Application of STX5 in tumor diagnosis, treatment and prognosis

Abstract

The invention discloses application of STX5 as a biomarker in diagnosis, treatment and prognosis of breast tumors. The invention finds that the expression level of STX5 is in negative correlation with breast cancer metastasis, and the prognosis of breast cancer patients with high expression of STX5 is better. Functional verification results show that the migration ability of breast cancer cells is significantly inhibited after overexpression of STX5, the migration efficiency of tumor cells is significantly promoted by knocking down the expression of STX5, and it is proved that STX5 has the function of inhibiting tumor metastasis. The results prove that the STX5 gene or protein has a cancer inhibition effect, is expected to be used as a marker for detecting the metastasis risk and lifetime of the breast cancer, or is developed into an anti-tumor drug, and provides a new thought for diagnosis and treatment of tumors.

Description

Technical Field

[0001] This invention belongs to the field of tumor diagnosis and treatment technology, specifically involving the application of the STX5 gene as a biomarker in the diagnosis and treatment of tumors, and the use of STX5 and / or its enhancers in the preparation of anti-tumor related drugs. Background Technology

[0002] Breast cancer is the most common malignant tumor among women, posing a significant threat to their health. The latest data from the National Cancer Institute shows that breast cancer accounts for 16.72% of all new cancer cases. According to the latest statistics from the American Cancer Society, between 2010 and 2019, the incidence of breast cancer continued to increase at a rate of 0.5% per year. However, with the improvement and widespread adoption of breast cancer screening, diagnosis, and treatment strategies, the mortality rate of breast cancer has decreased by 43% over the past thirty years. Nevertheless, nearly 12% of confirmed breast cancer cases eventually develop into metastatic disease.

[0003] Distant metastasis is a leading cause of death in breast cancer patients. Currently, the molecular mechanisms of breast cancer metastasis are not fully understood, and reliable molecular targets and treatment strategies are lacking. Therefore, strengthening the screening of genes related to adenocarcinoma metastasis is particularly important, and it is hoped that this will provide experimental evidence and potential targets for the treatment and prognosis of metastatic breast cancer. Summary of the Invention

[0004] To achieve the above objectives, this invention found that the expression level of STX5 is negatively correlated with breast cancer metastasis, and breast cancer patients with high STX5 expression have a better prognosis. Functional validation results showed that overexpression of STX5 significantly inhibited the migration ability of breast cancer cells, while knockdown of STX5 expression significantly promoted the migration ability of tumor cells, proving that STX5 has the function of inhibiting tumor metastasis and that the STX5 gene or protein has an anti-cancer effect.

[0005] In a first aspect, the present invention provides the use of the STX5 gene, mRNA, cDNA, or protein, or a detection reagent thereof, for (a) as a biomarker for detecting the risk of metastasis in breast cancer; and / or (b) as a biomarker for assessing the prognosis and survival of breast cancer patients; and / or (c) for preparing diagnostic reagents or kits for detecting the risk of metastasis in breast cancer; and / or (d) for preparing diagnostic reagents or kits for assessing the prognosis and survival of breast cancer patients.

[0006] In another preferred embodiment, the diagnostic reagent includes antibodies, primers, probes, sequencing libraries, nucleic acid chips (such as DNA chips), or protein chips.

[0007] In another preferred embodiment, the protein comprises a full-length protein or a protein fragment.

[0008] In another preferred embodiment, the STX5 gene, mRNA, cDNA, or protein is derived from mammals, preferably rodents (such as mice and rats), primates, and humans, and more preferably from patients diagnosed with breast cancer.

[0009] In another preferred embodiment, the accession number of the STX5 gene is 6811, full name syntaxin 5, also known as SED5A; CDG2AA.

[0010] In another preferred embodiment, the detection is a tissue sample detection.

[0011] In another preferred embodiment, the detection includes immunohistochemistry, Western blotting, and quantitative real-time PCR.

[0012] In another preferred embodiment, the metastasis includes lung metastasis, bone metastasis, and brain metastasis.

[0013] In another preferred embodiment, the detection is performed on a breast cancer tissue sample or a general breast tissue sample.

[0014] In another preferred embodiment, the detection reagent includes a specific antibody against STX5, a specific binding molecule against STX5, specific amplification primers, a probe, or a chip.

[0015] In another preferred embodiment, the STX5 protein or its specific antibody or specific binding molecule is conjugated with or carries a detectable marker.

[0016] In another preferred embodiment, the detectable marker is selected from the group consisting of chromophores, chemiluminescent groups, fluorophores, isotopes, or enzymes.

[0017] In another preferred embodiment, the specific antibody for STX5 is a monoclonal antibody or a polyclonal antibody.

[0018] In a second aspect, the present invention provides a diagnostic kit for (i) detecting the risk of metastasis in breast cancer; and / or (ii) determining the prognosis and survival of breast cancer patients, said kit comprising a container containing a detection reagent for detecting the STX5 gene, mRNA, cDNA, or protein; and a label or instruction manual indicating that said kit is used for (i) detecting the risk of metastasis in breast cancer; and / or (iii) determining the prognosis and survival of breast cancer patients.

[0019] In another preferred embodiment, the judgment includes a preliminary judgment (prediction).

[0020] In another preferred embodiment, the detection reagent for detecting the STX5 gene, mRNA, cDNA, or protein includes:

[0021] (a) Specific antibodies against STX5 protein; and / or

[0022] (b) Specific primers for specific amplification of STX5 mRNA or cDNA.

[0023] In another preferred embodiment, the detection is a tissue sample detection.

[0024] In another preferred embodiment, the label or instruction manual includes the following information:

[0025] (a) When the STX5 expression level E1 in the breast cancer cells or tissues of the test subject is lower than the STX5 expression level E2 in general breast cancer cells or tissues, it suggests that the test subject has a higher risk of lung metastasis of cancer cells than the general population.

[0026] (b) When the STX5 expression level E1 in the breast cancer cells or tissues of the test subject is lower than the STX5 expression level E2 in general breast cancer cells or tissues, it suggests that the test subject has a higher probability of poor prognosis and shortened survival than the general population.

[0027] Here, E2 refers to the expression level of STX5 in general breast cells or tissues of the general population.

[0028] Thirdly, the present invention provides a method for (i) detecting the risk of metastasis in breast cancer; and / or (ii) determining the prognosis and survival of breast cancer patients, said method being used for non-disease diagnostic and treatment methods, said method comprising:

[0029] a) Provide test samples from the subjects;

[0030] b) Detect the expression level (E1) of STX5 protein in the test sample;

[0031] c) Compare the expression level of STX5 protein measured in step b) with the control.

[0032] Compared with the control, the expression level of STX5 protein in the sample was lower than the reference value, indicating that the subject had a higher risk of lung metastasis than the general population (control group); and / or the expression level of STX5 protein was higher than the reference value, indicating that the subject had a lower risk of lung metastasis of cancer cells than the general population (control group); and / or compared with the control, the expression level of STX5 protein in the sample was higher than the reference value, indicating that the subject had a lower probability of poor prognosis and shortened survival than the general population (control group); and / or the expression level of STX5 protein was lower than the reference value, indicating that the subject had a higher probability of poor prognosis and shortened survival than the general population (control group).

[0033] In another preferred embodiment, the subject is a human or a non-human mammal.

[0034] Fourthly, the present invention provides a method for determining a treatment regimen, comprising: a) providing a test sample from a subject; b) detecting the expression level of STX5 protein in the test sample; and c) determining a treatment regimen based on the expression level of STX5 protein in the sample.

[0035] The treatment regimens include STX5 promoter therapy and STX5 promoter combined with chemotherapeutic agents (chemotherapeutic drugs) (such as combination therapy of paclitaxel and anthracyclines).

[0036] Fifthly, the present invention provides the use of STX5 and / or its enhancers in the preparation of antitumor-related drugs.

[0037] In another preferred embodiment, the STX5 is a substance selected from the group consisting of the STX5 gene, STX5 mRNA, cDNA, STX5 protein, or an active fragment of any of the aforementioned.

[0038] In another preferred embodiment, the STX5 enhancer includes substances that increase the transcriptional level or protein level of STX5, activate the STX5 signaling pathway, delay STX5 metabolism, or inhibit STX5 degradation.

[0039] In another preferred embodiment, the STX5 enhancer is selected from: an overexpression vector of the STX5 gene, a viral vector carrying the STX5 gene, nanoparticles carrying the STX5 gene, STX5 protein, STX5 gene or protein carried by extracellular vesicles, STX5 gene or protein encapsulated in liposomes, PEG-modified STX5 protein, STX5 protein microspheres, etc.

[0040] In another preferred embodiment, the STX5 enhancer is selected from: natural purified substances, modified natural purified substances, semi-synthetic substances, chemically synthesized substances, enzymes, traditional Chinese medicine, compositions, etc.

[0041] In a sixth aspect, the present invention provides a medicament for promoting the expression of the STX5 gene or its protein, including use for preparing a compound, composition or formulation, characterized in that the compound, composition or formulation is used to (a) promote the expression of the STX5 gene or its protein; (b) inhibit the growth or proliferation of breast cancer cells; and / or (c) inhibit the metastasis of breast cancer cells; and / or (d) prevent and / or treat breast cancer; and / or (e) increase the sensitivity of breast cancer cells to chemotherapeutic agents.

[0042] In a seventh aspect, the present invention provides a pharmaceutical combination comprising: (a1) STX5 and / or an enhancer thereof; (a2) an optional chemotherapeutic agent; and (b) a pharmaceutically acceptable carrier.

[0043] In another preferred embodiment, the pharmaceutical composition further includes:

[0044] (c) Other medications for the prevention and / or treatment of breast cancer.

[0045] In another preferred embodiment, the promoter should include a compound, composition, or formulation that promotes the expression of the STX5 gene or its protein.

[0046] In another preferred embodiment, the chemotherapeutic agent is selected from the group consisting of taxanes and anthracyclines, or combinations thereof.

[0047] In another preferred embodiment, the weight ratio of component (a1) to component (a2) is 100:1-0.01:1, more preferably 10:1-0.1:1, and even more preferably 2:1-0.5:1.

[0048] In another preferred embodiment, the content of component (a1) in the pharmaceutical composition is 1%-99%, more preferably 10%-90%, and even more preferably 30%-70%.

[0049] In another preferred embodiment, the content of component (a2) in the pharmaceutical composition is 1%-99%, more preferably 10%-90%, and even more preferably 30%-70%.

[0050] In another preferred embodiment, the content of component (c) in the pharmaceutical composition is 1%-99%, more preferably 10%-90%, and even more preferably 30%-70%.

[0051] In another preferred embodiment, the component (a1) and optional components (a2) and optional components (c) in the pharmaceutical composition account for 0.01-99.99 wt% of the total weight of the pharmaceutical composition, more preferably 0.1-90 wt%, and more preferably 1-80 wt%.

[0052] In another preferred embodiment, the dosage form of the pharmaceutical composition includes injectable and oral dosage forms.

[0053] In another preferred embodiment, the oral dosage form includes tablets, capsules, films, and granules.

[0054] In another preferred embodiment, the dosage form of the pharmaceutical composition includes a sustained-release dosage form and a non-sustained-release dosage form.

[0055] Eighthly, the present invention provides a medicine box, comprising:

[0056] (a1) A first container, and an enhancer of the STX5 gene or its protein located in the first container, or a drug containing an enhancer of the STX5 gene or its protein;

[0057] (b1) An optional second container, and a chemotherapy agent or a drug containing a chemotherapy agent located in the second container.

[0058] In a ninth aspect, the present invention provides the use of the above-described pharmaceutical composition or the above-described kit for (a) inhibiting the growth and proliferation of breast cancer cells; and / or (b) inhibiting the metastasis of breast cancer cells; and / or (c) preventing and / or treating breast cancer.

[0059] In a tenth aspect, the present invention provides a method for culturing breast cancer cells in the presence of an in vitro non-therapeutic inhibitor of breast cancer cells, thereby inhibiting the growth or proliferation of breast cancer cells.

[0060] In one aspect, the present invention provides a method for screening candidate compounds for the prevention and / or treatment of breast cancer, the method comprising the steps of:

[0061] (a) In the test group, the test compound was added to the cell culture system and the expression level (E1) and / or activity (A1) of STX5 in the cells of the test group were observed; in the control group, the test compound was not added to the same cell culture system and the expression level (E0) and / or activity (A0) of STX5 in the cells of the control group were observed.

[0062] If the expression level (E1) and / or activity (A1) of STX5 in the test group is significantly higher than that in the control group, it indicates that the test compound is a candidate compound for the prevention and / or treatment of breast cancer that promotes the expression and / or activity of STX5.

[0063] The technical effects of this invention are as follows:

[0064] A literature search revealed no previous reports on the relationship between STX5 and breast cancer. This invention, compared to existing technologies, is the first to discover a negative correlation between STX5 expression levels and breast cancer metastasis, with breast cancer patients exhibiting high STX5 expression showing better prognosis. Functional validation results showed that overexpression of STX5 significantly inhibited the migration ability of breast cancer cells, while knockdown of STX5 expression significantly promoted tumor cell migration, demonstrating that STX5 has an inhibitory function on tumor metastasis and that the STX5 gene or protein possesses anti-cancer properties.

[0065] In summary, this invention confirms that STX5 is a novel biomarker for monitoring breast cancer metastasis, and related products can be formulated into kits for detecting breast cancer metastasis; STX5 can inhibit the occurrence and development of breast cancer, and STX5 and / or its enhancers can be used to prepare anti-tumor related drugs. Attached Figure Description

[0066] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0067] Figure 1 The expression level of STX5 in primary breast cancer tissue, metastatic lymph nodes, and metastatic lesions is shown.

[0068] Figure 2 Correlation analysis of STX5 with breast cancer prognosis.

[0069] Figure 3 To validate the efficiency of STX5 stable interference and overexpression in cell lines.

[0070] Figure 4 The effect of STX5 on the in vitro metastasis ability of breast cancer cells was detected using Transwell assay. Detailed Implementation

[0071] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustration and explanation only and are not intended to limit the invention as detailed in the claims. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional methods, and the experimental materials used are available from commercial companies unless otherwise specified.

[0072] Example 1: Analysis of STX5 expression levels in primary breast cancer tissue, metastatic lymph nodes, and metastatic lesions using an online database.

[0073] The expression levels of STX5 in primary breast cancer tissue, metastatic lymph nodes, and metastatic lesions were analyzed using the TCGA database (UALCAN(uab.edu)) and the bc-GenExMinerv5.0 database (exhaustive gene expression analysis module|bc-GenExMiner(unicancer.fr)).

[0074] Example 2: Analyzing the correlation between STX5 and breast cancer prognosis using an online database.

[0075] The correlation between STX5 gene expression and breast cancer prognosis was analyzed using the bc-GenExMiner v5.0 database (website: exhaustive gene expression analysis module|bc-GenExMiner(unicancer.fr)), the online database Kaplan-Meier (website: https: / / kmplot.com / analysis / ), and The Human Protein Atlas database (website: https: / / www.proteinatlas.org / ).

[0076] Example 3: Efficiency verification of STX5 stable interference and overexpression cell lines

[0077] 1. Constructing a breast cancer cell model with STX5 overexpression

[0078] 1.1 Linearization of pCDH plasmid:

[0079] pCDH plasmid was digested with BamHI / EcoRI (37℃, 4h); the digested product (7kb) was separated and recovered by 1% Agarose electrophoresis (120V, 30min).

[0080] 1.2 Amplification of the STX5 CDS fragment:

[0081] Amplification primers containing sticky ends of BamHI / EcoRI were designed based on the CDS sequence of the STX5 gene. The STX5 CDS fragment was amplified using cDNA as a template, and the PCR amplification product (1080bp) was recovered by 1% agarose electrophoresis. The amplification product was also treated with double digestion of BamHI / EcoRI to expose the sticky ends, and then separated and recovered by 1% agarose.

[0082] STX5 PCR amplification primer sequences:

[0083] Positive: 5'-CCGGAATTCatgatcccgcggaaacgctacg-3'

[0084] Reverse: 5'-CGCGGATCCtcaagcaaggaagaccacaaagatgatg-3'

[0085] 1.3 Ligation to form pCDH-STX5 overexpression plasmid

[0086] 3 μL of linearized pCDH plasmid was mixed with 2 μL of enzyme-digested STX5 amplified fragment, and after being reacted with T4 DNA ligase at 16℃ for 1 h, it was transformed into DH5α competent cells and plated on LB plates containing Amp. The cells were then incubated upside down at 37℃ overnight. Single clones were picked and amplified, plasmids were extracted and Sanger sequencing was performed to identify whether the construction was successful.

[0087] 1.4 Packaging Virus

[0088] HEK-293T cells were co-transfected with pCDH-STX5 plasmid and pVSVg / psPAX2 packaging plasmid using PEI transfection reagent. After culturing for 48 h, the culture supernatant was collected and filtered through a 0.45 μm filter to remove cell debris and other impurities, thus obtaining the viral solution.

[0089] 1.5 Infecting and stabilizing STX5-low-expressing cell lines

[0090] The virus solution was added to the cells at a 1:1 ratio with the complete culture medium. The cells were then incubated at 37°C and 5% CO2 for 12 hours. The culture medium was then replaced with the complete culture medium, and the cells were incubated for another 24 hours. The culture medium was then replaced with the complete culture medium containing Puromycin. Positive transformants were obtained by screening.

[0091] 1.6 Identification

[0092] Real-time PCR was used to identify whether STX5 was successfully overexpressed in target cells.

[0093] 2. Constructing an STX5 knockdown breast cancer cell model

[0094] 2.1 Linearization of pLKO.1 plasmid

[0095] pLKO.1 plasmid was digested with AgeI / EcoRI (37℃, 4h);

[0096] The enzyme digestion product (7kb) was separated and recovered by 1% agarose electrophoresis (120V, 30min).

[0097] 2.2 Design and synthesis of shRNAoligos

[0098] Based on the target gene CDS sequence, a shRNA loop structure sequence containing AgeI / EcoRI sticky ends was designed; each pair of shRNAoligos was pre-denatured at 95℃ for 5 min and then naturally cooled to form a double-stranded shRNA structure.

[0099] STX5 shRNA sequence:

[0100] Positive:

[0101] 5'- CCGGCCAGACAAATAAGCCAGCTTTCTCGAGAAAGCTGGCTTATTTGTCTGGTTTTTG -3'

[0102] Reverse:

[0103] 5'- AATTCAAAAACCAGACAAATAAGCCAGCTTTCTCGAGAAAGCTGGCTTATTTGTCTGG -3'

[0104] 2.3 Ligation to form pLKO.1-shRNA low-expression plasmid

[0105] Take 3 μL of linearized pLKO.1 plasmid and 2 μL of degenerated shRNAoligos, react with T4 DNA ligase at 16℃ for 1 h, transform DH5α competent cells, plate them on LB plates containing Amp, and incubate them upside down at 37℃ overnight.

[0106] Single clones were selected and amplified, plasmids were extracted and Sanger sequencing was performed to determine whether the construction was successful.

[0107] 2.4 Packaging Virus

[0108] HEK-293T cells were co-transfected with pLKO.1-shRNA plasmid and pVSVg / psPAX2 packaging plasmid using PEI transfection reagent. After 48 h of culture, the culture supernatant was collected and filtered through a 0.45 μm filter to remove cell debris and other impurities, yielding the viral solution.

[0109] 2.5 Infecting and stabilizing STX5-low-expressing cell lines

[0110] Virus solution was added to cells at a 1:1 ratio with complete culture medium and incubated at 37°C and 5% CO2 for 12 hours. The culture medium was then replaced with complete culture medium, and incubated for another 24 hours. Afterward, the culture medium was replaced with complete culture medium containing puromycin, and positive transformants were screened.

[0111] 2.6 Identification

[0112] Real-time PCR was used to identify whether STX5 expression was successfully knocked down in target cells. 3. RNA extraction

[0113] RNA extraction was performed entirely using RNase-free Eppendorf tubes and RNase-free pipette tips, and masks were worn properly.

[0114] The specific steps are as follows:

[0115] (1) When the cell density in the 10cm culture dish reaches 80-90%, discard the culture medium, add 2mL of Trizol, and repeatedly blow it with a pipette tip to aspirate it into two 1.5mL Eppendorf tubes. Store one of them at -80℃ for later use, and use the other for subsequent experiments.

[0116] (2) After standing at room temperature for 10 minutes for lysis, add 200 μL of chloroform and immediately shake vigorously for about 15 seconds, then place at room temperature for 2 minutes. Centrifuge at 12000g at 4℃ for 15 minutes, and carefully remove the centrifuge tube.

[0117] (3) Transfer the upper clear aqueous phase to a new 1.5 mL Eppendorf tube, then add 500 μL of isopropanol, gently invert the tube 8 times, let it stand at room temperature for 10 minutes, and centrifuge at 12000g at 4℃ for 15 minutes. The white precipitate at the bottom of the Eppendorf tube is RNA.

[0118] (4) After thoroughly discarding the supernatant, add 1 ml of 75% ethanol (prepared with DEPC water) to the Eppendorf tube, gently invert 6-8 times, centrifuge at 7500g for 5 minutes at 4°C, discard the supernatant, and continue centrifuging at 7500g for 2 minutes at 4°C. Thoroughly aspirate any remaining liquid. Open the tube and dry the RNA at room temperature. When the precipitate is translucent, add 20-40 μL of DEPC water to dissolve the RNA precipitate and measure the RNA concentration using a Nanodrop instrument.

[0119] 4. Reverse transcription of RNA

[0120] The reaction system used in this experiment is as follows (reverse transcription kit, TaKaRa):

[0121]

[0122] PCR instrument program settings: 37℃ for 15 minutes; 85℃ for 5 seconds; 4℃ Hold. Collect samples after reaching 4℃. Reverse-transcribed cDNA samples can be stored at -20℃.

[0123] 5 Real-time PCR (384-well plate)

[0124] STX5 Realtime-PCR identification primer sequences:

[0125] Positive: 5'-GCGCATTGGGAAAGACCTTAGC-3'

[0126] Reverse: 5'-CTGGCTGCCCTTGGCTCTCAC-3'

[0127] The PCR amplification reaction system (50 μL / well) was prepared as follows:

[0128]

[0129] PCR amplification conditions:

[0130] Step 1:

[0131] 95℃ for 5 minutes

[0132] Step 2: 40 cycles

[0133] 95℃ 30s

[0134] 60℃ 30s

[0135] 72℃ for 1 minute

[0136] Step 3:

[0137] 72℃ for 5 minutes

[0138] Results analysis: The results were analyzed using 2-ΔΔct to represent the relative changes in the expression of the target gene. Δct refers to the Ct value of the target gene minus the average Ct value of the internal reference gene, and ΔΔct refers to the Δct value of the target gene minus the Δct value of the control group gene.

[0139] Example 4: Detection of the effect of STX5 on the in vitro metastasis ability of breast cancer cells

[0140] (1) Cells with a density of 80-90% (Hs578T pCDH, Hs578T STX5-OE, 231pCDH, 231STX5-OE, 231Sh-scramble, 231shSTX5) were digested with trypsin and centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in DMEM without serum and antibiotics. After counting the cells with a cell counter, the density of the cell suspension was adjusted to 2.5×105 cells / mL. Among them: Hs578T-Ctrl (also known as Hs578T pCDH, which is the control group of Hs578T cells overexpressing pCDH), Hs578T-STX5-OE (which is the control group of Hs578T cells overexpressing STX5); 231-Ctrl (also known as 231pCDH, which is the control group of MDA-MB-231 cells overexpressing pCDH), 231-STX5-OE (which is the group of MDA-MB-231 cells overexpressing STX5); 231-shScramble (which is the control group of MDA-MB-231 cells knocked down), 231-shSTX5 (which is the group of MDA-MB-231 cells knocked down STX5).

[0141] (2) Add 0.6 mL of culture medium (containing 20% ​​serum) to each well of a 24-well culture plate. Use tweezers to place the Transwell chamber into the 24-well plate containing the culture medium, avoiding the formation of air bubbles. After mixing the adjusted cell suspension, add 200 μL (5 × 10⁴ cells / well) to each chamber and gently place it in an incubator. Incubate for 5-18 h according to cell migration ability.

[0142] (3) After a specific culture time, take out the chamber and fix it in crystal violet (containing methanol) for 30 min. Carefully wipe off the cells in the inner layer of the chamber with a cotton swab in water and invert the chamber to let it air dry naturally.

[0143] (4) Using an inverted microscope, randomly photograph 3-4 fields of view in the chamber, and then count and statistically analyze them.

[0144] Example of effect 1

[0145] Analysis of the TCGA dataset indicated that STX5 was expressed at relatively low levels in metastatic tissues compared to primary tissues. This suggests a negative correlation between STX5 expression levels and breast cancer metastasis (see [link to relevant documentation]). Figure 1 ).

[0146] Example 2

[0147] STX5 expression levels are positively correlated with the prognosis of breast cancer patients, meaning that breast cancer patients with high STX5 expression have a better prognosis, suggesting that STX5 functions as a tumor suppressor gene in breast cancer (see...). Figure 2 ).

[0148] Example 3: Constructing STX5-overexpressing or knocked-down breast cancer cell lines to investigate the role of STX5 in breast cancer metastasis.

[0149] To verify the role of STX5 in breast cancer metastasis at the cellular level, we constructed STX5 knockdown and overexpression cell lines using lentiviral infection. The gene knockdown plasmid used was pLKO.1puro plasmid (…). Figure 3 A), the gene overexpression plasmid used was pCDH-CMV-MCS-EF1-copGFP plasmid ( Figure 3 B). Real-time PCR was used to confirm the significant effects of STX5 knockdown and overexpression (see [link]). Figure 3 C and 3D, **p<0.01, differences between groups were analyzed by t-test). Using Transwell assays in breast cancer cells, overexpression of STX5 significantly inhibited the migration ability of breast cancer cells; knockdown of STX5 significantly promoted the migration efficiency of tumor cells. Figure 4 ).

[0150] The above experiments confirm that STX5 plays a role in inhibiting tumor metastasis in breast cancer.

[0151] It should be noted that the above descriptions are merely embodiments of the present invention and do not limit the patent scope of the present invention. Any direct or indirect applications made using the description and drawings of the present invention in other related technical fields are similarly included within the patent protection scope of the present invention. Therefore, any technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the protection scope defined by the claims.

Claims

1. The use of an STX5 gene, mRNA, cDNA, or protein, or a detection reagent thereof, characterized in that, (a) Used as a biomarker to detect the risk of breast cancer metastasis; and / or (b) Used as a biomarker to determine the prognosis and survival of breast cancer patients; and / or (c) Diagnostic reagents or kits used to prepare for detecting the risk of metastasis in breast cancer; and / or (d) Used to prepare diagnostic reagents or kits for use in determining the prognosis and survival of breast cancer patients.

2. A diagnostic kit for (i) detecting the risk of metastasis in breast cancer; and / or (ii) determining the prognosis and survival of breast cancer patients, characterized in that, The kit contains a container containing a detection reagent for detecting the STX5 gene, mRNA, cDNA, or protein; and a label or instruction manual indicating that the kit is used to detect (i) the risk of metastasis in breast cancer; and / or (iii) to determine the prognosis and survival of breast cancer patients.

3. A method for (i) detecting the risk of metastasis in breast cancer; and / or (ii) determining the prognosis and survival of breast cancer patients, characterized in that, The method is used for non-disease diagnosis and treatment purposes, and the method includes: a) Provide test samples from the subjects; b) Detect the expression level of STX5 protein (E1) in the test sample; and c) Compare the STX5 protein expression level measured in step b) with the control. Compared to the control group, the expression level of STX5 protein in the sample was lower than the reference value, indicating that the subject had a higher risk of tumor metastasis than the general population (control group); and / or the expression level of STX5 protein was higher than the reference value, indicating that the subject had a lower risk of tumor metastasis than the general population (control group); and / or Compared with the control group, the expression level of STX5 protein in the sample was higher than the reference value, indicating that the subjects had a lower probability of poor prognosis and shortened survival than the general population (control group); and / or the expression level of STX5 protein was lower than the reference value, indicating that the subjects had a higher probability of poor prognosis and shortened survival than the general population (control group).

4. A method for determining a treatment plan, characterized in that... include: a) Provide test samples from the subjects; b) Detect the expression level of STX5 protein in the test samples; and c) Determine the treatment regimen based on the expression level of STX5 protein in the sample.

5. Use of STX5 and / or its enhancers in the preparation of antitumor-related drugs. in, The STX5 is a substance selected from the group consisting of: the STX5 gene, STX5 mRNA, cDNA, STX5 protein, or an active fragment of any of the aforementioned. The STX5 enhancer includes substances that increase the transcriptional and protein levels of STX5, activate the STX5 signaling pathway, delay STX5 metabolism, or inhibit STX5 degradation.

6. STX5 and / or its enhancers are characterized in that the compound, composition or formulation is used to (a) promote the expression of the STX5 gene or its protein; (b) inhibit the growth or proliferation of breast cancer cells; and / or (c) inhibit the metastasis of breast cancer cells; and / or (d) prevent and / or treat breast cancer; and / or (e) increase the sensitivity of breast cancer cells to chemotherapeutic agents.

7. A pharmaceutical composition, characterized in that, include: (a1) STX5 and / or its enhancers; (a2) Optional chemotherapy agents; and (b) Pharmaceutically acceptable carriers.

8. A medicine box, characterized in that, include: (a1) A first container, and an enhancer of the STX5 gene or its protein located in the first container, or a drug containing an enhancer of the STX5 gene or its protein; (b1) An optional second container, and a chemotherapy agent or a drug containing a chemotherapy agent located in the second container.

9. Use of the pharmaceutical composition of claim 7 or the medicine box of claim 8, characterized in that, Used for (a) inhibiting the growth and proliferation of breast cancer cells; and / or (b) inhibiting the metastasis of breast cancer cells; and / or (c) preventing and / or treating breast cancer.

10. Breast cancer cells are cultured in the presence of an in vitro non-therapeutic inhibitor of breast cancer cells, thereby inhibiting the growth or metastasis of breast cancer cells.

11. A method for screening candidate compounds for the prevention and / or treatment of breast cancer, characterized in that, The method includes the following steps: In the test group, the test compound was added to the cell culture system, and the expression level (E1) and / or activity (A1) of STX5 in the cells of the test group were observed; in the control group, the test compound was not added to the same cell culture system, and the expression level (E0) and / or activity (A0) of STX5 in the cells of the control group were observed. If the expression level (E1) and / or activity (A1) of STX5 in the test group is significantly higher than that in the control group, it indicates that the test compound is a candidate compound for the prevention and / or treatment of breast cancer that promotes the expression and / or activity of STX5.

Images