Library building method for mRNA vaccine quality evaluation based on nanopore sequencing platform

Abstract

The invention relates to a library building method for mRNA vaccine quality evaluation based on a nanopore sequencing platform. The library building method comprises the following steps: S1, preparing an RNA template; s2, connecting a CRTA joint, and performing digestion and purification; s3, carrying out reverse transcription, strand displacement and UMI integration to obtain a reaction solution; s4, rapid bar code connection PCR: adding a bar code primer and a PCR premixed solution into the reaction solution obtained in the step S3, and carrying out a PCR amplification reaction to obtain a PCR product; purifying and eluting by adopting magnetic beads; s5, quickly connecting a joint and sequencing on a machine: adding a quick sequencing library joint, and reacting at room temperature to complete the preparation of the library; and loading to a sequencing platform for sequencing. According to the method, indexes such as sequence consistency, integrity and PolyA length of mRNA vaccine quality evaluation can be comprehensively evaluated through one-time library establishment. The positive correlation exists between the ONT evaluation method and a traditional method, can be used as an important supplement of the traditional detection method, and is suitable for popularization and application.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of vaccine quality evaluation, and relates to a library construction method for mRNA vaccine quality evaluation based on a nanopore sequencing platform. BACKGROUND

[0002] In recent years, mRNA vaccine technology with lipid nanoparticle (LNP) as a delivery system has developed rapidly, and the COVID-19 pandemic has also accelerated the application of mRNA vaccines, bringing revolutionary changes to the global vaccine industry. In 2023, the Nobel Prize in Physiology or Medicine was awarded to Katalin Karikó and Drew Weissman for their breakthrough discovery in nucleotide base modification, which enabled the successful development of COVID-19 mRNA vaccines. mRNA vaccines have great application potential in infectious disease prevention and cancer treatment vaccines. After the COVID-19 vaccine, several mRNA vaccines have been approved for marketing, and hundreds of mRNA vaccines are undergoing clinical trials.

[0003] The successful application of mRNA vaccines is partly due to breakthroughs in production processes, which enable the production of billions of doses of vaccines with sufficient quality and safety. However, strict quality analysis must be performed on mRNA vaccines to assess their sequence integrity and detect contaminants that may reduce their effectiveness or cause side effects. Unidentified quality problems can lead to reduced mRNA effectiveness, poor clinical trial results, and costly project delays, and threaten regulatory approval.

[0004] Currently, mRNA vaccines and therapies still rely on time-consuming and labor-intensive traditional detection methods. Widely used analysis methods include: 1) sequence identification: high-throughput sequencing technology (HTS), Sanger sequencing, real-time fluorescent quantitative reverse transcription polymerase chain reaction (RT-qPCR); 2) integrity assessment: capillary electrophoresis (CE), capillary gel electrophoresis (CGE), agarose gel electrophoresis; 3) purity analysis: reverse phase liquid chromatography mass spectrometry (RP-LC-MS / MS), ion pair reverse phase high performance liquid chromatography (IP-RP-HPLC), and molecular exclusion high performance liquid chromatography (SEC-HPLC), etc. These methods are reliable, but often time-consuming and labor-intensive to operate and maintain, and each can only assess a single quality indicator, and often cannot comprehensively and sensitively detect key mRNA quality characteristics.

[0005] Therefore, there is an urgent need to develop a comprehensive evaluation and analysis method capable of comprehensively, efficiently, and accurately assessing the key quality attributes of mRNA vaccines, including sequence consistency, integrity, and purity. Establishing such a quality evaluation system is of great significance for ensuring quality control throughout the entire mRNA vaccine production process. This invention addresses the pain points in mRNA vaccine quality evaluation by providing a library construction method for mRNA vaccine quality evaluation based on a nanopore sequencing platform, which can comprehensively, efficiently, and accurately assess the key quality attributes of mRNA vaccines. Summary of the Invention

[0006] The purpose of this invention is to provide a library construction method for quality evaluation of mRNA vaccines based on a nanopore sequencing platform, which can comprehensively, efficiently, and accurately assess the key quality attributes of mRNA vaccines, thereby improving the efficiency and reliability of mRNA vaccine production.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by this invention is a library construction method for mRNA vaccine quality evaluation based on a nanopore sequencing platform, the specific steps of which are as follows:

[0008] S1. Prepare the RNA template: Select a full-length RNA with a poly-A tail as the RNA template;

[0009] S2 ligation of CRTA adapter, digestion and purification: The RNA template is mixed with the reverse transcription adapter CRTA (cDNA RTAdapter) and annealing buffer for annealing reaction; then ligation reaction buffer, ligase and recombinant ribonuclease inhibitor (RNaseOUT) are added for ligation reaction; the ligated full-length RNA is digested by Lambda exonuclease and USER enzyme, and finally purified.

[0010] S3 Reverse Transcription, Strand Displacement and UMI Integration: The purified RNA template from step S2 is annealed using RT primers and deoxyribonucleoside triphosphate (dNTPs); then SSPII strand displacement primers are added for SSPII ligation; finally, reverse transcriptase is added and UMI integration is performed to obtain the reaction solution of the reverse transcription product.

[0011] S4 Rapid Barcode PCR: Add barcode primers and PCR premix to the reaction solution obtained in step S3, perform PCR amplification reaction, and obtain PCR products; then purify and elute using magnetic beads;

[0012] S5 Rapid ligation of adapters and sequencing: Add rapid sequencing library adapters to the eluted product from step S4, react at room temperature to complete library preparation; then load the prepared library onto the sequencing platform for sequencing, convert the raw data into sequencing sequences and split the data to obtain sequencing data for each sample; finally, perform bioinformatics analysis on the sequencing data.

[0013] The aforementioned technical solutions suffer from drawbacks because traditional mRNA vaccine quality evaluation methods and their maintenance are time-consuming and labor-intensive. Furthermore, each method can only assess a single quality indicator, failing to comprehensively and sensitively detect key mRNA quality characteristics. Therefore, this invention addresses the pain points of time-consuming and labor-intensive traditional mRNA vaccine quality evaluation methods by optimizing the ONT PCR barcode kit (SQK-PCB111.24). Through a series of wet-laboratory parameter adjustments and a single library construction and sequencing dataset, it can comprehensively evaluate key quality attributes of mRNA vaccines, including sequence consistency, integrity, and PolyA length. This improves the efficiency and reliability of mRNA vaccine production and is of great significance for quality control throughout the entire mRNA vaccine production process. It can serve as an important supplement to traditional detection methods and is suitable for widespread application.

[0014] Preferably, the specific steps of step S2 are as follows:

[0015] S21 reverse transcription adapter ligation: Mix 4-50 ng of polyA-tailed mRNA with 1 µL of reverse transcription adapter cDNA RTAdapter (CRTA) and 1 µL of annealing buffer (AB), then add water to make up to 12 µL. Incubate at 60 °C for 5 min, then incubate at room temperature for 5 min. Then add 3.6 µL of rapid ligation reaction buffer, 1.4 µL of T4 DNA ligase and RNaseOUT ribonuclease inhibitor, mix, and incubate again at 21 °C for 10 min to perform ligation.

[0016] S22 Adapter Digestion: Add 1 µL of Lambda exonuclease and 1 µL of USER enzyme to the reaction system (18 µL) in step S21, incubate at 37 °C for 15 min, and then purify.

[0017] S23 purification: Add RNA Clean XP magnetic beads and mix thoroughly. After adsorption, discard the supernatant. Wash the magnetic beads several times with short fragment buffer (SFB), dry, and then elute with nuclease-free water. Specifically:

[0018] S231: Add 36µL of resuspended RNA-free nucleic acid purification magnetic beads (RNA-free Clean XP magnetic beads) to the above reaction and incubate at room temperature for 5 min;

[0019] S232: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0020] S233: Wash the magnetic beads with 100µL of short fragment buffer (SFB) and discard the supernatant;

[0021] S234: Repeat step S233;

[0022] S235: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0023] S236: The precipitate was resuspended in 12µL of nuclease-free water and incubated at room temperature for 10 min;

[0024] S237: Return the magnetic rack to the tube and transfer 12µL of elution buffer into a clean 0.2mL thin-walled PCR tube.

[0025] Preferably, in step S4, pre-amplification is performed first, followed by multiple cycles of amplification, and then extension is performed after the cycles are completed to obtain PCR products.

[0026] Preferably, in step S4, three standards of different lengths are selected, mixed, and then subjected to cyclic amplification; the number of PCR amplification cycles is 6 to 18. The effect of PCR cycle number shift on the library is evaluated using self-made standards.

[0027] Preferably, the number of PCR amplification cycles is 6 to 10.

[0028] Preferably, the cyclic amplification in step S4 specifically comprises:

[0029] S41 Denaturation: First, add barcode primer BP01-24 (BarcodePrimer (BP01-24)) and PCR amplification reagent (KAPA hot-start HiFi high-fidelity enzyme) to the reaction solution obtained in step S3. Pre-denature at 95℃ for 30s, then denature at 95℃ for 15s and cycle 6~18 times, preferably 6~10 times. For the sequence of barcode primer BP01-24, please refer to the document page on the ONT official website. The barcode01-24 sequence PDF file can be found in the barcode sequences section.

[0030] S42 Annealing: Anneal at 60~65℃ for 15s~45s, and repeat 6~18 times, preferably 6~10 times;

[0031] S43 extension: extend at 65℃ for 60s / kb and cycle 6~18 times, preferably 6~10 times; finally extend for 6min; obtain the amplification product and store at 4℃.

[0032] Preferably, the rapid barcode PCR DNA amplification enzyme in the PCR premix in step S4 includes NEBLongAmp® hot-start Taq DNA polymerase, KAPA hot-start HiFi high-fidelity enzyme, and Takara high-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase; the amplification enzyme is preferably KAPA hot-start HiFi high-fidelity enzyme; the PCR amplification reaction system in step S4 is 25~100µL, preferably 25~50µL.

[0033] Preferably, after the extension reaction in step S43, a specific exonuclease is added to the obtained amplification product to cut and remove excess primers. Specifically, the product is first incubated at 37°C for 15-30 min, and then heated at 80°C for 15 min to inactivate the primers. Then, AMPure XP purification beads are added for purification in step S44.

[0034] Preferably, the purification steps in step S44 are as follows:

[0035] S441: Add 36µL of resuspended AMPure XP purified magnetic beads to the above reaction and incubate at room temperature for 5 min;

[0036] S442: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0037] S443: Wash the magnetic beads with 200µL of 80% ethanol and remove the supernatant;

[0038] S444: Repeat step S443;

[0039] S445: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0040] S446: The precipitate was resuspended in 12 µL of elution buffer and incubated at room temperature for 10 min;

[0041] S447: Return the magnetic rack to the container and transfer 11 µL of elution buffer into a clean 0.2 mL thin-walled PCR tube.

[0042] Preferably, in step S2, the concentration of the reverse transcription adaptor CRTA is 1~2 ng / µL, the adapter ligation time is 10~20 min, the adapter ligation reaction temperature is 21℃, the adapter ligation reaction system is 18µL, the adapter digestion reaction temperature is 37℃, the time is 10~20 min, and the adapter digestion reaction system is 20µL.

[0043] Preferably, the amount of RNA template in step S1 is 4-50 ng.

[0044] Preferably, in step S5, when rapidly ligating adapters and sequencing, the adapter ligation concentration is 1~2µL; and the reaction is incubated at room temperature for 10~20min.

[0045] Preferably, step S3 specifically comprises:

[0046] S31 reverse transcription primer RTP annealing: Mix 1 µL of reverse transcription primer RT, 10 mM of deoxyribonucleoside triphosphate (dNTPs) with 12 µL of purified RNA and incubate at 21 °C for 15 min.

[0047] S32 chain conversion primer SSPII ligation: Add 4.5µL of reverse transcriptase-compatible buffer (5×RT buffer), 1µL of ribonuclease inhibitor RNaseOUT and 2µL of SSPII chain replacement primer to the product (14µL) from step S31, incubate at 42~65℃ for 2~5 min and then add reverse transcriptase.

[0048] S33: First react at 42℃ for 90 min, then react at 85℃ for 5 min to perform reverse transcription and strand conversion, obtain the reverse transcription product, then perform heat inactivation and store at 4℃.

[0049] Preferably, the specific steps of step S5 are as follows:

[0050] S51 Adapter Addition: Add 2µL of Rapid Adapter T (RAPT) to the purified PCR product (10µL), react at room temperature to complete the library preparation;

[0051] S52 sequencing: The prepared library is loaded onto the sequencing chip, and the sequencer is used to perform sequencing. The raw data is converted into cDNA sequences and the data is split to obtain sequencing data, i.e., sample sequencing data.

[0052] Preferably, the specific steps of step S52 are as follows:

[0053] S521: Warmly melt the reagents. Take the buffer solutions, including Sequencing Buffer II (SBII), Loading Beads II (LBII), Flush Tether (FLT), and Flush Buffer (FB), and immediately place them in an ice box after melting. These four reagents form a complete support system of "pretreatment-loading-reaction-maintenance" in the sequencing process: SBII and LBII directly determine the efficiency and accuracy of the sequencing reaction, FLT ensures sequencing continuity, and FB is responsible for chip cleaning and balancing.

[0054] S522: Open the cover of the Nanopore sequencing instrument and turn the cover of the prime port of the flow cell clockwise;

[0055] S523: Check under the cap of the Priming port for air bubbles. Use a pipette to draw a small volume to remove the air bubbles.

[0056] S524: Adjust the 1000µL pipette to 200µL;

[0057] S525: Insert the nozzle into the prime port;

[0058] S526: Slowly adjust the knob until you see a small volume of buffer enter the pipette tip, then remove the pipette.

[0059] S527: Priming mix: Add 30 µL of molten and mixed Flush Tether (FLT) to the melted and mixed Flush Buffer (FB), and mix by pipetting up and down.

[0060] S528: Add 800µL of priming mix to the flow cell through the priming port, avoiding the introduction of air bubbles, and wait for 5 minutes;

[0061] S529: Use a pipette to thoroughly mix SBII and LBII into a new tube, ready for loading the sample library.

[0062] S5210: Open the cover of the SpotON sample port of the flow cell;

[0063] S5211: Add 200 μL of priming mix to the flow cell through the priming port to avoid introducing air bubbles;

[0064] S512: Mix the library by pipetting;

[0065] S513: Add 75 μL of sample to the flow cell through the SpotON sample port, one drop at a time, ensuring that the sample flows into the port before adding the next drop.

[0066] S5214: Carefully close the cap on the SpotON sample port, ensuring the plug is inside the SpotON sample port, and close the Priming port;

[0067] S5215: Sequencing was performed using the third-generation sequencing platform GridION / MinION;

[0068] S5216: Perform bioinformatics analysis on sequencing data.

[0069] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0070] (1) This invention innovatively evaluates the impact of PCR cycle number shift on the library by using self-made standards.

[0071] (2) The present invention adjusts parameters such as different amplification enzymes, sample input amount, adapter concentration and adapter ligation time, which greatly improves the results of mRNA integrity.

[0072] (3) The present invention provides a library construction method for mRNA vaccine quality evaluation based on a nanopore sequencing platform, which enables one-time library construction and comprehensive evaluation of mRNA vaccine quality indicators such as sequence consistency, integrity, and PolyA length. The ONT evaluation method has a positive correlation with traditional methods and can serve as an important supplement to traditional detection methods, making it suitable for widespread application. Attached Figure Description

[0073] Figure 1 This is a flowchart of the library construction method for mRNA vaccine quality evaluation based on the nanopore sequencing platform of the present invention;

[0074] Figure 2 This is a flowchart illustrating the effect of self-made standard test on the library of the present invention on the quality evaluation of mRNA vaccines based on nanopore sequencing platform, in a specific embodiment 1 of the present invention.

[0075] Figure 3 This is a CE integrity diagram of mRNA vaccine quality assessment based on nanopore sequencing platform in a verification embodiment of the library construction method for quality assessment of mRNA vaccines based on nanopore sequencing platform of the present invention.

[0076] Figure 4 The following are comparison charts showing the PolyA length of mRNA vaccines evaluated using the nanopore sequencing platform compared to traditional methods in an application example of the library construction method for quality evaluation of mRNA vaccines based on the nanopore sequencing platform of the present invention: (a) is a comparison chart of PolyA length for sample ID MZJLJB; (b) is a comparison chart of PolyA length for sample ID MZJLJC; (c) is a comparison chart of PolyA length for sample ID MZJLJD; (d) is a comparison chart of PolyA length for sample ID MZJLJE; (e) is a comparison chart of PolyA length for sample ID MZJLF; and (f) is a comparison chart of PolyA length for sample ID MZJLJG.

[0077] Figure 5 The diagram shows a comparison of sequence information for mRNA vaccine quality assessment based on nanopore sequencing platform according to the present invention with that of traditional methods; (a) is a sequence identity comparison diagram for sample ID MZJLJB; (b) is a sequence identity comparison diagram for sample ID MZJLJC; (c) is a sequence identity comparison diagram for sample ID MZJLJD; and (d) is a sequence identity comparison diagram for sample ID MZJLJE. Detailed Implementation

[0078] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0079] In this document, "and / or" includes any and all combinations of one or more of the listed related items.

[0080] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.

[0081] In this article, "front end" can also refer to "left end" and "end end" can also refer to "right end", referring to one end of a pipe and the other end.

[0082] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4%, more typically + / -3%, more typically + / -2%, even more typically + / -1%, even more typically + / -0.5%.

[0083] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values ​​within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0084] The term "room temperature" as used in this instruction manual is 20~25℃.

[0085] Example: Figure 1 As shown, the library construction method for mRNA vaccine quality evaluation based on the nanopore sequencing platform includes the following steps:

[0086] S1. Prepare the RNA template: Weigh out a full-length RNA with a poly-A tail as the RNA template; the amount of RNA template in step S1 is 4-50 ng.

[0087] S2 ligation of CRTA adapter, digestion and purification: The RNA template is mixed with the reverse transcription adapter CRTA (cDNA RTAdapter) and annealing buffer for annealing reaction; then ligation reaction buffer, ligase and recombinant ribonuclease inhibitor (RNaseOUT) are added for ligation reaction; the ligated full-length RNA is digested by Lambda exonuclease and USER enzyme (uracil-specific excision reagent), and finally purified;

[0088] In some specific embodiments, the concentration of the reverse transcription adaptor CRTA in step S2 is 1~2 ng / µL, the adapter ligation time is 10~20 min, the adapter ligation reaction temperature is 21℃; the adapter ligation reaction system is 18µL; the adapter digestion reaction temperature is 37℃; the time is 10~20 min; the adapter digestion reaction system is 20µL.

[0089] The specific steps of step S2 are as follows:

[0090] S21 reverse transcription adapter ligation: Mix 4-50 ng of polyA-tailed mRNA with 1 µL of reverse transcription adapter cDNA RTAdapter (CRTA) and 1 µL of annealing buffer (AB), then add water to make up to 12 µL. Incubate at 60 °C for 5 min, then incubate at room temperature for 5 min. Then add 3.6 µL of rapid ligation reaction buffer, 1.4 µL of T4 DNA ligase and RNaseOUT ribonuclease inhibitor, mix, and incubate again at 21 °C for 10 min to perform ligation.

[0091] S22 Adapter Digestion: Add 1 µL of Lambda exonuclease and 1 µL of USER enzyme to the reaction system (18 µL) in step S21, incubate at 37 °C for 15 min, and then purify.

[0092] S23 purification: Add RNA Clean XP magnetic beads and mix thoroughly. After adsorption, discard the supernatant. Wash the magnetic beads several times with short fragment buffer (SFB), dry, and then elute with nuclease-free water. Specifically:

[0093] S231: Add 36µL of resuspended RNA-free Clean XP magnetic beads to the above reaction and incubate at room temperature for 5 min;

[0094] S232: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0095] S233: Wash the magnetic beads with 100µL of short fragment buffer (SFB) and discard the supernatant;

[0096] S234: Repeat step S233;

[0097] S235: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0098] S236: The precipitate was resuspended in 12µL of nuclease-free water and incubated at room temperature for 10 min;

[0099] S237: Return the magnetic rack to the tube and transfer 12µL of elution buffer into a clean 0.2mL thin-walled PCR tube.

[0100] S3 Reverse Transcription, Strand Substitution and UMI Integration: The purified RNA template from step S2 is annealed using RT primers and deoxyribonucleoside triphosphate (dNTPs); then SSPII strand substitution primers are added for SSPII ligation; finally, reverse transcriptase is added and UMI integration is performed to obtain the reaction solution of the reverse transcription product.

[0101] Step S3 specifically involves:

[0102] S31 reverse transcription primer RTP annealing: Mix 1 µL of reverse transcription primer RT, 10 mM of deoxyribonucleoside triphosphate (dNTPs) with 12 µL of purified RNA and incubate at 21 °C for 15 min.

[0103] S32 chain conversion primer SSPII ligation: Add 4.5µL of reverse transcriptase-compatible buffer (5×RT buffer), 1µL of ribonuclease inhibitor RNaseOUT and 2µL of SSPII chain replacement primer to the product (14µL) from step S31, incubate at 42~65℃ for 2~5 min and then add reverse transcriptase.

[0104] S33: First, react at 42℃ for 90 min to perform reverse transcription and strand conversion, then react at 85℃ for 5 min to perform heat inactivation, and store the product at 4℃.

[0105] S4 Rapid Barcode PCR: Add barcode primers and PCR premix to the reaction solution obtained in step S3, perform PCR amplification reaction, and obtain PCR products; then purify and elute using magnetic beads;

[0106] In step S4, pre-amplification is performed first, followed by multiple cycles of amplification, and then extension is performed after each cycle to obtain the PCR product. In step S4, three standards of different lengths are selected, mixed, and then subjected to cyclic amplification. The number of PCR amplification cycles is 6 to 18. Preferably, the number of PCR amplification cycles is 6 to 10.

[0107] In step S4, the rapid barcode PCR DNA amplification enzymes in the PCR premix include NEB LongAmpHot Start, KAPA hot-start HiFi high-fidelity enzyme, and Takara PrimeSTAR® GXL DNA Polymerase; the amplification enzyme is preferably KAPA hot-start HiFi high-fidelity enzyme; the PCR amplification reaction system in step S4 is 25~100µL, preferably 25~50µL.

[0108] The cyclic amplification in step S4 specifically involves:

[0109] S41 Denaturation: First, add barcode primer BP01-24 (BarcodePrimer (BP01-24)) and PCR amplification reagent (KAPA hot-start HiFi high-fidelity enzyme) to the reaction solution obtained in step S3. Pre-denature at 95℃ for 30s, then denature at 95℃ for 15s and cycle 6~18 times, preferably 6~10 times. For the sequence of barcode primer BP01-24, please refer to the document page on the ONT official website. The barcode01-24 sequence PDF file can be found in the barcode sequences section.

[0110] S42 Annealing: Anneal at 60~65℃ for 15~45s, and cycle 6~18 times, preferably 6~10 times;

[0111] S43 extension: extend at 60~65℃ for 60s, and cycle 6~18 times, preferably 6~10 times; finally extend for 6min; obtain the amplification product and store at 4℃;

[0112] After the extension reaction in step S43 is completed, a specific exonuclease is added to the obtained amplification product to cut and remove excess primers. Specifically, the product is first incubated at 37°C for 15-30 min, and then heated at 80°C for 15 min to inactivate the primers. Then, AMPure XP purification beads are added for purification in step S44.

[0113] The specific purification steps in step S44 are as follows:

[0114] S441: Add 36µL of resuspended AMPure XP purified magnetic beads to the above reaction and incubate at room temperature for 5 min;

[0115] S442: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0116] S443: Wash the magnetic beads with 200µL of 80% ethanol and remove the supernatant;

[0117] S444: Repeat step S443;

[0118] S445: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0119] S446: The precipitate was resuspended in 12 µL of elution buffer and incubated at room temperature for 10 min;

[0120] S447: Replace the magnetic rack and aspirate 11 µL of elution buffer into a clean 0.2 mL thin-walled PCR tube;

[0121] S5 Rapid ligation of adapters and sequencing: Add rapid sequencing library adapters to the eluted product from step S4, react at room temperature to complete library preparation; then load the prepared library onto the sequencing platform for sequencing, convert the raw data into sequencing sequences and split the data to obtain sequencing data for each sample; finally, perform bioinformatics analysis on the sequencing data.

[0122] In step S5, when rapidly ligating adapters and sequencing, the adapter concentration is 1-2 µL; the reaction is incubated at room temperature for 10-20 min.

[0123] In some specific embodiments, step S5 specifically involves the following steps:

[0124] S51 Adapter Addition: Add 2µL of Rapid Adapter T (RAPT) to the purified PCR product (10µL), react at room temperature to complete the library preparation;

[0125] S52 sequencing: The prepared library is loaded onto the sequencing chip, and the sequencer is used to perform sequencing. The raw data is converted into cDNA sequences and the data is split to obtain sequencing data, i.e., sample sequencing data.

[0126] The specific steps of step S52 are as follows:

[0127] S521: Warmly melt the reagents. Weigh out the buffer solutions including Sequencing Buffer II (SBII), Loading Beads II (LBII), Flush Tether (FLT), and Flush Buffer (FB). After melting, immediately place them in an ice box. These four reagents form a complete support system of "pretreatment-loading-reaction-maintenance" in the sequencing process: SBII and LBII directly determine the efficiency and accuracy of the sequencing reaction, FLT ensures sequencing continuity, and FB is responsible for chip cleaning and balancing.

[0128] S522: Open the cover of the Nanopore sequencing instrument and turn the cover of the prime port of the flow cell clockwise;

[0129] S523: Check under the cap of the Priming port for air bubbles. Use a pipette to draw a small volume to remove the air bubbles.

[0130] S524: Adjust the 1000µL pipette to 200µL;

[0131] S525: Insert the nozzle into the prime port;

[0132] S526: Slowly adjust the knob until you see a small volume of buffer enter the pipette tip, then remove the pipette.

[0133] S527: Priming mix: Add 30 µL of molten and mixed Flush Tether (FLT) to the melted and mixed Flush Buffer (FB), and mix by pipetting up and down.

[0134] S528: Add 800µL of priming mix to the flow cell through the priming port, avoiding the introduction of air bubbles, and wait for 5 minutes;

[0135] S529: Use a pipette to thoroughly mix 37.5µL of SBII and 25.5µL of LBII in a new tube, ready for loading the sample library;

[0136] S5210: Open the cover of the SpotON sample port;

[0137] S5211: Add 200 μL of priming mix to the flow cell through the priming port to avoid introducing air bubbles;

[0138] S512: Mix the library by pipetting;

[0139] S513: Add 75μL of sample to the flow cell through the SpotON sample port, one drop at a time, ensuring that the sample flows into the port before adding the next drop.

[0140] S5214: Carefully close the cap on the SpotON sample port, ensuring the plug is inside the SpotON sample port, and close the Priming port;

[0141] S5215: Sequencing was performed using the third-generation sequencing platform GridION / MinION;

[0142] S5216: Perform bioinformatics analysis on sequencing data.

[0143] The following discussion and analysis will be conducted through several specific embodiments, wherein specific embodiment 1 is a performance optimization and parameter adjustment experiment; specific embodiment 2 is a specific implementation of the library construction method of the present invention; and the verification embodiment is to verify the correlation with traditional detection methods. Specific Implementation Example 1:

[0145] This invention designs experiments based on the ONT PCR barcode kit (SQK-PCB111.24), optimizing RNA input, PCR amplification enzyme, adapter concentration, adapter ligation time, and the number of PCR cycles using self-made standards. Through adjustments to various parameters, a library preparation method for mRNA vaccine quality evaluation based on a nanopore sequencing platform is established. A single library preparation and sequencing dataset can comprehensively assess mRNA vaccine quality indicators such as sequence consistency, integrity, and PolyA length, serving as an important supplement to traditional detection methods and suitable for widespread application. Specifically, real-time sequencing is performed on a nanopore sequencing platform to obtain raw sequencing data (Raw_reads). Quality control is then performed to obtain quality-controlled sequencing data, referred to as Cleanreads. The quality control conditions include: sequencing length greater than 500 bp and sequencing quality greater than 9, and the inclusion of both RTP and SSPII primer sequences. If the sample sequencing data simultaneously meets these conditions, it is considered to have passed the sequencing data quality control standard and is referred to as cleanreads. The nucleotide sequences of the RTP primers are shown in SEQ ID NO.1, and the nucleotide sequences of the SSPII primers are shown in SEQ ID NO.2. SEQ ID NO.1: TTGCCTGTCGCTCTATCTTC; SEQ ID NO.2: TCTGTGGTGTGCTGATATTGC. The Clean_ratio is the ratio of the quality-controlled sequencing data to the raw sequencing data.

[0146] 1. Testing with different amplification enzymes:

[0147] Due to hydrolysis, RNase degradation, or transcription failure, mRNA may become fragmented, failing to form complete open reading frames to encode effective drugs. Therefore, mRNA integrity directly affects the efficacy of mRNA vaccines. Considering the very high requirements for amplification efficiency and experimental precision of different amplification enzymes, different types of amplification enzymes may significantly impact the results of mRNA integrity. Using an RNA reference standard (RCS, RNA Control Expansion, EXP-RCS001, Nanopore) as a template, we tested DNA amplification enzymes from three commercially available manufacturers and compared the integrity of mRNA samples, as shown in Table 1.

[0148] Table 1. Test results of different amplification enzymes

[0149] Sample PCR reagent Raw_reads Clean_ reads Clean_ratio% Integrity_mRNA% RCS NEB LongAmp 453468 397015 87.55 87.42 RCS KAPA HiFi 519979 484842 93.24 89.64 RCS Takara GXL 500637 421816 84.26 86.21

[0150] Therefore, considering the integrity of the mRNA vaccine data after delivery, KAPA hot-start HiFi high-fidelity enzyme premix (catalog number KK2601) was selected as the DNA amplification enzyme.

[0151] 2. Sample size:

[0152] As is well known, a low initial DNA amount can lead to insufficient library output if the number of cycles is too small, failing to meet sequencing requirements; while an excessive number of cycles can result in over-amplification, increased bias, increased sequencing duplicates, increased chimeric products, and accumulation of amplified mutations, among other adverse consequences. Using the RCS control as a template, the input amounts for the ONT PCR barcoding kit (SQK-PCB111.24) library preparation kit were optimized. As shown in Table 2 below: when the input amount was adjusted from the conventional 4 ng to 50 ng, the data output increased by two orders of magnitude.

[0153] Table 2 Comparison results of sample input amount

[0154] Sample Input amount PCR cycle number Raw_ reads Clean_ reads Clean_ ratio% Integrity_ mRNA% RCS 4 6 591 562 95.09 87.88 RCS 50 6 39251 37655 95.93 84.55

[0155] In summary, the higher the input amount, the more data output is generated, assuming a relatively high proportion of intact mRNA; the selected sample input amount is 50ng.

[0156] 3. Optimization of connector density and connector connection time:

[0157] Using the RCS control as a template, this study investigated whether doubling the adapter concentration and increasing the ligation time in the ONT PCR barcode kit (SQK-PCB111.24) library construction kit would affect mRNA integrity.

[0158] 1) Comparison of connector concentration, the test data are shown in Table 3.

[0159] Table 3 Comparison data of connector concentration

[0160] Sample Adapter concentration ng / µL Raw_ reads Clean_ reads Clean_ratio% Integrity_ mRNA% RCS 1 25800 24252 94 83.6 RCS 2 52825 50176 94.66 86.82

[0161] 2) Connector connection time, test data are shown in Table 4.

[0162] Table 4 Comparison of joint times

[0163] Sample Adapter ligation time Raw_ reads Clean_ reads Clean_ ratio% Integrity_ mRNA% RCS 10min 25800 24252 94 83.6 RCS 20min 22520 21551 95.7 86.06

[0164] In summary, considering both data output and mRNA integrity, a sample adapter concentration of 2 ng / µL yielded slightly better results than 1 ng / µL. Regarding data output and ligation time, 20 min had no significant impact on the results compared to 10 min; however, for mRNA integrity, a ligation time of 20 min was slightly better than 10 min.

[0165] 4. Optimization of PCR cycle number using self-made standards:

[0166] As is well known, the number of PCR cycles during DNA library construction is one of the important factors determining the quality of sequencing libraries. We prepared our own standards and selected three different lengths (553 nt, 1314 nt, and 2897 nt, with 1314 nt serving as the RCS control) of the mixed standards to test the effect of PCR cycle number shift on the library. The experimental protocol is as follows: Figure 2 As shown in Table 5, the comparison results are as follows. The specific steps of the experimental procedure are as follows:

[0167] (1) The mixed mRNA template was reverse transcribed, and then primers were designed to amplify the cDNA template;

[0168] (2) After the final ligation, the adapter and primer BCA of the ONT PCR barcode kit (SQK-PBK004, PBK004) are introduced to facilitate the addition of barcodes for pre-amplification in subsequent PCR.

[0169] (3) Denaturation (pre-amplification): First, pre-denature at 95℃ for 30s, then denature at 95℃ for 15s and cycle 6~10 times; the pre-amplification product is purified and quantified, and mixed according to the molar number as a template.

[0170] (4) Amplification: Amplification was performed using different PCR cycles (6 to 18 times) followed by instrument testing.

[0171] Table 5 Comparison of PCR cycle numbers for self-made standard products

[0172] In summary, using the RCS percentage as a control group as a baseline, the percentage of 2897nt samples initially increased and then decreased with increasing PCR amplification number, while the percentage of 550nt samples gradually increased. The PCR cycle number significantly affects the proportion of samples of different lengths in the final library; therefore, while ensuring normal library output, a lower PCR cycle number is better, with 6-10 cycles recommended. The impact of PCR cycle number shift on the library was then assessed using self-made standards.

[0173] The integrity of the mRNA (full-length RNA) obtained by the optimized method and the original method was compared, specifically:

[0174] Using the RCS control as a template, the experimental workflow was optimized by adjusting the parameters of amplification enzyme, sample input, adapter concentration, adapter ligation time, and PCR cycle number. The SQK-PCB111.24 library was constructed using the same workflow as the original method, and the data after the experiment were compared as shown in Table 6.

[0175] Table 6. Comparison of mRNA integrity obtained by the optimized method and the original method.

[0176] Sample Procedure Raw_ reads Clean_ reads Clean_ ratio% Integrity_ mRNA% RCS Original procedure 453468 397015 87.55 87.42 RCS Optimized procedure 515813 452108 87.65 99.12

[0177] In summary, the optimized process significantly improves mRNA integrity compared to the original process.

[0178] Based on the ONT PCR barcode kit (SQK-PCB111.24), the RNA input amount, PCR amplification enzyme, adapter concentration, adapter ligation time, and number of PCR cycles with self-made standards were optimized. Through a series of wet experimental parameter adjustments, a library construction method for mRNA vaccine quality evaluation based on a nanopore sequencing platform was established.

[0179] Specific Implementation Example 2: Establishing the method system of the present invention, based on the optimized experiments of Specific Implementation Example 1, the library construction method system of the present invention is obtained. The present invention uses the ONT PCR barcode kit (SQK-PCB111.24) as the basis for designing experiments. The specific steps are as follows:

[0180] S1 Prepare RNA template: Take 4-50 ng of full-length RNA with poly-A tail;

[0181] S2 connects to the CRTA adapter for digestion and purification:

[0182] S21: Connect the CRTA connector; the CRTA connector annealing configuration system is shown in Table 7 below.

[0183] Table 7 CRTA Connector Annealing Configuration System

[0184] Component Volume RNA template 4~50ng(X µL) CRTA adapter 1 µL Annealing buffer AB 1 µL Water 10-X µL Total 12 µL

[0185] The parameters for the annealing reaction procedure of CRTA joints are shown in Table 8 below.

[0186] Table 8 Annealing reaction parameters for CRTA joints

[0187] Temperature ℃ Time 60℃ 5min Room temperature 5min

[0188] The CRTA connector connection configuration system is shown in Table 9 below.

[0189] Table 9 CRTA Connector Connection Configuration System

[0190] Component Volume Product of previous step 12 µL Fast ligation reaction buffer 3.6 µL T4 DNA ligase 1.4 µL RNaseOUT 1 µL Total 18 µL

[0191] The CRTA connector connection reaction procedure is shown in Table 10 below.

[0192] Table 10 CRTA Connector Reaction Procedure Parameters

[0193] Temperature ℃ Time 21° 10min

[0194] Note: CRTA is a double-linked header with poly(T) overhangs that can precisely pair with the poly(A) tail of the RNA strand. This design ensures successful reverse transcription of the full-length RNA while accurately determining the length of the poly(A) strand.

[0195] S22: Joint digestion; the joint digestion configuration system is shown in Table 11 below.

[0196] Table 11 Connector digestion configuration system

[0197] Component Volume Product of previous step 18 µL Lambda exonuclease 1 µL USER enzyme 1 µL Total 20µL

[0198] The adapter digestion reaction procedure is shown in Table 12 below.

[0199] Table 12 Connector Digestion Reaction Procedure Parameters

[0200] Temperature ℃ Time 37℃ 15min

[0201] S23: The specific steps for purification are as follows:

[0202] S231: Add 36µL of resuspended RNA-free Clean XP magnetic beads to the above reaction and incubate at room temperature for 5 min;

[0203] S232: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0204] S233: Wash the magnetic beads with 100µL of short fragment buffer (SFB) and discard the supernatant;

[0205] S234: Repeat step S233;

[0206] S235: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0207] S236: The precipitate was resuspended in 12µL of nuclease-free water and incubated at room temperature for 10 min;

[0208] S237: Replace the magnetic rack and aspirate 12µL of elution buffer into a clean 0.2 mL thin-walled PCR tube;

[0209] S3 reverse transcription, strand substitution, and UMI integration: Specifically:

[0210] S31RT primer annealing: Mix 1 µL of reverse transcription primer RT, 10 mM of deoxyribonucleoside triphosphate (dNTPs) with 12 µL of purified RNA and incubate at 21 °C for 15 min; The RT primer annealing reaction system is shown in Table 13 below.

[0211] Table 13 Configuration of RT primer annealing reaction system

[0212] Component Volume Purified RNA of previous step 12 µL RT primer 1 µL dNTPs (10 mM) 1 µL Total 14µL

[0213] The parameters of the RT primer annealing reaction procedure are shown in Table 14 below.

[0214] Table 14 Parameters of the RT primer annealing reaction procedure

[0215] Temperature ℃ Time 21℃ 15min

[0216] S32 chain conversion primer SSPII ligation: Add 4.5 µL of reverse enzyme-compatible buffer (5×RT buffer), 1 µL of ribonuclease inhibitor RNaseOUT, and 2 µL of SSPII chain replacement primer to the product (14 µL) from step S31. After reacting at 42 °C for 2 min, add 1 µL of Maxima H Minus reverse transcriptase. The SSPII ligation reaction system is shown in Table 15 below.

[0217] Table 15 Configuration of SSPII Linkage Reaction System

[0218] Component Volume Product of previous step 14µL 5×RT buffer 4.5 µL RNaseOUT 1 µL SSPII strand displacement primer 2 µL Total 21.5µL

[0219] S33: First react at 42℃ for 90 min, then react at 85℃ for 5 min to perform reverse transcription and strand conversion, obtain the reverse transcription product, then perform heat inactivation and store at 4℃; the specific reaction procedure parameters are shown in Table 16.

[0220] Table 16 Parameters of the reverse transcription and strand conversion reaction program

[0221] Temperature ℃ Time 42°C 90mins 85°C 5mins 4°C ∞

[0222] S4 Rapid Barcode PCR: Add barcode primers and PCR premix to the reaction solution obtained in step S3, perform PCR amplification reaction, and obtain PCR products; then purify and elute using magnetic beads;

[0223] The amplification reaction includes:

[0224] S41 First, add barcode primer BP01-24 (Barcode Primer (BP01-24)) and PCR amplification reagent (KAPA hot-start HiFi high-fidelity enzyme) to the reaction solution obtained in step S3. Pre-denature at 95℃ for 30s, then denature at 95℃ for 15s and cycle 6-10 times. For the sequence of barcode primer BP01-24, please refer to the documentation page on the ONT official website. The barcode01-24 sequence PDF file can be found in the barcodesequences section.

[0225] S42 annealing: Anneal at 62℃ for 15 seconds, and repeat 6 to 10 times;

[0226] S43 extension: extend at 65℃ for 60s, and cycle 6~10 times; finally extend for 6min; obtain the amplification product and store at 4℃; the configuration of the amplification reaction system is shown in Table 17 below.

[0227] Table 17 Amplification Reaction System Configuration

[0228] Component Volume Reaction solution of previous step 5 µL Barcode Primer (BP01-24) 0.75 µL 2* kapa Hifi mix 12.5 µL Water 6.75 µL Total 25 µL

[0229] The parameters for setting the reaction program are shown in Table 18.

[0230] Table 18 Parameters of the Amplification Reaction Program

[0231] Temperature ℃ Time Cycles 95°C 30 secs 1 95°C 15 secs 6-10 62°C 15 secs 6-10 65°C 60 secs / kb 6-10 65°C 6 mins 1 4°C ∞ 1

[0232] After the extension reaction in step S43 is completed, 1 μL of specific exonuclease I is added to the obtained amplification product to cut and remove excess primers. Specifically, the product is first incubated at 37°C for 15-30 min, and then heated at 80°C for 15 min to inactivate the primers. The parameters are shown in Table 19 below.

[0233] Table 19 Parameters of the amplification reaction program

[0234] Temperature ℃ Time 37°C 15mins 80°C 15mins

[0235] S44: The specific purification steps are as follows:

[0236] S441: Add 36µL of resuspended AMPure XP purified magnetic beads to the above reaction and incubate at room temperature for 5 min;

[0237] S442: Centrifuge the sample and place it on a magnetic rack to remove the supernatant;

[0238] S443: Wash the magnetic beads with 200µL of 80% ethanol and remove the supernatant;

[0239] S444: Repeat step S443;

[0240] S445: Aspirate any residual buffer solution and allow to dry briefly for 30 seconds;

[0241] S446: The precipitate was resuspended in 12 µL of elution buffer and incubated at room temperature for 10 min;

[0242] S447: Return the magnetic rack to the container and transfer 11 µL of elution buffer into a clean 0.2 mL thin-walled PCR tube.

[0243] S5 Rapid ligation of adapters and sequencing: Rapid sequencing library adapters are added to the eluted product from step S4, and the reaction is carried out at room temperature to prepare the library. The prepared library is then loaded onto the sequencing platform for sequencing. The raw data is converted into sequencing sequences and the data is split to obtain sequencing data for each sample. Finally, bioinformatics analysis is performed on the sequencing data. Specifically:

[0244] S51: Add a connector. The reaction system with the connector is configured as shown in Table 20 below; incubate at room temperature for 10-20 min.

[0245] Table 20 Reaction System Configuration

[0246] Component Volume Eluted product of previous step 10µL Rapid Adapter T (RAP T) 2µL Total 12µL

[0247] S52: Load the prepared library onto the sequencing chip, use a sequencer to perform sequencing, convert the raw data into cDNA sequences and split the data to obtain sequencing data, i.e., sample sequencing data;

[0248] The specific steps of step S52 are as follows:

[0249] S521: Warm-melting reagents: Weigh out the buffer solutions including Sequencing Buffer II (SBII), Loading Beads II (LBII), Flush Tether (FLT), and Flush Buffer (FB), and immediately place them in an ice box after thawing. These four reagents form a complete support system of "pretreatment-loading-reaction-maintenance" in the sequencing process: SBII and LBII directly determine the efficiency and accuracy of the sequencing reaction, FLT ensures sequencing continuity, and FB is responsible for chip cleaning and balancing.

[0250] S522: Open the cover of the Nanopore sequencing instrument and turn the cover of the prime port of the flow cell clockwise;

[0251] S523: Check under the cap of the Priming port for air bubbles. Use a pipette to draw a small volume to remove the air bubbles.

[0252] S524: Adjust the 1000µL pipette to 200µL;

[0253] S525: Insert the nozzle into the prime port;

[0254] S526: Slowly adjust the knob until you see a small volume of buffer enter the pipette tip, then remove the pipette.

[0255] S527: Priming mix: Add 30 µL of molten and mixed Flush Tether (FLT) to the melted and mixed Flush Buffer (FB), and mix by pipetting up and down.

[0256] S528: Add 800µL of priming mix to the flow cell through the priming port, avoiding the introduction of air bubbles, and wait for 5 minutes;

[0257] S529: Use a pipette to thoroughly mix 37.5µL of SBII and 25.5µL of LBII in a new tube, ready for loading the sample library;

[0258] S5210: Open the cover of the SpotON sample port;

[0259] S5211: Add 200 μL of priming mix to the flow cell through the priming port to avoid introducing air bubbles;

[0260] S512: Mix the library by pipetting;

[0261] S513: Add 75μL of sample to the flow cell through the SpotON sample port, one drop at a time, ensuring that the sample flows into the port before adding the next drop.

[0262] S5214: Carefully close the cap on the SpotON sample port, ensuring the plug is inside the SpotON sample port, and close the Priming port;

[0263] S5215: Sequencing was performed using the third-generation sequencing platform GridION / MinION;

[0264] S5216: Perform bioinformatics analysis on sequencing data.

[0265] Table 21 Configuration of the sample library system

[0266] Component Volume Product of ligation reaction of previous step 12µL SBII 37.5µL LBII 25.5µL Total 75µL

[0267] Verification Example: To verify the correlation with traditional detection methods, based on the procedure of Specific Example 2 of this invention, six samples with results from traditional detection methods (CE integrity, PolyA length, and first-generation sequencing test sequence information) were selected. The correlation between the integrity, PolyA length, and sequence consistency obtained by different traditional detection methods and the library construction method indicators of this invention was verified. cDNA libraries were constructed from the six mRNA vaccine samples using a PCR barcoding kit (SQK-PCB111.24), and the results were compared with those from traditional analysis methods.

[0268] Table 22 Comparison of the completeness of mRNA vaccine quality assessment based on nanopore sequencing platform with traditional methods

[0269] Sample ID Length (Length) CE Integrity Raw_reads Clean_reads Clean_ratio Intergrity_mRNA MZJLJB 1804 97.9 465067 397587 85.49% 98.47 MZJLJC 1877 96.4 761987 670987 88.06% 98.41 MZJLJD 1877 96.9 191040 151027 79.06% 98.42 MZJLJE 1885 96.9 329756 272746 82.71% 98.38 MZJLJF 1902 96.5 614683 525376 85.47% 98.43 MZJLJG 1073 98.4 301921 254095 84.16% 99.45 RCS 1314 / 360364 293994 81.58% 98.92

[0270] Table 23 Sequence Identification of mRNA Vaccines Based on Nanopore Sequencing Platform

[0271] Sample ID PolyA_length (first generation sequencing) PolyA_length (CE) PolyA_length (ONT) MZJLJB 30 / 33 MZJLJC 106 / 109 MZJLJD 76 71-91 81 MZJLJE 76 73-91 81 MZJLJF 76 70-91 78 MZJLJG 76 71-91 79 RCS / / 33

[0272] The results of comparing the quality evaluation of mRNA vaccines based on nanopore sequencing platforms with traditional methods show that:

[0273] 1) Completeness: such as Figure 3 As shown, the difference between the integrity of the nanopore sequencing platform-based mRNA vaccine quality assessment (ONT integrity) and the CE integrity does not exceed 3%. A positive correlation exists between ONT integrity and CE integrity.

[0274] Y = 0.4749x + 52.355; R 2 =0.8455.

[0275] 2) PolyA length: e.g. Figure 4 As shown, Figure 4 (a) in the figure is a comparison chart of the length of PolyA for sample number MZJLJB; Figure 4 (b) in the figure is a comparison chart of the length of PolyA for sample number MZJLJC; Figure 4 (c) in the figure is a comparison chart of the length of PolyA for sample number MZJLJD; Figure 4 (d) in the figure is a comparison chart of the length of PolyA sample number MZJLJE; Figure 4 (e) in the figure is a comparison chart of the length of PolyA for sample ID MZJLF; Figure 4(f) in the figure is a comparison chart of PolyA length for sample ID MZJLJG; the PolyA length value obtained by the RCS control based on ONT detection is 33bp, which is 3bp different from the true length (30bp); in the test sample, the results of first-generation sequencing, CE and ONT detection are basically consistent.

[0276] 3) Sequence consistency: such as Figure 5 As shown, Figure 5 (a) in the figure is a sequence consistency comparison chart for sample number MZJLJB; Figure 5 (b) in the figure is a sequence consistency comparison chart for sample number MZJLJC; Figure 5 (c) in the figure is a sequence consistency comparison diagram of sample number MZJLJD; Figure 5 (d) in the figure shows the sequence identity comparison diagram for sample MZJLJE; it can be seen that there is a one-base mismatch between the ONT identity sequence and the first-generation sequencing result. The ONT identity sequences of samples MZJLF and MZJLG are consistent with the first-generation sequencing results.

[0277] In summary, this invention, through adjustments to various parameters, establishes a library preparation method for mRNA vaccine quality evaluation based on a nanopore sequencing platform. A single library preparation and sequencing dataset can comprehensively assess indicators such as sequence consistency, integrity, and PolyA length in mRNA vaccine quality evaluation, serving as an important supplement to traditional detection methods and suitable for widespread application.

[0278] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention, such as changes to a reagent or material, should be included within the scope of protection of the present invention.

Claims

1. A library construction method for quality evaluation of mRNA vaccines based on a nanopore sequencing platform, characterized in that, The specific steps are as follows: S1. Prepare the RNA template: Select a full-length RNA with a poly-A tail as the RNA template; S2 ligation of CRTA adapter, digestion and purification: The RNA template is mixed with the reverse transcription adaptor CRTA and annealing buffer for annealing reaction; then ligation reaction buffer, ligase and recombinant ribonuclease inhibitor are added for ligation reaction; the ligated full-length RNA is digested by Lambda exonuclease and USER enzyme, and finally purified. S3 Reverse Transcription, Strand Displacement and UMI Integration: The purified RNA template from step S2 is annealed using RT primers and deoxyribonucleoside triphosphate (dNTPs). Then, SSPII chain replacement primers are added to perform SSPII ligation; then, reverse transcriptase is added and UMI integration is performed to obtain the reaction solution of reverse transcription product. S4 Rapid Barcode PCR: Add barcode primers and PCR premix to the reaction solution obtained in step S3, perform PCR amplification reaction, and obtain PCR products; Then, magnetic beads are used for purification and elution; S5 Rapid ligation of adapters and sequencing: Add rapid sequencing library adapters to the eluted product from step S4, react at room temperature to complete library preparation; then load the prepared library onto the sequencing platform for sequencing, convert the raw data into sequencing sequences and split the data to obtain sequencing data for each sample; finally, perform bioinformatics analysis on the sequencing data.

2. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 1, characterized in that, In step S4, pre-amplification is performed first, followed by multiple cycles of amplification, and then extension is performed after the cycles are completed to obtain PCR products.

3. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, In step S4, three standards of different lengths are selected, mixed, and then subjected to cyclic amplification. The number of PCR amplification cycles is 6 to 18.

4. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, The cyclic amplification in step S4 specifically involves: S41 Denaturation: First, add barcode primers and PCR amplification reagents to the reaction solution obtained in step S3 and pre-denature at 95℃ for 30s, then denature at 95℃ for 15s and cycle 6~18 times. S42 Annealing: Anneal at 60~65℃ for 15s~45s, and repeat 6~18 times; S43 extension: extend at 60~65℃ for 60s / kb, and cycle 6~18 times; finally extend for 6min. The amplified product was obtained and stored at 4°C.

5. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 4, characterized in that, In step S4, the rapid barcode PCR DNA amplification enzymes in the PCR premix include NEB LongAmp® hot-start Taq DNA polymerase, KAPA hot-start HiFi high-fidelity enzyme, and Takara high-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase; the PCR amplification reaction system in step S4 is 25~100µL.

6. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 4, characterized in that, After the extension reaction in step S43 is completed, a specific exonuclease is added to the obtained amplification product to cut and remove excess primers. Specifically, the product is first incubated at 37°C for 15-30 min, then heated at 80°C for 15 min to inactivate the primers; then AMPure XP purification beads are added for purification.

7. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, In step S2, the concentration of the reverse transcription adaptor CRTA is 1-2 ng / µL, the adapter ligation time is 10-20 min, and the adapter ligation reaction temperature is 21℃; the adapter ligation reaction system is 18µL; the adapter digestion reaction temperature is 37℃; the time is 10-20 min; and the adapter digestion reaction system is 20µL.

8. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, The amount of RNA template in step S1 is 4-50 ng.

9. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, In step S5, when rapidly ligating adapters and sequencing, the adapter concentration is 1-2 µL; the reaction is incubated at room temperature for 10-20 min.

10. The library construction method for mRNA vaccine quality evaluation based on nanopore sequencing platform according to claim 2, characterized in that, Step S3 specifically involves: S31 reverse transcription primer RTP annealing: Mix reverse transcription primer RT, deoxyribonucleoside triphosphate (dNTPs) with purified RNA and incubate at room temperature; S32 chain conversion primer SSPII ligation: Add buffer compatible with reverse transcriptase, RNaseOUT ribonuclease inhibitor and SSPII chain replacement primer, incubate at 42~65℃ for 2~5 min and then add reverse transcriptase for reverse transcription and chain conversion.

Images