Application of miRNA in diagnosis of cognitive function decline induced by hypoxia stress
By using miR-3473h-p3 as a diagnostic biomarker, combined with qPCR and high-throughput sequencing, a machine learning model was constructed to address the lack of sensitivity and specificity in diagnosing hypoxia-induced cognitive decline, thus achieving efficient and accurate early diagnosis.
Patent Information
- Application Number
- CN202511740076.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-11-12
- Filing Date
- 2025-11-25
- Publication Date
- 2026-02-10
AI Technical Summary
Existing technologies lack sensitive and specific biomarkers for assessing hypoxia-induced cognitive decline. Traditional neuropsychological tests are time-consuming and susceptible to environmental interference, while imaging tests lack sensitivity and are difficult to implement dynamic monitoring.
Using miR-3473h-p3 as a diagnostic biomarker, the expression level of miR-3473h-p3 in serum samples was detected by qPCR, probe hybridization and high-throughput sequencing methods. A machine learning diagnostic model was constructed, and detection kits, chips and devices were provided for auxiliary diagnosis.
miR-3473h-p3 demonstrates high accuracy and specificity in the diagnosis of hypoxia-induced cognitive decline, enabling early identification of cognitive decline and providing an efficient and convenient diagnostic method.
Smart Images

Figure CN121496052A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically, it relates to the application of a miRNA in the diagnosis of hypoxia-induced cognitive decline. Background Technology
[0002] Peripheral serum molecular markers of brain function changes refer to biomolecules detectable in the blood that reflect the physiological or pathological state of the central nervous system (brain), including proteins, metabolites, and microRNAs. When brain tissue is damaged or its function is abnormal, specific molecules can be released into the bloodstream across the blood-brain barrier, or the nervous system can influence peripheral blood components through neural connections with the periphery and mechanisms such as exosomes and cytokines, thus allowing the detection of corresponding molecules closely related to changes in brain function in the blood. Because serum marker molecular detection is non-invasive, repeatable, and simple, it is suitable for early and dynamic monitoring, making it an important technical means for monitoring brain function.
[0003] High-altitude hypoxia can induce acute or chronic changes in brain function, including cognitive fatigue, traumatic brain injury (TBI), and neuroinflammation. Rapid and portable monitoring methods are needed to assess brain function status. However, traditional neuropsychological tests (such as the MMSE) are time-consuming and susceptible to environmental interference. Furthermore, imaging techniques suffer from insufficient sensitivity in detecting brain pathophysiological changes. Therefore, dynamic monitoring of biomarker trends is necessary to inform task allocation decisions. Consequently, brain cognitive function assessment techniques based on changes in serum biomarker expression have significant application value in assisting the diagnosis of hypoxia-induced cognitive decline and improving diagnostic and treatment efficiency. Summary of the Invention
[0004] In view of this, in order to overcome the shortcomings of the prior art, the purpose of this invention is to provide serum miR-3473h-p3 as a diagnostic biomarker for hypoxia stress-induced cognitive decline and related products, in order to provide a biomarker with high sensitivity and specificity in the field of diagnosis of hypoxia stress-induced cognitive decline.
[0005] This invention uses qPCR detection technology to screen for miRNA (miR-3473h-p3) that shows significant differential expression in hypoxia-stress-induced cognitive decline. Further validation was performed on real clinical serum samples collected during this invention. The validation results show that miR-3473h-p3 has high accuracy, sensitivity, and specificity in diagnosing hypoxia-stress-induced cognitive decline, and can be used as an auxiliary diagnostic tool in clinical practice for this condition. This is of great significance for the early diagnosis of hypoxia-stress-induced cognitive decline.
[0006] The present invention achieves the above-mentioned objectives by adopting the following technical solution:
[0007] A first aspect of the present invention provides the use of a reagent for detecting the expression level of the biomarker miR-3473h-p3 in a sample in the preparation of a product for diagnosing hypoxia-induced cognitive decline.
[0008] In this invention, the biomarker is miRNA, which refers to microRNA, or small non-coding RNA molecules. These are endogenous small RNAs, approximately 20-24 nucleotides in length, that play a variety of important regulatory roles within cells. They primarily regulate gene expression at the post-transcriptional level (regulating approximately one-third of protein-coding genes), thereby controlling cell apoptosis, proliferation, differentiation, metabolism, individual development, and the occurrence, development, and drug resistance of tumors. miRNAs exist in various forms. The most primitive is pri-miRNA, approximately 300-1000 bases in length. After one processing step, pri-miRNA becomes pre-miRNA, or microRNA precursor, approximately 70-90 bases in length. Pre-miRNA is then digested with the Dicer enzyme to become mature miRNA, approximately 20-24 nt in length.
[0009] Furthermore, the product includes test kits, test chips, test strips, test systems, test equipment, and test devices.
[0010] Furthermore, the detection kit contains primers, probes, or chips that specifically bind to the biomarker miR-3473h-p3.
[0011] Furthermore, the primers for specifically amplifying miR-3473h-p3 include universal primers and self-developed primers, with sequences shown in SEQ ID NO:1.
[0012] Furthermore, the kit also includes reagents for sample processing and instructions, which should clearly explain how to use the kit to assess whether a subject has or is suspected of having hypoxia-induced cognitive decline.
[0013] Specifically, the sample is pretreated before being used for detection in this invention. This pretreatment may include processes necessary to release or separate the compound, or to remove excess material or waste. Suitable techniques include centrifugation, extraction, fractionation, purification, and / or enrichment of the compound. Furthermore, other pretreatments may be performed to provide the compound in a form or concentration suitable for analysis; for example, if gas chromatography-coupled mass spectrometry is used in the method of this invention, the compound will need to be derivatized prior to gas chromatography. Suitable and necessary pretreatments depend on the tools used in performing the method of this invention and are well known to those skilled in the art.
[0014] In some embodiments, the detection kit is an RT-PCR kit, which may further include elements necessary for a reverse transcription polymerase chain reaction. The RT-PCR kit contains a pair of primers specifically targeting the biomarker miR-3473h-p3. The RT-PCR kit may also include test tubes or suitable containers, reaction buffers (at different pH values and magnesium concentrations), enzymes (e.g., Taq polymerase and reverse transcriptase), DEPC-water, and sterile water.
[0015] In some embodiments, the chip includes a solid support and oligonucleotide probes immobilized on the solid support, the oligonucleotide probes including one or more miR-3473h-p3-targeting oligonucleotide probes for detecting miR-3473h-p3 transcriptional levels.
[0016] In this invention, the chip can be prepared using conventional methods known in the art for preparing biochips. For example, if the solid support is a modified glass slide or silicon wafer, and the 5' end of the probe contains an amino-modified polydT string, the oligonucleotide probe can be prepared into a solution, and then spotted onto the modified glass slide or silicon wafer using a spotting instrument, arranged into a predetermined sequence or array. After being left to stand overnight for fixation, the miRNA chip of this invention can be obtained. If the nucleic acid does not contain amino modification, its preparation method can also refer to: Wang Shenwu (ed.), *Gene Diagnostic Technology - Non-Radioactive Operation Manual*; J.L. Erisi, V.R.Y., P.O. Brown. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science, 1997; 278: 680; and Ma Liren and Jiang Zhonghua (eds.), *Biochips*. Beijing: Chemical Industry Press, 2000, 1-130.
[0017] In some implementations, the solid support may be made of various commonly used materials in the field of gene chips, including but not limited to: nylon membranes, glass or silicon slides modified with active groups (e.g., aldehydes, aminos, etc.), unmodified glass slides, plastic sheets, etc.
[0018] Furthermore, the reagents include primers that specifically amplify miR-3473h-p3 and / or probes that specifically recognize miR-3473h-p3.
[0019] In some implementations, the primers refer to 7-50 nucleic acid sequences capable of forming base pairs complementary to the template strand and serving as a starting point for template strand replication. Primers are typically synthesized, but naturally occurring nucleic acids can also be used. The primer sequence does not necessarily need to be identical to the template sequence, as long as it is sufficiently complementary to hybridize with the template.
[0020] Furthermore, the samples are tissue samples, blood samples, serum samples, cell samples, urine samples, and / or exosome samples derived from the subject.
[0021] In some implementations, the sample includes samples obtained from cell, tissue, or body fluid collections of any subject origin. Specifically, the sample includes, but is not limited to: tissue or cell samples that may be derived from solid tissue of a fresh, frozen, and / or preserved organ or tissue sample, or from a biopsy or aspirate; blood or any blood component; body fluids such as cerebrospinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid. Tissue samples may be primary or in vitro cultured cells or cell lines. Optionally, tissue or cell samples may be obtained from diseased tissue / organ. Tissue samples may contain compounds naturally mixed with the tissue, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or similar compounds.
[0022] Furthermore, the sample is a blood sample from the subject.
[0023] Furthermore, the sample is a serum sample from the subject.
[0024] In some embodiments, the subject may be human or non-human and may include, for example, animal strains or species used as a “model system” for research purposes. Similarly, the subject may include adults or adolescents (e.g., children). Furthermore, the subject may refer to any living organism, preferably a mammal (e.g., human or non-human). Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates (e.g., chimpanzees) and other apes and monkeys; livestock, such as cattle, horses, sheep, goats, pigs; domestic animals, such as rabbits, dogs, and cats; laboratory animals include rodents, such as rats, mice, and guinea pigs. Examples of non-mammals include, but are not limited to, birds, fish, etc.
[0025] In some implementations, the product detects the expression level of miR-3473h-p3 in test samples from subjects using quantitative PCR, probe hybridization, and / or high-throughput sequencing methods.
[0026] In some implementations, the reagents used to detect the expression level of miR-3473h-p3 in test samples from subject sources based on quantitative PCR include primers that specifically amplify miR-3473h-p3.
[0027] In some embodiments, the reagent used to detect the expression level of miR-3473h-p3 in a subject-derived sample using a probe hybridization method includes a probe that specifically recognizes miR-3473h-p3.
[0028] In some implementations, the quantitative PCR method is also known as real-time quantitative PCR (RT-PCR). A fluorescence detection PCR instrument can plot a dynamic curve of the cumulative rate of amplified sequences throughout the PCR process. The higher the initial concentration of the target sequence in the reaction mixture, the fewer PCR cycles (generally expressed as a specific threshold cycle number Ct) are required to obtain a specific yield of the amplified product. Since miRNAs are only 22 nt in length, traditional qRT-PCR is not suitable for amplifying such short fragments.
[0029] In some implementations, real-time quantitative PCR methods for miRNAs include tailing and neck loop methods. The neck loop method is an ideal qRT-PCR method for miRNA detection: First, special stem-loop primers are designed. Using the target miRNA as a template, the first strand of cDNA is synthesized via reverse transcription. One end of this cDNA is a stem-loop primer; opening the stem-loop structure increases the cDNA length. Subsequently, primers are designed using the synthesized cDNA as a template for real-time quantitative PCR amplification. qRT-PCR has many advantages, including high specificity, good sensitivity, speed, and simplicity.
[0030] In some implementations, the basic principle of the probe hybridization method is to hybridize a labeled probe with a miRNA sample, and then detect the signal to determine the expression level of the miRNA. The probe hybridization method includes techniques such as Northern blotting, miRNA expression profiling chips, ribozyme protection analysis, RAKE assay, in situ hybridization, and microsphere-based flow cytometry.
[0031] In some implementations, the high-throughput sequencing method is also known as next-generation sequencing. High-throughput sequencing can sequence hundreds of thousands to millions of DNA molecules simultaneously, greatly improving sequencing efficiency. This type of large-scale sequencing technology significantly increases the speed of interpreting genetic information from multiple species, ensuring the acquisition of sequence information for all miRNAs and deciphering the miRNA map. Simultaneously, high-throughput sequencing makes it possible to perform detailed and comprehensive analysis of the transcriptome and genome of a species, hence it is also called deep sequencing. Representative high-throughput sequencing platforms include Roche's GSFLX sequencer, Illumina's Solexa Genome Analyzer, and ABI's SOLiD sequencer.
[0032] Specifically, the diagnosis refers to the presence of suspected hypoxia-stress-induced cognitive decline in a subject when the level of miR-3473h-p3 in the subject's sample is upregulated.
[0033] In this invention, the term "upregulation" refers to an increase in the absolute or relative amount of a metabolite. When reference results are obtained from subjects or populations known not to have hypoxia-induced cognitive decline, the disease or susceptibility can be diagnosed based on the difference between the test results obtained from the sample and the aforementioned reference results, i.e., based on differences in the qualitative or quantitative composition of at least one metabolite. In some embodiments, the difference in relative or absolute amounts is significant, i.e., outside the reference ranges of the 45th to 55th percentile, 40th to 60th percentile, 30th to 70th percentile, 20th to 80th percentile, 10th to 90th percentile, and 5th to 95th percentile.
[0034] In this invention, verification in real clinical samples collected by this invention revealed that the biomarker miR-3473h-p3 has good diagnostic efficacy for the diagnosis of hypoxia-induced cognitive decline. The diagnostic efficacy is verified by the receiver operating characteristic curve (ROC). The area under the curve (AUC) is the area under the ROC curve, which is well known to those skilled in the art. The determination of AUC helps to compare the accuracy of classifiers across the overall data range.
[0035] A classifier with a larger AUC has a greater ability to accurately classify unknowns between two groups of interest. In distinguishing between two groups, ROC has the performance to represent specific features (e.g., any items of biomarkers and / or additional biomedical information described in this invention) graphically. Typically, the aforementioned feature data are sorted in ascending order across the entire population (e.g., patient group and control group) based on a single feature value. Then, for each value of the aforementioned feature, the true positive rate and false positive rate are calculated for the data. The true positive rate is determined by dividing the number of cases above the value for its feature by the total number of cases. The false positive rate is determined by dividing the number of control groups above the value for its feature by the total number of control groups. Although this definition refers to the case where the feature of the patient group is higher than that of the control group, it also applies to the case where the feature of the patient group is lower than that of the control group (in which case, the number of samples below the value of the aforementioned feature can be calculated).
[0036] ROCs can be generated for other single calculations or for single features. To provide a single sum value, for example, when two or more features are mathematically combined (e.g., addition, subtraction, multiplication, etc.), this single sum value can be represented by an ROC. Additionally, it is possible to plot combinations of multiple features from which a single calculation value can be derived using ROCs. These combinations of features can constitute a test. The ROC described above is a graph representing the true positive rate (sensitivity) of a test relative to the false positive rate (1-specificity) of the test.
[0037] A second aspect of the present invention provides a product for diagnosing hypoxia-induced cognitive decline, the product comprising a reagent for detecting the expression level of the biomarker miR-3473h-p3 in a sample.
[0038] Furthermore, the product includes test kits, test chips, test strips, test systems, test equipment, and test devices.
[0039] Furthermore, the reagents include primers that specifically amplify miR-3473h-p3 and / or probes that specifically recognize miR-3473h-p3.
[0040] Furthermore, the primers for specifically amplifying miR-3473h-p3 include universal primers and self-developed primers, with sequences shown in SEQ ID NO:1.
[0041] The third aspect of this invention provides the application of miR-3473h-p3 in constructing a diagnostic model for hypoxia-induced cognitive decline.
[0042] A fourth aspect of the present invention provides a method for constructing a diagnostic model of cognitive decline induced by hypoxia stress, the method comprising the steps of acquiring miR-3473h-p3 level data in a sample and inputting the data into a machine learning algorithm to construct a diagnostic model.
[0043] Furthermore, the method includes the following steps: dividing the miR-3473h-p3 level data into a test set and a validation set, extracting the biomarker expression level data from the test set and inputting it into a machine learning algorithm to construct a prediction model, and validating the model through the validation set to evaluate its performance.
[0044] Furthermore, the diagnostic model obtains classification results using the following criteria: when the level of miR-3473h-p3 is higher than the optimal cutoff value, the subject is classified as having or suspected of having hypoxia stress-induced cognitive decline; if the level of miR-3473h-p3 is lower than the optimal cutoff value, the subject is classified as not having hypoxia stress-induced cognitive decline.
[0045] In this invention, the term "optimal cutoff value" refers to a value that is statistically relevant to a specific outcome when compared with the analysis results. In a preferred embodiment, the optimal cutoff value is determined based on statistical conclusions from studies comparing patients with hypoxia-induced cognitive decline and healthy subjects. Studies from the literature and the experience of users of the methods described herein can also be used to generate or adjust the optimal cutoff value. The optimal cutoff value can also be determined by taking into account the patient's genetic background, clinical characteristics, work environment, and other relevant factors and outcomes.
[0046] Furthermore, the sample is a serum sample from the subject.
[0047] In some embodiments of the present invention, the methods for constructing the diagnostic model are known to those skilled in the art and can be implemented and realized in different ways, linking biomarker expression levels with a certain probability or risk. Preferably, the measured concentrations of the biomarker and one or more other biomarkers are mathematically combined, and the combined value is associated with the fundamental question of whether or not one has or is suspected of having a disease. The measured biomarker values can be combined using any suitable existing mathematical method, and a predictive model can be constructed using machine learning algorithms.
[0048] Furthermore, the machine learning algorithm includes algorithmic models developed using various development tools.
[0049] Furthermore, the development tools include, but are not limited to, TensorFlow, Scikit-Learn, PyTorch, OpenNN, RapidMiner, Azure Machine Learning, Apache Mahout, Shogun, KNIME, Vertex AI, H2Oai, Anaconda, Keras, Tableau, Fast.ai, Catalyst, Amazon ML, MLJAR, and Spell.
[0050] Furthermore, the algorithm models include, but are not limited to, generalized linear models, principal component analysis, logistic regression analysis, LASSO regression analysis, nearest neighbor analysis, support vector machines, neural network models, random forest models, LightGBM, gradient boosting (GBoost), XGBoost, CatBoost, and decision tree (DT).
[0051] The fifth aspect of the present invention provides a system for diagnosing hypoxia-induced cognitive decline, the system comprising a data classification unit for inputting miR-3473h-p3 level data into a diagnostic model constructed according to the method described in the fourth aspect of the present invention, to obtain a classification result of whether the sample has or is suspected of having hypoxia-induced cognitive decline.
[0052] Furthermore, the system also includes a data acquisition unit, which is used to acquire miR-3473h-p3 level data in the sample.
[0053] Furthermore, the system also includes an output unit for outputting classification results.
[0054] The sixth aspect of this invention provides a diagnostic device for hypoxia-induced cognitive decline and a computer-readable storage medium. The device includes a memory and a processor. The memory stores program instructions. The processor executes the program instructions, which, when executed, perform the following operations: acquiring miR-3473h-p3 level data in a sample, inputting the miR-3473h-p3 level data into a diagnostic model constructed based on the method described in the fourth aspect of this invention, and obtaining a classification result indicating whether the sample has or is suspected of having hypoxia-induced cognitive decline.
[0055] In some embodiments, to provide interaction with a user, the device may be a computer having: a display device for displaying information to the user; and a keyboard and pointing device (e.g., a mouse) through which the user provides input information to the computer. Other types of devices may also be used to provide interaction with a user; for example, feedback provided to the user may be any form of sensory feedback (e.g., visual feedback, auditory feedback, or tactile feedback); and input from the user may be received in any form (including sound input, voice input, or tactile input).
[0056] The computer-readable storage medium stores a computer program that, when executed by a processor, implements the following method: acquiring miR-3473h-p3 level data in a sample, inputting the miR-3473h-p3 level data into a diagnostic model constructed based on the method described in the fourth aspect of the present invention, and obtaining a classification result indicating whether the sample has or is suspected of having hypoxia stress-induced cognitive decline.
[0057] In some embodiments, any combination of one or more computer-readable media may be employed. A computer-readable medium may be a computer-readable signal medium or a computer-readable storage medium. A computer-readable storage medium may be, for example, but not limited to, an electrical, magnetic, optical, electromagnetic, infrared, or semiconductor system, apparatus, or device, or any combination thereof. In this invention, the computer-readable storage medium may be any tangible medium containing or storing a program that can be used by or in conjunction with an instruction execution system, apparatus, or device. More specific examples of computer-readable storage media in some embodiments include, but are not limited to: an electrical connection having one or more wires, a portable computer disk, a hard disk, random access memory (RAM), read-only memory (ROM), erasable programmable read-only memory (EPROM or flash memory), optical fiber, portable compact disk read-only memory (CD-ROM), optical storage device, magnetic storage device, or any suitable combination thereof.
[0058] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:
[0059] This invention is the first to apply miR-3473h-p3 to the diagnosis of hypoxia-induced cognitive decline. Validation using real clinical samples collected in this invention revealed that miR-3473h-p3 exhibits good diagnostic efficacy, high accuracy, sensitivity, and specificity for hypoxia-induced cognitive decline. This invention provides a novel approach and strategy for the research and development of diagnostic products related to hypoxia-induced cognitive decline, and has broad application prospects and significant translational value in this technical field. Attached Figure Description
[0060] Figure 1 This study analyzes the cognitive abilities of young people in high-altitude areas; where A represents the accuracy of matching memory and B represents the reaction time of matching memory.
[0061] Figure 2 The diagnostic efficacy analysis of miR-3473h-p3 was performed. A represents the abundance changes of miR-3473h-p3 in the serum of young people entering high-altitude areas and controls (test set); B represents the ROC curve of miR-3473h-p3 (validation set); C represents the abundance changes of miR-3473h-p3 in the serum of young people entering high-altitude areas and controls (test set); and D represents the ROC curve of miR-3473h-p3 (validation set). Detailed Implementation
[0062] The present invention will be further illustrated below with reference to specific embodiments. These specific embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents.
[0063] The reagents, experimental consumables, and raw materials used in this invention are readily available to those skilled in the art and, unless otherwise specified, can be obtained commercially. Experimental methods not specifying particular conditions in this invention are typically performed under conventional conditions or according to the manufacturer's recommendations. In particular, the following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. It should be noted that the experimental conditions and results described in the following examples are for illustrative purposes only and should not, and will not, limit the invention as described in the claims.
[0064] Example: Diagnostic efficacy analysis of serum miR-3473h-p3 against hypoxia-induced cognitive decline.
[0065] I. Experimental Methods
[0066] 1. Sample Source: This invention recruited 43 young people who had been in high-altitude areas for 3 days from the Century Altar Hospital (hereinafter referred to as the high-altitude youth group), and 20 age- and sex-matched healthy controls were recruited from the same hospital's physical examination center during the same period. The subjects were divided into a test set and a validation set, with 6 controls in the test set and 18 high-altitude youth group, and 14 controls in the validation set and 25 high-altitude youth group.
[0067] 2. Diagnostic efficacy validation: Venous blood was collected from healthy controls and young people from high-altitude areas, and serum was separated. The expression level of miR-3473h-p3 in serum was detected using qPCR (universal primers: miRcute enhanced miRNA quantitative PCR kit (Tiangen, FR411-02); self-developed primers: CCGGACTGCTCTTCCAGAGGTC (SEQ ID NO:1)). Data analysis: All statistical analyses were performed using Prsim 8.0, and results are expressed as mean ± SD. Unpaired t-tests or Wilcoxon rank-sum tests were used.
[0068] II. Experimental Results
[0069] The results showed that, compared with the control group, the accuracy of matching memory decreased by 20.4% and the reaction time increased by 3.0% in the high-altitude youth population. Figure 1 A and B). This demonstrates a significant decline in cognitive function among young people in high-altitude areas.
[0070] Serum analysis results showed that, compared with the control group, the expression level of miR-3473h-p3 in the serum of young people entering high-altitude areas was significantly upregulated. Figure 2 A, C). To verify the diagnostic efficacy of miR-3473h-p3, we plotted ROC curves, with an AUC value of 1.00 for both the test set and the validation set, indicating that miR-3473h-p3 exhibits superior detection sensitivity and specificity. Figure 2 (B, D). The above results further confirm that serum miR-3473h-p3 can be used to diagnose hypoxia-induced cognitive decline.
[0071] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. Application of reagents for detecting the expression level of biomarker miR-3473h-p3 in samples in the preparation of products for diagnosing hypoxia-induced cognitive decline.
2. The application according to claim 1, characterized in that, The products include test kits, test chips, test strips, test systems, test equipment, and test devices; Preferably, the reagent includes primers that specifically amplify miR-3473h-p3 and / or probes that specifically recognize miR-3473h-p3; Preferably, the primers for specifically amplifying miR-3473h-p3 include universal primers and self-developed primers, with sequences as shown in SEQ ID NO:
1.
3. The application according to claim 1, characterized in that, The samples are tissue samples, blood samples, cell samples, urine samples and / or exosome samples from the subject; Preferably, the sample is a blood sample from the subject; Preferably, the sample shown is a serum sample from the subject.
4. A product for diagnosing hypoxia-induced cognitive decline, characterized in that, The product contains a reagent for detecting the expression level of the biomarker miR-3473h-p3 in samples; Preferably, the product includes a test kit, a test chip, a test strip, a test system, a test equipment, and a test device.
5. The product according to claim 4, characterized in that, The reagents include primers that specifically amplify miR-3473h-p3 and / or probes that specifically recognize miR-3473h-p3; Preferably, the primers for specifically amplifying miR-3473h-p3 include universal primers and self-developed primers, with sequences as shown in SEQ ID NO:
1.
6. Application of miR-3473h-p3 in constructing a diagnostic model for hypoxia-induced cognitive decline.
7. A method for constructing a diagnostic model of cognitive decline induced by hypoxia stress, characterized in that, The method includes obtaining miR-3473h-p3 level data in a sample and inputting the data into a machine learning algorithm to construct a diagnostic model. Preferably, the diagnostic model obtains classification results using the following criteria: when the level of miR-3473h-p3 is higher than the optimal cutoff value, the subject is classified as having or suspected of having hypoxia-induced cognitive decline; if the level of miR-3473h-p3 is lower than the optimal cutoff value, the subject is classified as not having hypoxia-induced cognitive decline.
8. The method according to claim 7, characterized in that, The machine learning algorithms include algorithm models developed using various development tools; Preferably, the development tools include TensorFlow, Scikit-Learn, PyTorch, OpenNN, RapidMiner, Azure Machine Learning, Apache Mahout, Shogun, KNIME, Vertex AI, H2Oai, Anaconda, Keras, Tableau, Fast.ai, Catalyst, Amazon ML, MLJAR, and Spell. Preferably, the algorithm model includes generalized linear model, principal component analysis, logistic regression analysis, LASSO regression analysis, nearest neighbor analysis, support vector machine, neural network model, random forest model, LightGBM, gradient boosting (GBoost), XGBoost, CatBoost, and decision tree (DT).
9. A system for diagnosing hypoxia-induced cognitive decline, characterized in that, The system includes a data classification unit, which is used to input miR-3473h-p3 level data into a diagnostic model constructed according to the method of any one of claims 7 or 8, to obtain a classification result of whether the sample has or is suspected of having hypoxia stress-induced cognitive decline. Preferably, the system further includes a data acquisition unit, which is used to acquire miR-3473h-p3 level data in the sample; Preferably, the system further includes an output unit for outputting classification results.
10. A diagnostic device for hypoxia-induced cognitive decline and a computer-readable storage medium, characterized in that, The device includes a memory and a processor; the memory is used to store program instructions; the processor is used to execute the program instructions, which, when executed, are used to perform the following operations: acquire miR-3473h-p3 level data in the sample, input the miR-3473h-p3 level data into a diagnostic model constructed based on the method of any one of claims 7 or 8, and obtain a classification result of whether the sample has or is suspected of having hypoxia stress-induced cognitive decline; The computer-readable storage medium stores a computer program that, when executed by a processor, implements the following method: acquiring miR-3473h-p3 level data in a sample, inputting the miR-3473h-p3 level data into a diagnostic model constructed based on the method of any one of claims 7 or 8, and obtaining a classification result indicating whether the sample has or is suspected of having hypoxia stress-induced cognitive decline.