example 2 Electroporation of Bacillus subtilis using the homologous recombination expression vector pHY300PLK-CLP1 and screening of positive electroporation clones: Preparation of competent cells of Bacillus subtilis: Bacillus subtilis 168 was streaked onto LB agar plates in a clean bench and incubated at 37°C in a water-jacketed incubator for 12 hours. A single colony of Bacillus subtilis from the plate was picked and inoculated into an Erlenmeyer flask containing 5 mL of LB liquid medium and incubated overnight at 37°C with a shaker at 200 rpm. 2.5 mL of the cultured bacterial solution was inoculated into an Erlenmeyer flask containing 40 mL of growth medium and incubated at 37°C with a shaker at 200 rpm for 4–5 hours. The cultured bacterial solution was transferred to two sterile 50 mL centrifuge tubes, incubated on ice for 10 minutes, and then centrifuged at 6000 g at 4°C for 10 minutes in a centrifuge pre-chilled at 4°C. The supernatant in the 50 mL centrifuge tubes was carefully discarded, and the cells were gently resuspended in 25 mL of pre-chilled electroporation wash buffer and centrifuged at 6000 g at 4°C for 10 minutes in a centrifuge pre-chilled at 4°C. This process was repeated four times. Carefully discard the supernatant in the 50 mL centrifuge tube, gently resuspend the precipitate with 1 mL of electroporation wash buffer, and aliquot 60 μL into a 1.5 mL EP tube and store at -80°C.

[0090] Electroporation of Bacillus subtilis competent cells with the homologous recombinant expression vector pHY300PLK-CLP1: Remove Bacillus subtilis competent cells from the -80℃ freezer and thaw on ice. Add 3-5 μL of the homologous recombinant expression vector pHY300PLK-CLP1 to the dispensed competent cells, gently mix with a pipette tip, and incubate on ice for 10 min. Transfer the liquid from the tube to a clean, UV-sterilized electroporation cuvette. Turn on the electroporator, wipe the cuvette clean, and place it in the electroporator. Set the voltage to 2500 V, resistance to 200 Ω, capacitance to 25 μF, and time to 4 ms, and begin electroporation. After electroporation, quickly add 1 mL of recovery medium to the cuvette, mix with a pipette tip, transfer to a clean 1.5 mL EP tube, and incubate at 37℃ on a shaker at 200 rpm for 3 h. After 3 hours of culture, the bacterial culture was centrifuged at 4000 rpm for 5 minutes, and 900 μL of supernatant was discarded. The precipitate was resuspended in the remaining supernatant and evenly spread onto LB agar plates with a final tetracycline concentration of 15 μg / mL. The plates were incubated upright at 37°C for 30 minutes until the bacterial culture was completely absorbed. Then, the plates were inverted and incubated overnight. The transformation results are as follows. Figure 7 As shown in the figure, the results indicate that positive transformed colonies were successfully obtained.

[0091] Identification of Bacillus subtilis by electroporation: Positive strains from electroporation plates were transferred to LB liquid medium with a tetracycline concentration of 15 μg / mL and cultured at 37°C with a shaker at 180 r / min for 12 h. Using the bacterial culture as a template, primers were designed for PCR amplification of the homologous recombination expression cassette sequence. The PCR-positive bacterial cultures were retained. Results are shown below. Figure 8 As shown, the obtained single colony contained the target fragment (1492bp), proving that the recombinant expression vector pHY300PLK-CLP1 had been successfully transformed into Bacillus subtilis.

[0092] Example 3 Screening for positive clones of homologous recombinant Bacillus subtilis containing transformation vectors: After transforming the pHY300PLK-CLP1 homologous recombination vector into Bacillus subtilis, the rate of natural homologous recombination is extremely low, necessitating effective screening to obtain homologous recombination strains from pHY300PLK-CLP1-transformed positive strains that have never undergone homologous recombination. This invention obtains homologous recombination-positive clones of Bacillus subtilis through continuous culture and PCR identification of pHY300PLK-CLP1-transformed positive strains.

[0093] PCR identification method: In recombinant bacteria that have undergone homologous recombination double crossover, after the CLP1 gene replaces the β-GAL gene, the bands amplified using primers for the upstream and downstream homologous arms of Bacillus subtilis β-GAL should differ from those of the original Bacillus subtilis. Therefore, two pairs of primers were designed to amplify the sequences between the upstream and downstream homologous arms to screen for double-crossover recombinant bacteria and determine whether electroporation-positive strains have undergone homologous recombination. If no double crossover occurs, the amplified bands will be approximately 3461 bp and 3886 bp in size. If homologous recombination occurs, the double-crossover bands will be 1625 bp and 2050 bp. If double bands (non-crossover band and double-crossover band) appear on electrophoresis, it indicates that the colony contains both non-crossover electroporated bacteria and homologous recombinant bacteria, therefore further purification is needed to obtain the recombinant bacteria.

[0094] The pHY300PLK-CLP1 transformed positive strain was passaged in LB solid plates and liquid medium with a final tetracycline concentration of 15 μg / mL. Figure 9 In strain A, at the 15th generation, identical single colonies were selected, and homologous recombination was simultaneously identified using two pairs of primers. The results showed that homologous recombination occurred in parts of four single colonies. Single colonies with brighter homologous recombination bands were selected and further streaked and passaged on LB agar plates with a final tetracycline concentration of 15 μg / mL. PCR identification was performed every 5 generations. The results for generations 20, 25, 30, and 35 are as follows: Figure 9 As shown in the BE diagram, during the screening process, the bands that have undergone homologous recombination become brighter and brighter, while the bands that have not undergone recombination become darker and darker, until finally the bands that have not undergone recombination disappear, and only the bands that have undergone homologous recombination are displayed. Therefore, the bacterial culture that has successfully undergone homologous recombination is obtained.

[0095] Single colonies with double crossover were sent for testing. Sequence consistency sequencing results confirmed that the coding region of the β-GAL gene was replaced by the CLP1 gene, resulting in single colonies of tetracycline-resistant homologous recombinant bacteria with double crossover. Figure 10 ).

[0096] Example 4 Screening for positive clones of homologous recombinant Bacillus subtilis that have lost their transformation vector: Since Bacillus subtilis itself does not have tetracycline resistance, when screening for homologous recombinant bacteria using a culture medium containing tetracycline antibiotics, the pHY300PLK vector still remains in the positive clones of Bacillus subtilis that have undergone homologous recombination. Therefore, it is necessary to screen for antibiotic-free recombinant bacteria that have lost the residual pHY300PLK vector to avoid the target recombinant bacteria having antibiotic resistance.

[0097] Preliminary screening of Bacillus subtilis clones with homologous recombination without antibiotic vector: Positive Bacillus subtilis clones exhibiting homologous recombination were streaked onto LB agar plates without tetracycline. Single colonies were then picked and transferred to LB agar plates with a final tetracycline concentration of 15 μg / mL and LB agar plates without tetracycline, respectively, and matched one-to-one. Figure 11 As shown, the recombinant bacteria can grow on both tetracycline-resistant plates and tetracycline-free LB plates, while Figure 11 The single colonies circled in blue in the middle b are in their corresponding Figure 11 The colonies on the tetracycline-resistant plate were smaller, and these colonies were selected for the next step of isolation and culture.

[0098] Further screening of the homologous recombinant Bacillus subtilis clone without the resistance vector: The above-mentioned colonies were further streaked onto tetracycline-free LB agar plates and cultured. Single colonies were then picked and cultured onto LB agar plates with a final tetracycline concentration of 15 μg / mL and LB agar plates without tetracycline, respectively. Growth results are as follows... Figure 12 As shown, this corresponds to LB plate culture without tetracycline ( Figure 12 (a) The plate with added tetracycline contained a large number of ungrown recombinant bacteria. Figure 12 (b) These strains that did not grow on tetracycline-added plates but grew on tetracycline-free LB plates are the homologous recombinant Bacillus subtilis clones without the resistance vector.

[0099] PCR verification of Bacillus subtilis clones without antibiotic resistance vector homologous recombination: Single colonies of Bacillus subtilis without antibiotic resistance vector that grew on LB plates without tetracycline but did not grow on tetracycline-resistant plates were further verified by PCR. The genomic homologous recombination sequence was amplified, proving that the obtained colonies were positive clones of Bacillus subtilis homologous recombination that had obtained the CLP1 fragment and did not have the pHY300PLK expression vector. Figure 13 ).

[0100] Example 5 Growth curves and exogenous gene stability analysis of homologous recombinant Bacillus subtilis: Growth curve determination of homologous recombinant bacteria: After inoculating with Bacillus subtilis 168 and homologous recombinant bacteria culture, respectively, the culture was shaken and the OD was measured every 2 h. 600 Absorbance values ​​were used to analyze the growth curves of the two bacteria over 24 hours. Figure 14 The results indicate that there is no significant difference in growth performance between the recombinant strain and the wild-type Bacillus subtilis 168.

[0101] Stability test results of CLP1 gene after passage of homologous recombinant bacteria: The homologous recombinant bacteria were still able to amplify the CLP1 gene fragment after 40 passages. Figure 15 (a), and the sequencing results of the CLP1 fragment amplified in the 40th generation are consistent with the target sequence ( Figure 15(b) indicates that homologous recombinant bacteria possess gene stability and recombination stability.

[0102] Example 6 Establishment of conditions for inducing homologous recombinant Bacillus subtilis CLP1 gene expression: Concentration and time analysis of IPTG-induced β-GAL enzyme activity in wild-type fungi: Figure 16 As shown, there were significant differences in β-GAL enzyme activity between Bacillus subtilis and uninduced Bacillus subtilis after induction with different concentrations and durations of IPTG. Induction with 0.6, 0.8, and 1.0 μM IPTG for 2 h, 4 h, and 6 h resulted in average β-GAL enzyme activities of 0.158, 0.160, and 0.173, respectively. All induced groups showed varying degrees of improvement, with the highest β-GAL enzyme activity (0.241) observed after 6 h of induction with 0.6 μM IPTG. This concentration and time were considered as one of the optimal induction conditions for IPTG and used for subsequent screening.

[0103] Concentration and time analysis of β-GAL mRNA expression induced by isopropyl-β-D-thiogalactoside (IPTG) in wild-type bacteria: Bacillus subtilis cultured to its OD value 168 600 When the value was in the range of 0.6~0.7, 0, 0.6 μM, 0.8 μM, and 1 μM IPTG were added to the bacterial culture, respectively. The culture was incubated at 37 ℃ in a shaker at 180 r / min for 2 h, 4 h, and 6 h, respectively. RNA was extracted and reverse transcribed into cDNA immediately after the incubation period. After a 10-fold dilution, 16S rRNA of Bacillus subtilis 168 was used as an internal control for qPCR to obtain the ΔCT value of the β-GAL gene. The experimental groups were those with added inducer, and the control group was the same as the experimental groups but without added inducer. ΔCT = target gene CT value - mean internal control gene CT value; ΔΔCT = experimental group ΔCT - control group ΔCT. The 2-1 values ​​were calculated. -ΔΔCT For the expression quantity.

[0104] Depend on Figure 17As shown, the expression levels of the β-GAL gene in Bacillus subtilis 168 induced by different concentrations and durations of IPTG showed significant differences compared to the uninduced strain. At 2 h of induction, the expression levels induced by 0.6 μM IPTG were 1.52, 0.8 μM IPTG were 3.37, and 1 μM IPTG were 2.56, showing a trend of first increasing and then decreasing. At 4 h of IPTG induction, the levels were 3.58, 3.12, and 5.77, respectively, showing a trend of first decreasing and then increasing. At 6 h of IPTG induction, the levels were 1.46, 10.56, and 2.78, respectively, showing a trend of first increasing and then decreasing. The β-GAL gene mRNA expression level induced by 0.8 μM IPTG for 6 h was approximately 11-fold higher than the uninduced β-GAL gene mRNA expression level. This concentration and time were considered as one of the optimal induction conditions for IPTG and used for subsequent screening.

[0105] Concentration and time analysis of β-GAL enzyme activity induced by lactose in wild-type fungi: Figure 18 As shown, after inducing Bacillus subtilis with different concentrations and times of lactose, there were significant differences in β-GAL enzyme activity between the uninduced and non-induced β-GAL enzyme activities. After induction with 0.8%, 1.0%, and 1.2% lactose for 2 h, 4 h, and 6 h, respectively, the average β-GAL enzyme activities of the uninduced Bacillus subtilis were 0.158, 0.160, and 0.173, respectively. The induced groups all showed varying degrees of improvement, with the highest β-GAL enzyme activity observed in Bacillus subtilis induced with 1% lactose for 2 h. This concentration and time were selected as one of the optimal induction conditions for IPTG and used for subsequent screening.

[0106] Concentration and time analysis of β-GAL mRNA expression induced by lactose in wild-type bacteria: Figure 19 As shown, the expression levels of the β-GAL gene in Bacillus subtilis induced by different concentrations and durations of lactose showed significant differences compared to the uninduced strain. At 2 h of induction, the expression levels induced by 0.8% lactose were 2.81, 1.0% lactose were 4.31, and 1.2% lactose were 5.93, showing an increasing trend. At 4 h of induction, the values ​​were 4.07, 2.26, and 1.17, respectively, showing a decreasing trend. At 6 h of induction, the values ​​were 1.44, 2.88, and 1.54, respectively, showing an initial increasing trend followed by a decrease. The β-GAL gene mRNA expression level induced by 1.2% lactose for 2 h was nearly 6 times higher than the uninduced β-GAL gene mRNA expression level. This concentration and time were considered as one of the optimal induction conditions for IPTG and used for subsequent screening.

[0107] Analysis of the concentration and time of CLP1 mRNA expression induced by IPTG in homologous bacteria: Culture homologous recombinant Bacillus subtilis to its OD 600 When the value was in the range of 0.6~0.7, IPTG was added to the bacterial culture at concentrations of 0, 0.6 μM, 0.8 μM, and 1 μM, respectively. The culture was incubated at 37 ℃ in a shaker at 180 r / min for 2 h, 4 h, and 6 h, respectively. RNA was extracted and reverse transcribed into cDNA immediately after the incubation period. After a 10-fold dilution, qPCR was performed using 16S rRNA of Bacillus subtilis 168 as an internal control to obtain the ΔCT value of the CLP1 gene. The experimental groups were those with added inducer, and the control group was the same as the experimental groups but without added inducer. ΔCT = target gene CT value - mean CT value of internal control gene; ΔΔCT = experimental group ΔCT - control group ΔCT. The 2-1 values ​​were calculated. -ΔΔCT For the expression quantity.

[0108] Depend on Figure 20 As shown, the expression levels of the CLP1 gene in Bacillus subtilis induced by different concentrations and durations of IPTG showed significant differences compared to the uninduced CLP1 gene. At 2 h of induction, the expression levels induced by 0.6 μM IPTG were 2.34, 0.8 μM IPTG were 3.95, and 1 μM IPTG were 1.87, showing an initial increase followed by a decrease. At 4 h of IPTG induction, the levels were 1.87, 2.23, and 5.91, respectively, showing an increasing trend. At 6 h of IPTG induction, the levels were 2.67, 13.80, and 4.60, respectively, showing an initial increase followed by a decrease. The CLP1 gene mRNA expression level induced by 0.8 μM IPTG for 6 h was nearly 14-fold higher than the uninduced CLP1 gene mRNA expression level. Therefore, 0.8 μM IPTG induction for 6 h was used as the IPTG-induced expression condition for homologous recombinant CLP1 gene.

[0109] Analysis of the concentration and time of CLP1 mRNA expression induced by lactose in homologous bacteria: culturing homologous recombinant Bacillus subtilis to its OD... 600 When the pH value was in the range of 0.6-0.7, lactose was added to the bacterial culture at concentrations of 0%, 0.8%, 1%, and 1.2%, respectively. The expression levels of the CLP1 gene in Bacillus subtilis induced by different concentrations and durations of lactose showed significant differences compared to the uninduced CLP1 gene. At 2 h of induction, the expression levels induced by 0.8% lactose were 3.06, 1.0% lactose were 4.75, and 1.2% lactose were 4.93, showing an upward trend. At 4 h of induction, the levels were 5.02, 2.26, and 1.97, respectively, showing a downward trend. At 6 h of induction, the levels were 1.90, 3.81, and 1.19, respectively, showing an initial upward trend followed by a downward trend. The CLP1 gene mRNA expression level induced by 0.8% lactose for 4 h was approximately 5 times higher than the uninduced level. Figure 21 0.8% lactose was used as the IPTG-induced expression condition for homologous recombinant CLP1 gene for 6 h.

[0110] Example 7 Analysis of the inhibitory effects of homologous recombinant Bacillus subtilis on four enteropathogenic bacteria: Inhibitory effect of homologous recombinant bacteria on Clostridium perfringens: The Oxford cup method (6 mm inner diameter, 8 mm outer diameter) was used, with Clostridium perfringens as the indicator bacterium to observe the inhibitory effect of the homologous recombinant bacteria. After 24 h of incubation, the results showed that ampicillin indicator had an inhibition zone with a radius of approximately 12 mm. No inhibition zones were observed in the supernatant and lysed cells of wild-type bacteria induced with 0.8 μM IPTG, and in the recombinant bacteria induced with 0.8 μM IPTG. Figure 22 The results showed that the recombinant bacteria did not have an inhibitory effect on the growth of Clostridium perfringens.

[0111] Inhibitory effect of homologous recombinant bacteria on Listeria monocytogenes: The Oxford cup method (6 mm inner diameter, 8 mm outer diameter) was used, with Listeria monocytogenes as the indicator bacterium to observe the inhibitory effect of homologous recombinant bacteria. After 24 h of incubation, the results showed that ampicillin indicator had an inhibition zone with a radius of approximately 12 mm. No inhibition zones were observed in the supernatant of uninduced wild-type bacteria, inducing wild-type bacteria with 0.8 μM IPTG, or inducing recombinant bacteria with 0.8 μM IPTG. (Note: The original text also mentions no inhibition zones in the supernatant and broken bacterial cells of the recombinant bacteria.) Figure 23 The results showed that the recombinant bacteria did not have an inhibitory effect on the growth of Clostridium perfringens.

[0112] Inhibitory effect of homologous recombinant bacteria on Escherichia coli: The Oxford cup method (6 mm inner diameter, 8 mm outer diameter) was used, with *E. coli* as the indicator bacterium. After culturing for 24 h, the results showed that ampicillin indicator had an inhibition zone with a radius of approximately 15 mm. No inhibition zones were observed in the supernatant of bacterial cultures induced with 0.8 μM IPTG (without wild-type bacteria) or recombinant bacteria (without recombinant bacteria) induced with 0.8 μM IPTG. Figure 24 IPTG at a concentration of 0.8 μM induces an inhibition zone in recombinant bacteria, with a radius of approximately 14 mm.

[0113] The growth curves of the lysed cells of recombinant bacteria induced or not induced by 0.8 μM IPTG were significantly slower than those of LB culture. Figure 25 The results showed that the recombinant bacteria had an inhibitory effect on the growth of Escherichia coli.

[0114] Inhibitory effect of homologous recombinant bacteria on Salmonella: The Oxford cup method (6 mm inner diameter, 8 mm outer diameter) was used, with Salmonella as the indicator bacterium. After 24 h of incubation, the results showed that ampicillin indicator had an inhibition zone with a radius of approximately 12 mm. No inhibition zones were observed in the supernatant and lysed cells of the recombinant bacterial culture induced with 0.8 μM IPTG, which did not induce wild-type bacteria. Figure 26 The results showed that the homologous recombinant bacteria did not have an inhibitory effect on the growth of Salmonella.

[0115] The growth curves of lysed cells of recombinant bacteria induced or not induced with 0.8 μM IPTG showed no significant difference from the growth curves of Salmonella cultured in LB. Figure 27 The results showed that the homologous recombinant bacteria did not have an inhibitory effect on the growth of Salmonella.

[0116] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A recombinant expression cassette of the homologous recombinant black soldier fly CLP1 gene, characterized in that, This includes the upstream homologous arm sequence of the coding region of the β-galactosidase gene, the CLP1 gene sequence, and the downstream homologous arm sequence of the coding region of the endonuclease-1,4-β-D-glucanase gene.

2. The recombinant expression cassette according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

5.

3. A recombinant expression vector for the homologous recombinant black soldier fly CLP1 gene, characterized in that, The recombinant expression vector uses pHY300PLK as its backbone and includes the recombinant expression cassette as described in claim 1 or 2.

4. A recombinant Bacillus subtilis strain containing a homologous recombinant black soldier fly CLP1 gene, characterized in that, The starting strain is Bacillus subtilis 168, and it contains the recombinant expression cassette of claim 1 or 2 or the recombinant expression vector of claim 3.

5. The use of the recombinant expression cassette as described in claim 1 or 2, the recombinant expression vector as described in claim 3, or the recombinant Bacillus subtilis as described in claim 4 in the preparation of drugs for preventing and treating diseases caused by Escherichia coli.

6. A drug for preventing and treating diseases caused by Escherichia coli, characterized in that, Includes the recombinant Bacillus subtilis as described in claim 4.