Animal models of ADAR1-derived breast cancer brain metastases and methods for using them

Abstract

In alternative embodiments, provided are methods comprising use of orthotopic and organoid models to better characterize ADAR1 activity in breast cancer (BC) metastatic niches, with a special focus on the less studied brain metastasis (BM). Methods as provided herein provide new insights into the mechanistic role of ADAR1 in breast metastatic disease and provide novel models for developing or discovering new therapeutics, such as as drugs, effective against BC and BM.

Description

[0001] PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0002] ANIMAL MODELS OF ADAR1-DERIVED BREAST CANCER BRAIN METASTASES AND METHODS FOR USING THEM

[0003] REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0004] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on September 17, 2024, is named “0321_158062PCT".xml” and is 5,107 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.

[0005] TECHNICAL FIELD

[0006] This invention generally relates to cancer biology. In alternative embodiments, provided are methods comprising use of orthotopic and organoid models to better characterize AD ARI (adenosine deaminase acting on RNA-1 protein) activity in breast cancer (BC) metastatic niches, with a special focus on the less studied brain metastasis (BM). Methods as provided herein provide new insights into the mechanistic role of AD ARI in breast metastatic disease and provide novel models for the development of new therapeutics against BC and BM.

[0007] BACKGROUND

[0008] Approximately 10 to 20% of patient diagnosed with breast cancer (BC) will develop metastatic disease which remains the leading cause of death. Breast is the second organ, after the lung, at high risk of developing brain metastases (BM). The incidence of BM is increasing due to improved treatments and detection of metastatic sites.

[0009] Adenosine deaminase acting on dsRNA (AD ARI) is known to drive transcriptome remodeling through a plethora of mechanisms (including changes in amino acid sequence, mRNA splicing and / or canonical polyadenylation sites) which can also promote cancer stem cells progression.

[0010] AD ARI pl 50, the interferon-inducible isoform, favors the alternative splicing of proteins with invasive potential in leukemia stem cells. In telomerase positive cancer, AD ARI has been found to promote telomerase activity by resolving R-loop formation in RNA: DNA hybrids of aberrant telomeric repeats. PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0011] In BC, AD ARI plays an essential role in cell survival due to increased apoptosis and reduced proliferation found in multiple BC cell lines engineered to express reduced levels of AD ARI.

[0012] High levels of AD ARI have been associated with shorter survival and disease progression in BC patients, however, the role of AD ARI is only partially understood in the context of metastasis.

[0013] SUMMARY

[0014] In alternative embodiments, provided are methods for screening for an identifying a new therapeutic effective against breast cancer (BC) and BC-caused brain metastasis (BM), wherein optionally the new therapeutic comprises a drug, and optionally the therapeutic or drug treats or ameliorates, or slows the progression of, a BC or a BM, the method comprising:

[0015] (a) providing or having provided a murine tumor or a cancer cell, or a plurality of murine tumor or a cancer cells, wherein optionally the murine tumor or a cancer cell, or a plurality of murine tumor or cancer cells comprise a breast cancer cell, or a murine or a human breast cancer cell, or a Triple-Negative Breast Cancer (TNBC) cancer cell, optionally MDA- MD-231 TNBC cancer cells;

[0016] (b) providing or having provided a reporter construct comprising: a bioluminescence reporter construct (optionally a luciferase reporter construct), a green fluorescent protein (GFP) reporter construct, a red fluorescent protein (RFP) reporter construct, a yellow fluorescent protein (YFP) reporter construct, an ADARl-nano-luc reporter construct, a NANLUC™-luciferase reporter construct, a SEAP (Secreted Alkaline Phosphatase) reporter construct, or a P-Galactosidase (P-Gal) reporter construct, for (or capable of) detecting, tracing or measuring AD ARI (adenosine deaminase acting on RNA-1 protein) activity, wherein optionally the AD ARI is an AD ARI pl 50 protein; PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0017] (c) providing or having provided a rodent or a species from the family Muridcte. wherein optionally the rodent or species from the family Muridae is a mouse; wherein optionally the rodent is a rodent pup (optionally a mouse pup), and wherein optionally the pup is a neonatal pup (optionally a neonatal mouse), wherein optionally the murine animal is Rag2- / - yc- / - strain;

[0018] (d) providing or having provided a test therapeutic or a test drug, wherein optionally the test therapeutic or the test drug comprises a small molecule, a nucleic acid, a carbohydrate or a protein or peptide, and optionally the protein is an antibody or a cytokine, and optionally the nucleic acid is an inhibitory nucleic acid, optionally a micro-RNA, optionally mi-RNA;

[0019] (e) transducing the tumor or cancer cell, plurality of murine tumor or a cancer cells, with the reporter construct;

[0020] (f) implanting into a brain of the murine animal the transduced tumor or cancer cell or plurality of transduced murine tumor or a cancer cells, wherein optionally the implanting comprises a method comprising an intracerebroventricular injection (ICV), wherein optionally the transduced tumor or cancer cell or plurality of transduced murine tumor or cancer cells are implanted on postnatal day 0, 1, 2, 3, 4, 5, 6, 7 or 8, wherein optionally the transduced tumor or cancer cell or plurality of transduced murine tumor or cancer cells are implanted on two or more days, or are implanted on 2, 3, 4, 5 or 6 separate days, wherein optionally about 102to 1012murine tumor or cancer cells are implanted per administration (or injection) event;

[0021] (g) waiting a period of time to allow the implanted transduced tumor or cancer cell, wherein optionally the period of time is between about 2 days and 2 months, or between about 3 days and 2 months, or between about 4 days and 6 weeks, or between about 5 days and one month, or about 1, 2, 3, 4, 5 or 6 weeks; and

[0022] (h) administering to the murine animal a test therapeutic or a test drug, wherein optionally the test drug is administered intrathecally, enterally or parenterally, or by ICV or osmotic mini-pump infusion, PATENT 0321.158062PCT / SD2023 -391 -2PCT and optionally the test therapeutic is radiation therapy; and

[0023] (i) determining if the test therapeutic or test drug reduces or inhibits AD ARI expression or activity, optionally AD ARI pl 50 expression or activity, wherein optionally AD ARI (optionally AD ARI pl 50) levels of expression or activity in a brain and / or a spinal cord is measured or determined, and optionally an increase in detected report levels (optionally GFP, YFP, RFP) levels or increase in luciferase, Alkaline Phosphatase or P-Galactosidase activity indicates an increase in AD ARI expression or activity, wherein optionally levels of expression or increase in expression or activity of WNT / p-catenin pathway and / or APOBEC mutagenesis genes are also measured or determined, wherein optionally a method comprising FACS-analysis is used to detect upregulation or levels of expression or increase in expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally a method comprising reverse transcription polymerase chain reaction (RT-PCR) is used to detect upregulation or levels of expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally a method comprising FACS and reverse transcription polymerase chain reaction (RT-PCR) is used to detect upregulation or levels of expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally AD ARI (optionally AD ARI pl 50) levels of expression or activity in a brain and / or a spinal cord is measured or determined by enzymatically digesting brains or spinal cord to general a whole brain or spinal cord extract, and FACS-sorting of GFP+ cells is performed on the whole brain or spinal cord extract, wherein a test therapeutic or a test drug that reduces or inhibits AD ARI expression or activity (optionally AD ARI expression or activity pl 50 protein activity), and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes, is determined to be a new therapeutic effective against breast cancer (BC) and / or BC-caused brain metastasis (BM).

[0024] The details of one or more exemplary embodiments of the invention are set PATENT 0321.158062PCT / SD2023 -391 -2PCT forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0025] All publications, patents, patent applications, American Type Culture Collection (ATCC) deposits and NCBI reference sequences cited herein are hereby expressly incorporated by reference in their entireties for all purposes.

[0026] DESCRIPTION OF DRAWINGS

[0027] The drawings set forth herein are illustrative of exemplary embodiments provided herein and are not meant to limit the scope of the invention as encompassed by the claims.

[0028] FIG. 1 A schematically illustrates how AD ARI deaminase activity converts adenosines to inosines which are interpreted as guanosines, de facto changing the mRNA;

[0029] FIG. IB schematically illustrates AD ARI two main isoforms pl 10 and interferon-inducible pl 50 which expresses the Z-a binding domain for interacting with RNA / DNA in a conformation; and

[0030] FIG. 1C-D graphically illustrate reduced Overall Survival (OS) from mRNA dataset of grade three, HER2 positive BC tumors which underwent endocrine therapies (p= 0.019) (FIG. ID) and reduced OS from protein dataset in grade three BC compared with control (p= 0031), (FIG. ID) KM plotter dataset.

[0031] FIG. 2A-C illustrate workflow to establish AD ARI -driven brain metastases mouse model:

[0032] FIG. 2A schematically illustrates an exemplary process where cancer cells are transduced with a nanoluc-luciferase reporter construct for tracing AD ARI activity;

[0033] FIG. 2B illustrates tumor growth (3-6 weeks for the MDA-MD-231 cells) in neonatal pups, the tumor cells are implanted through intracerebroventricular injection (ICV) (see for example, Kim et al, Alz Res Therapy 13, 154 (2021)) with transduced cells; and

[0034] FIG. 2C illustrates FACS-sorting of GFP+-tumor cells.

[0035] FIG. 3 A-E illustrates data showing that AD ARI potentiates cancer stem cells aggressiveness:

[0036] FIG. 3 A illustrates pictures of MDA-MD-231 AD ARI -reporter metastases from organs (top and middle panel) and digested tissue (bottom panel), PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0037] FIG. 3B illustrates a picture of a MDA-MD-231 implanted brain at three weeks post-ICV,

[0038] FIG. 3C illustrates FACS analysis of one brain and one spine from total brain extract co-expressing ADAR1-GFP positive cells, CD44 and CD47;

[0039] FIG. 3D illustrates FACS contour plots of CD44 and CD47 displaying different populations among the parental cell line versus brain and spine metastases, and

[0040] FIG. 3E-F graphically illustrates RT-PCR from GFP-FACS-sorted brain metastases (231-Br SI, S2 and S3) and non-transplanted cell line (231-Cells).

[0041] FIG. 4A illustrates representative IF images of AD ARI in the MDA-MD-231 cells transduced with sh-scramble (Ctrl) or sh-ADARl (ADAR1-KD);

[0042] FIG. 4B illustrates images of WB for AD ARI in Ctrl and AD ARI KD samples (top image) with band intensity quantification, t-test p value <0.0001 for total AD ARI and 0.0022 for pl 50 (bottom image);

[0043] FIG. 4C graphically illustrates RT-PCR for total AD ARI and the pl50 isoform in Ctrl and ADAR1-KD samples (t-test p value = 0.0348 for total AD ARI and 0.0467 for pl50), and RT-PCR for CD47 isoforms (t-test p value = 0.0448 for 201-202 and 0.0066 for 203-205 isoforms);

[0044] FIG. 4D illustrates representative histograms for total AD ARI and CD47 FACS (left) with FACS plot showing total AD ARI versus CD47 population in Ctrl and ADAR1-KD (right); and

[0045] FIG. 4E graphically illustrates quantification of double positive (DP), (left), and double negative (DN), (right), population from the FACS plots in D, (t-test p value = 0.0012 for DP and 0.0011 for DN).

[0046] FIG. 5 A-B illustrate characterizing samples from breast cancer metastatic sites:

[0047] FIG. 5A illustrates a metastatic apheresis (MBC003) and malignant pleural effusions (mPE) (others) patient specification table,

[0048] FIG. 5B illustrates an example of breast cancer stem cells profiling for the MBC006.

[0049] FIG. 6A-C illustrate tumoroids grown in a bioreactor bag, an augmented in vitro model: PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0050] FIG. 6 A illustrates an example of bioreactor bags for BC primary tumoroids from the mPE MB6006 with pCDH-GFP (top) and Br-231 cells (bottom),

[0051] FIG. 6B illustrates MBC006 cells grown in BC conditional media, objective 20x, and

[0052] FIG. 6C illustrates FACS-sorted Br-231 cells with the AD ARI reporter grown in neural conditional media, objective 20x.

[0053] FIG. 7A-F illustrate that sc-RNA sequencing revealed ECM remodeling in the brain niche of TNBC-derived brain metastasis:

[0054] FIG. 7A illustrates exemplary protocol steps leading to RNA-seq;

[0055] FIG. 7B illustrates an image of an example of a TNBC-implanted brain with BC-BM;

[0056] FIG. 7C illustrates sc-RNA UMAP of implanted, vs. non-implanted TNBC cells;

[0057] FIG. 7D illustrates sample cluster distribution revealing that Clusters 5 and 6 are mainly populated by implanted cells;

[0058] FIG. 7E graphically illustrates implanted cells display GOCC upregulation of collagen containing ECM; and

[0059] FIG. 7F illustrates qRT-PCR showing upregulation of COL6A1 and COL6A2 in 231 -BC-BM vs the non-implanted cell line (two-tailed t-test, p value= 0.0076 for COL6A1 and 0.0034 for COL6A2).

[0060] FIG. 8A-F illustrate a functional analysis of AD ARI downregulated BC-BM via scRNA sequencing:

[0061] FIG. 8A illustrates sc-RNA UMAP of Ctrl vs. AD ARI KD TNBC-derived metastasis;

[0062] FIG. 8B graphically illustrates sample cluster distribution revealing that Cluster 3 is overrepresented by the AD ARI KD samples;

[0063] FIG. 8C illustrates Violin plots of AD ARI distribution per each cluster showing that Cluster 3 is mainly characterized by AD ARI KD cells;

[0064] FIG. 8D illustrates GSEA analysis for Cluster 3 showing GOBP downregulation for glycolytic processes and enrichment for oxidative phosphorylation (top); GOCC downregulation for collagen containing RCM and upregulation of mitochondrial matrix; PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0065] FIG. 8E illustrates Violin plots displaying overall distribution of COL6A1 (left) and COL6A2 (right), both downregulated in the AD ARI KD samples; and

[0066] FIG. 8F illustrates Violin plots for KISSI in each cluster indicating KISSI upregulation in Cluster 3 for the AD ARI KD samples.

[0067] Like reference symbols in the various drawings indicate like elements.

[0068] DETAILED DESCRIPTION

[0069] In alternative embodiments, provided are novel orthotopic and organoid models to better characterize AD ARI (adenosine deaminase acting on RNA-1 protein) activity, particularly ADAR-1 pl 50 activity, in breast cancer (BC) metastatic niches and brain metastasis (BM). Methods as provided herein can be used to investigate the mechanistic role of AD ARI in breast metastatic disease and provide novel models for the development of new therapeutics against BC and BM, including the discovery of new drugs and therapeutics to treat or ameliorate BC and / or BM.

[0070] We have demonstrated that AD ARI pl 50, the interferon-inducible isoform, favors the alternative splicing of proteins with invasive potential in leukemia stem cells. Moreover, in telomerase positive cancer, AD ARI was found to promote telomerase activity by resolving R-loop formation in RNA:DNA hybrids of aberrant telomeric repeats. In BC, AD ARI plays an essential role in cell survival due to increased apoptosis and reduced proliferation found in multiple BC cell lines engineered to express reduced levels of AD ARI. High levels of AD ARI have been associated with shorter survival and disease progression in BC patients, however, the role of AD ARI is only partially understood in the context of metastasis.

[0071] As discussed in Example 1, below, to investigate the role of ADAR pl 50 in BC brain metastases we developed an orthotropic mouse model based on intra- cerebroventricular (ICV) injections of cancer cells, in one exemplary embodiment, MDA-MD-231 TNBC cancer cells (see for example Knier et al (2022) Biomedicines Vol 10, pg 667; Burnett et al Oncotarget. 2015; vol 6, pg 12682-12696; De Meulenaere V, et al, PLoS ONE 15(12)_e0243156), and transduced the cancer cells with an ADAR1-GFP reporter into the brain of Rag2- / - yc- / - mice at postnatal day 2. After three to six weeks of incubation the metastases are sufficiently fully developed in the brain of the Rag2- / - yc- / - mice, and by that time also will most likely spread (metastasize) to other part of the mouse’s body. PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0072] Brain metastasis formation can be evaluated using brain metastases were evaluated by looking at physical and behavioral changes in mice (i.e., weight loss, hunched posture, decreased sociability); also preclinical MRI, and bone metastasis formation can be assessed using high-resolution computed tomography (CT) and 2- deoxy-2-[18F] fluoro-D-glucose ([ 18F] FDG) positron emission tomography (PET) imaging.

[0073] Based on the hypothesis that AD ARI pl 50 drives brain metastases, finding GFP-expressing cells in other organs of the brain would indicate that the metastases have spread starting from TNBC cells with high levels of the GFP-reporter implanted in the brain. In order to analyze the presence of ADAR1-GFP+ cells and their invasive potential we thought to enzymatically digest brains post collection and perform FACS-sorting of GFP+ cells. A pure population of metastatic cells can thus be isolated from the whole brain extract for downstream analyses (such as RT-PCR and FACS). We hypothesized that the metastases would express high levels of BC stem cell genes CD44, CD47 and AD ARI pl 50.

[0074] Reporter constructs

[0075] In alternative embodiments, provided are methods for screening for an identifying a new therapeutic effective against breast cancer (BC) and BC-caused brain metastasis (BM) comprising use of a reporter construct for (or capable of) detecting, tracing or measuring AD ARI (adenosine deaminase acting on RNA-1 protein) activity, where the report construct can comprise: a bioluminescence reporter construct (optionally a luciferase reporter construct), a green fluorescent protein (GFP) reporter construct, a red fluorescent protein (RFP) reporter construct, a yellow fluorescent protein (YFP) reporter construct, an ADARl-nano-luc reporter construct, a NANLUC™-luciferase reporter construct, a SEAP (Secreted Alkaline Phosphatase) reporter construct, and / or a P-Galactosidase (P-Gal) reporter construct.

[0076] In alternative embodiments, a reporter construct (the ADARl-nano-luc reporter construct) used in methods as provided herein was made as described in WO PATENT

[0077] 0321.158062PCT / SD2023 -391 -2PCT

[0078] 2023 004113 A2, for example, a reporter construct used in methods as provided herein was generated by sub-cloning the following DNA sequence: tctagaCTAGCCAAGGTGAGCGCGTCAATAAACATGCACGTTTATTAG CGCGCCCACCCTGGAGCTAGCGTCTTCACACTCGAAGATTTCGTTG GGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTG AACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCG TAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGA AGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCG ACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTG TGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGT AATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCC GTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAAC AGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGAT CAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGT GACCGGCTGGCGGCTGTGCGAACGCATTCTGgcggccgct (SEQ ID NO: 1)

[0079] Into a pCDH-EFl-T2A-copGFP lentiviral expression plasmid (CD521A-1, SBI Systems Biosciences). Amplification of the DNA sequence was generated using forward primer: 5’- ctagtctagactagccaaggtgagcgcgtca-3’) (SEQ ID NO:2) and reverse primer 5’- atagtttagcggccgccagaatgcgttc gcacag-3’. (SEQ ID NO:3)

[0080] After amplification the pCDH-EFl-T2A-copGFP vector was digested with restriction enzymes Xbal and Noth Ligation of the sequence above into Xbal / Notl digested pCDH-EFl-T2A-copGFP in-frame generated reporter responsive to RNA editase activity. A TAG stop codon is upstream of Nano luciferase and in response to the RNA editing of the adenine to inosine the codon is translated as TGG, alleviating the stop codon block and inducing expression of the reporter. The housekeeping elongation factor la (EFl) promoter drives the expression of the reporter. Oligonucleotide primers were synthesized by Eton Bioscience (San Diego, CA). Verification of the reporter construct was completed using both restriction enzyme analysis and DNA sequencing. PATENT

[0081] 0321.158062PCT / SD2023 -391 -2PCT

[0082] Kits

[0083] Provided are products of manufacture and kits for practicing methods as provided herein, including for example, a bioreactor bag or a nanobioreactor, and a reporter construct for (or capable of) detecting, tracing or measuring AD ARI (adenosine deaminase acting on RNA-1 protein) activity. Optionally, products of manufacture and kits as provided herein can further comprise instructions for practicing methods as provided herein.

[0084] In alternative embodiments, brain-derived cancer cells are cultured in three dimensional (3D) cultures as brain tumoroids; and optionally the 3D tumoroids are expanded in bioreactor bags or nanobioreactors (for example, as described in WO 2023 137107 Al) that are useful for long term cultures and are resistant to tough environment settings

[0085] Any of the above aspects and embodiments can be combined with any other aspect or embodiment as disclosed here in the Summary, Figures and / or Detailed Description sections.

[0086] As used in this specification and the claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0087] Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive and covers both “or” and “and”.

[0088] Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About (use of the term “about”) can be understood as within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12% 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”

[0089] Unless specifically stated or obvious from context, as used herein, the terms “substantially all”, “substantially most of’, “substantially all of’ or “majority of’ encompass at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or more of a referenced amount of a composition.

[0090] The entirety of each patent, patent application, publication and document referenced herein hereby is incorporated by reference. Citation of the above patents, PATENT 0321.158062PCT / SD2023 -391 -2PCT patent applications, publications and documents is not an admission that any of the foregoing is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents. Incorporation by reference of these documents, standing alone, should not be construed as an assertion or admission that any portion of the contents of any document is considered to be essential material for satisfying any national or regional statutory disclosure requirement for patent applications. Notwithstanding, the right is reserved for relying upon any of such documents, where appropriate, for providing material deemed essential to the claimed subject matter by an examining authority or court.

[0091] Modifications may be made to the foregoing without departing from the basic aspects of the invention. Although the invention has been described in substantial detail with reference to one or more specific embodiments, those of ordinary skill in the art will recognize that changes may be made to the embodiments specifically disclosed in this application, and yet these modifications and improvements are within the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element(s) not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of, and "consisting of' may be replaced with either of the other two terms. Thus, the terms and expressions which have been employed are used as terms of description and not of limitation, equivalents of the features shown and described, or portions thereof, are not excluded, and it is recognized that various modifications are possible within the scope of the invention. Embodiments of the invention are set forth in the following claims.

[0092] The invention will be further described with reference to the examples described herein; however, it is to be understood that the invention is not limited to such examples.

[0093] EXAMPLES

[0094] Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols, for example, as described in Sambrook et al. (2012) Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Other references for PATENT 0321.158062PCT / SD2023 -391 -2PCT standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK). Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR - Basics: From Background to Bench, First Edition, Springer Verlag, Germany.

[0095] Example 1 : Developing novel models to characterize AD ARI activity in metastatic breast cancer

[0096] This example demonstrates that methods as provided herein are effective for characterizing AD ARI activity in metastatic breast cancer, and provides orthotopic and organoid models to better characterize AD ARI activity in breast cancer (BC) metastatic niches, with a special focus on the less studied brain metastasis (BM). Methods as provided herein provide new insights into the mechanistic role of AD ARI in breast metastatic disease and establish novel models for the development of new therapeutics against BC and BM.

[0097] Transcriptome remodeling led by RNA modifiers, such as the adenosine deaminase acting on dsRNA (AD ARI), is emerging as a tumor progression mechanism in cancer. We hypothesized that AD ARI may play a role in promoting breast cancer (BC) metastases, given the worse prognosis observed in high-grade tumor patients, especially in the HER2 positive subtype, which together with the triple negative (TNBC), are at high risk of developing brain metastases. We have demonstrated that inflammation driven AD ARI pl 50 favors the alternative splicing of proteins with invasive potential in leukemia stem cells. Therefore, investigated AD ARI pl 50 in BC metastases, with a special focus on the brain.

[0098] We implanted two mice with AD ARI -reporter TNBC cells, which were collected three weeks post implantation. Using a fluorescent microscope, GFP+ cells were identified in the brain and spinal cord of both mice indicated that AD ARI derived metastases had colonized the brain and migrated (metastasized) to the spinal cord. FACS analysis on whole brain lysates confirmed the presence of GFP+ cells expressing multiple populations of CD44 and CD47 compared to the parental, non- transplanted / non-transduced cell line. PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0099] Following this experiment, ADAR1-GFP+ cells from three independent MDA-MD-231 ICV implants were isolated using GFP-FACS sorting and compared to the non-transplanted MDA-MD-231 cell line expressing ADAR 1 -reporter.

[0100] Quantitative PCR (RT-PCR) analysis revealed that in all the three brains the interferon inducible AD ARI pl 50, but not the standard pl 10 isoform was upregulated, thus confirming the initial hypothesis. Moreover, the brain metastases displayed also mis-regulation of known to be involved in the metastatic settings (P- catenin, CD47) or ADAR1 pathway (APOBEC mutagenesis genes).

[0101] These data demonstrate that AD ARI pl 50 driven metastases rely on the wnt / p-catenin pathway and differential splicing of key tumorigenic genes, such as CD47, to promote cell proliferation.

[0102] Described herein is a novel murine (e.g., mouse) model based on intra- cerebroventricular (ICV) injections of cancer cells transduced with an ADAR1-GFP reporter into the brain of Rag2- / - yc- / - mice at postnatal day 2.

[0103] Figure 1 : High levels of AD ARI correlate with shorter OS in high-grade BC.

[0104] FIG. 1 A: AD ARI deaminase activity converts adenosines to inosines which are interpreted as guanosines, de facto changing the mRNA;

[0105] FIG. IB: AD ARI two main isoforms pl 10 and interferon-inducible pl 50 which expresses the Z-a binding domain for interacting with RNA / DNA in a conformation;

[0106] FIG. 1C: reduced Overall Survival (OS) from mRNA dataset of grade three, HER2 positive BC tumors which underwent endocrine therapies (p= 0.019), (left) and reduced OS from protein dataset in grade three BC compared with control (p= 0031), (right). KM plotter dataset.

[0107] Figure 2: Workflow to establish ADARl-driven brain metastases mouse model.

[0108] FIG. 2A: Cancer cells are transduced with a nanoluc-luciferase reporter construct for tracing AD ARI activity;

[0109] FIG. 2B: neonatal pups are implanted through intracerebroventricular injection (ICV) (see for example, Kim et al, Alz Res Therapy 13, 154 (2021)) with transduced cells;

[0110] FIG. 2C: tumor growth (3-6 weeks for the MDA-MD-231 cells);

[0111] FIG. 2D: FACS-sorting of GFP+ -tumor cells;

[0112] FIG. 2E: cell collection for downstream analyses. PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0113] Orthotropic model of Breast cancer brain metastases

[0114] ADAR1-GFP metastases from ICV implants of the MDA-MB-231 TNBC line were visible at three weeks post implants in the brain and spinal cord of Rag2- / - yc- / - mice. FACS-analysis of brain metastases revealed upregulation of AD ARI pl 50 together with WNT / p-catenin pathway and APOB EC (“apolipoprotein B mRNA editing enzyme, catalytic polypeptide”) mutagenesis genes. Changes in splicing and regulation of cancer stem cells genes was also observed. Especially for CD47, the “do not eat me” signal that fuels cancer stem cells progression.

[0115] Figure 3: AD ARI potentiates cancer stem cells aggressiveness.

[0116] FIG. 3 A: illustrates pictures ofMDA-MD-231 ADAR 1 -reporter metastases from organs (top and middle panel) and digested tissue (bottom panel),

[0117] FIG. 3B: illustrates a picture of a MDA-MD-231 implanted brain at three weeks post-ICV,

[0118] FIG. 3C: illustrates FACS analysis of one brain and one spine from total brain extract co-expressing ADAR1-GFP positive cells, CD44 and CD47;

[0119] FIG. 3D: illustrates FACS contour plot of CD44 and CD47 displaying different populations among the parental cell line versus brain and spine metastases,

[0120] FIG. 3E: illustrates RT-PCR from GFP-F ACS -sorted brain metastases (231-Br SI, S2 and S3) and non-transplanted cell line (231-Cells).

[0121] Exploring AD ARI functions in vitro

[0122] To mechanistically investigate the role of AD ARI in BC context we engineered the MDA-MB-231 TNBC line to express lower levels of AD ARI. We were able to confirm down-regulation of CD47 specific isoforms in vitro upon AD ARI knock-down (KD).

[0123] Figure 4A-E: AD ARI knock-down reduces CD47 expression.

[0124] (A) Representative IF of AD ARI in the MDA-MD-231 cells transduced with sh- scramble (Ctrl) or sh-ADARl (ADAR1-KD); (B) WB for AD ARI in Ctrl and AD ARI KD samples (top) with band intensity quantification, t-test p value <0.0001 for total AD ARI and 0.0022 for pl50 (bottom); (C) RT-PCR for total AD ARI and the pl50 isoform in Ctrl and ADAR1-KD samples (t-test p value = 0.0348 for total AD ARI and 0.0467 for pl50), and RT-PCR for CD47 isoforms (t-test p value = 0.0448 for 201-202 and 0.0066 for 203-205 isoforms); (D) representative histograms PATENT 0321.158062PCT / SD2023 -391 -2PCT for total AD ARI and CD47 FACS (left) with FACS plot showing total AD ARI versus CD47 population in Ctrl and ADAR1-KD (right); (E) quantification of double positive (DP), (left), and double negative (DN), (right), population from the FACS plots in D, (t-test p value= 0.0012 for DP and 0.0011 for DN).

[0125] Samples collection and banking

[0126] We established a collaboration with the clinicians at UCSD to generate primary metastatic models. We are now collecting and profiling metastases from multiple sites.

[0127] Figure 5: Characterizing samples from breast cancer metastatic sites.

[0128] FIG. 5A illustrates metastatic apheresis (MBC003) and malignant pleural effusions (mPE) (others) patient specification table,

[0129] FIG. 5B illustrates an example of breast cancer stem cells profiling for the MBC006.

[0130] Modeling metastases in vitro

[0131] Experiments performed in low-earth orbit have shown the long-term stability of cultures in bioreactors.

[0132] Figure 6: Tumoroids grown in a bioreactor bag, an augmented in vitro model.

[0133] FIG. 6 A illustrates an example of bioreactor bags for BC primary tumoroids from the mPE MB6006 with pCDH-GFP (top) and Br-231 cells (bottom),

[0134] FIG. 6B illustrates MBC006 cells grown in BC conditional media, objective

[0135] 2 Ox,

[0136] FIG. 6C illustrates FACS-sorted Br-231 cells with the AD ARI reporter grown in neural conditional media, objective 20x.

[0137] Conclusions

[0138] This study demonstrates and describes an ICV-based model for tracing AD ARI activity in BC brain metastases. These data suggest that AD ARI pl 50 driven metastases rely on the wnt / p-catenin pathway and differential splicing of key tumorigenic genes, such as CD47, to promote cell proliferation.

[0139] These data demonstrates that AD ARI expression collaborates with the metastatic niche to fuel cell proliferation, since the phenotype observed is specific to the brain microenvironment. PATENT 0321.158062PCT / SD2023 -391 -2PCT

[0140] Both ICV-mouse metastatic model and mPE-derived tumoroids represent a robust platform for uncovering ADAR-1 functions in the BC metastatic environment.

[0141] Example 2: AD ARI loss impairs ECM components essential for establishing TNBC- derived brain metastasis

[0142] High levels of the Adenosine Deaminase Acting on dsRNA (ADAR1) have been associated with a reduced overall survival (OS) in breast cancer (BC) advanced tumor stages, suggesting that AD ARI is implicated in tumor progression [1], BC patients currently have a favorable prognosis, with the 5-years OS exceeding 90% of the cases. However, the presence of breast cancer brain metastasis (BC-BM) is associated with a considerably shorter OS of less than two years [2], BC-BM arises in 10 to 15% of patients with metastatic disease and it is more prone to occur in advanced tumor stages, especially in the triple-negative breast cancer (TNBC) and HER2+subtypes accounting for up to 30% of the cases.

[0143] Inventors have previously reported that the AD ARI cytokine / interferon- inducible isoform pl 50 is overexpressed in TNBC-derived BC-BM. Wnt / p-Catenin pathway upregulation and changes in the isoform of crucial genes such as the stem cell marker CD47 and APOBEC genes were also found in TNBC-derived BC-BM. We then performed single-cell RNA (sc-RNA) sequencing on the implanted and nonimplanted TNBC cells. Strikingly, it emerged that one of the most upregulated pathways in the cell cluster primarily characterized by implanted cells, was the upregulation of the collagen containing extracellular matrix (ECM). Some of the genes in this pathway were 10 to 20 times more upregulated than in the non-implanted counterparts. This led to the hypothesis that ECM remodeling is crucial for establishing metastasis and supporting its spread. Given multiple lines of evidence suggesting that AD ARI fuels brain metastasis, it was then postulated that AD ARI activity might also involve to ECM remodeling.

[0144] Methods

[0145] To model AD ARI activity in the brain, MDA-MD-231 TNBC cells carrying a nanoluc-GFP reporter for AD ARI, or a cerulean tag used to label shRNA, were implanted via intracerebroventricular injections (ICV) into the brain Rag2' / 'yc' / ‘ mice (FIG. 7A). sc-RNA sequencing was performed on implanted TNBC cells carrying the AD ARI reporter, scramble, or AD ARI knockdown vectors; and TNBC nonimplanted cells carrying the AD ARI reporter or scramble vectors. PATENT

[0146] 0321.158062PCT / SD2023 -391 -2PCT

[0147] Results and discussion

[0148] With the aim to discover the main activated pathways in TNBC-derived BC- BM, sc-RNA sequencing was utilized to compare TNBC-implanted and nonimplanted cells. Six different clusters were identified, of which Clusters 5 and 6 are mainly populated by implanted cells (FIG. 7C-D). Extracellular matrix (ECM) containing collagen was one of the top upregulated pathways in TNBC-derived BC- BM when compared to the non-implanted cells (FIG. 7E). Two main components of this pathway are collages VI genes COL6A1 and COL6A2, whose upregulation was confirmed by qRT-PCR performed on four freshly isolated cells from implanted metastases compared to the non-implanted counterparts (FIG. 7F).

[0149] The effect of AD ARI in the brain metastatic niche was then investigated by sc-RNA sequencing of scramble control (Ctrl) and ADAR 1 -knockdown (AD ARI - KD) TNBC-derived BC-BM. This analysis revealed that AD ARI depleted BC-BM harbored a population of cells, mainly represented in Cluster 3, that had lost tumor hallmarks (FIG.8A-B). This included the loss of stem cell markers, decreased epithelial to mesenchymal transition, expression of differentiation markers in the neural lineage, and downregulation of glycolysis in favor of oxidative phosphorylation (FIG.8D). Additionally, ECM components found to be upregulated in the implanted TNBC metastasis were decreased upon AD ARI depletion, particularly collagen subtypes COL6A1 and COL6A2 (FIG.8E).

[0150] Additionally, one gene found upregulated in the AD ARI KD cells in Cluster 3, stood up in the second sc-RNA analysis: the metastasis suppressor gene KISSI (FIG.8F). KISSI, encoding for Kisspeptin, is a potent trigger of the gonadotropinreleasing hormone secretion, however, it has also been reported to play a pro or antiturn origenic role depending on the specific cellular context. For the 231 TNBC derived BM, it has been suggested that KISSI, is downregulated in the tumor microenvironment through a mechanism involving (CXCL12) cytokine secretion by neighboring astrocytes [3], The direct overexpression of KISSI in the ADAR1-KD population suggests that AD ARI may directly or indirectly affect the fate of a tumor suppressor. Preliminary data (unpublished) from our laboratory indicate that KISSI overexpression is independent of AD ARI editing. The mechanism of interaction between AD ARI, KISSI, and COL6 is currently being investigated. Nevertheless, we propose a possible mechanistic route here. It has been reported that kisspeptin- 10, the PATENT 0321.158062PCT / SD2023 -391 -2PCT product of KISSI, significantly increases the intracellular collagen content in the myocardium [4], It is, therefore, tempting to speculate that KISSI upregulation could be driven by cues from the tumor microenvironment in an attempt to maintain the metastatic ECM structure. KISSI upregulation, in turn, ends up having a tumor suppressor effect in the brain.

[0151] Conclusions

[0152] This study demonstrates that loss of AD ARI suppresses TNBC metastatic cell aggressiveness by favoring a microenvironment where cancer stem cells start differentiating and acquiring a non-cancerous phenotype. The AD ARI -dependent mechanism for the maintenance of the brain metastatic niche involves upregulation of tumor suppressors and maintenance of metastatic ECM components. Overall, these data support the rationale for developing novel therapeutics aimed at inhibiting AD ARI in brain metastasis.

[0153] References Example 1

[0154] Jiang Q. et al., 2021, Cell Reports. Inflammation-driven deaminase deregulation fuels human pre-leukemia stem cell evolution.

[0155] Sagredo E.A. et al., 2020., BBA- Molecular Cell Research, AD ARI Transcriptome editing promotes breast cancer progression through the regulation of cell cycle and DNA damage response.

[0156] Lanczky A. et al., 2021 J Med Internet Res. Web-Based Survival Analysis Tool Tailored for Medical Research (KMplot): Development and implementation.

[0157] Crews A. L., et al., 2023. Cell Stem Cell, Reversal of malignant AD ARI splice isoform switching with Rebecsinib.

[0158] Van der Werf I., et al., 2023. Cell Reports Medicine, Detection and targeting of splicing deregulation in pediatric acute myeloid leukemia stem cells.

[0159] Betancur P.A. et al., 2017, Nature Communications, A CD47-associated super-enhancer links pro-inflammatory signalling to CD47 upregulation in breast cancer.

[0160] References Example 2

[0161] 1. Sagredo, E. A., et al., AD ARI Transcriptome editing promotes breast cancer progression through the regulation of cell cycle and DNA damage response. Biochim Biophys Acta Mol Cell Res, 2020. 1867(8): p. 118716. PATENT

[0162] 0321.158062PCT / SD2023 -391 -2PCT

[0163] 2. Wang, X.Y., et al., Analysis of Rates of Brain Metastases and Association With Breast Cancer Subtypes in Ontario, Canada. JAMA Netw Open, 2022. 5(8): p. e2225424.

[0164] 3. Kaverina, N., et al., Astrocytes promote progression of breast cancer metastases to the brain via a KISSI -mediated autophagy. Autophagy, 2017.

[0165] 13(11): p. 1905-1923.

[0166] 4. Radwanska, P., et al., Kisspeptin-10 increases collagen content in the myocardium by focal adhesion kinase activity. Sci Rep, 2023. 13(1): p. 19977. A number of embodiments of the invention have been described.

[0167] Nevertheless, it can be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

Claims

PATENT 0321.158062PCT / SD2023 -391 -2PCTWHAT IS CLAIMED IS:

1. A method for screening for an identifying a new therapeutic effective against breast cancer (BC) and BC-caused brain metastasis (BM), wherein optionally the new therapeutic comprises a drug, and optionally the therapeutic or drug treats or ameliorates, or slows the progression of, a BC or a BM, the method comprising:(a) providing or having provided a murine tumor or a cancer cell, or a plurality of murine tumor or a cancer cells, wherein optionally the murine tumor or a cancer cell, or a plurality of murine tumor or cancer cells comprise a breast cancer cell, or a murine or a human breast cancer cell, or a Triple-Negative Breast Cancer (TNBC) cancer cell, optionally MDA- MD-231 TNBC cancer cells;(b) providing or having provided a reporter construct comprising: a bioluminescence reporter construct (optionally a luciferase reporter construct), a green fluorescent protein (GFP) reporter construct, a red fluorescent protein (RFP) reporter construct, a yellow fluorescent protein (YFP) reporter construct, an ADARl-nano-luc reporter construct, a NANLUC™-luciferase reporter construct, a SEAP (Secreted Alkaline Phosphatase) reporter construct, or a P-Galactosidase (P-Gal) reporter construct, for (or capable of) detecting, tracing or measuring AD ARI (adenosine deaminase acting on RNA-1 protein) activity, wherein optionally the AD ARI is an AD ARI pl 50 protein;(c) providing or having provided a rodent or a species from the family Muridcte.PATENT0321.158062PCT / SD2023 -391 -2PCT wherein optionally the rodent or species from the family Muridae is a mouse; wherein optionally the rodent is a rodent pup (optionally a mouse pup), and wherein optionally the pup is a neonatal pup (optionally a neonatal mouse), wherein optionally the murine animal is Rag2- / - yc- / - mouse;(d) providing or having provided a test therapeutic or a test drug, wherein optionally the test therapeutic or the test drug comprises a small molecule, a nucleic acid, a carbohydrate or a protein or peptide, and optionally the protein is an antibody or a cytokine, and optionally the nucleic acid is an inhibitory nucleic acid, optionally a micro-RNA, optionally mi-RNA;(e) transducing the tumor or cancer cell, plurality of murine tumor or a cancer cells, with the reporter construct;(f) implanting into a brain of the murine animal the transduced tumor or cancer cell or plurality of transduced murine tumor or a cancer cells, wherein optionally the implanting comprises a method comprising an intracerebroventricular injection (ICV), wherein optionally the transduced tumor or cancer cell or plurality of transduced murine tumor or cancer cells are implanted on postnatal day 0, 1, 2, 3, 4, 5, 6, 7 or 8, wherein optionally the transduced tumor or cancer cell or plurality of transduced murine tumor or cancer cells are implanted on two or more days, or are implanted on 2, 3, 4, 5 or 6 separate days, wherein optionally about 102to 1012murine tumor or cancer cells are implanted per administration (or injection) event;(g) waiting a period of time to allow the implanted transduced tumor or cancer cell, wherein optionally the period of time is between about 2 days and 2 months, or between about 3 days and 2 months, or between about 4 days and 6 weeks, or between about 5 days and one month, or about 1, 2, 3, 4, 5 or 6 weeks; and(h) administering to the murine animal a test therapeutic or a test drug,PATENT 0321.158062PCT / SD2023 -391 -2PCT wherein optionally the test drug is administered intrathecally, enterally or parenterally, or by ICV or osmotic mini-pump infusion, and optionally the test therapeutic is radiation therapy; and(i) determining if the test therapeutic or test drug reduces or inhibits AD ARI expression or activity, optionally AD ARI pl 50 expression or activity, wherein optionally AD ARI (optionally AD ARI pl 50) levels of expression or activity in a brain and / or a spinal cord is measured or determined, and optionally an increase in detected report levels (optionally GFP, YFP, RFP) levels or increase in luciferase, Alkaline Phosphatase or P-Galactosidase activity indicates an increase in AD ARI expression or activity, wherein optionally levels of expression or increase in expression or activity of WNT / p-catenin pathway and / or APOBEC mutagenesis genes are also measured or determined, wherein optionally a method comprising FACS-analysis is used to detect upregulation or levels of expression or increase in expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally a method comprising reverse transcription polymerase chain reaction (RT-PCR) is used to detect upregulation or levels of expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally a method comprising FACS and reverse transcription polymerase chain reaction (RT-PCR) is used to detect upregulation or levels of expression of AD ARI pl 50 (and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes) in BC and / or BM, wherein optionally AD ARI (optionally AD ARI pl 50) levels of expression or activity in a brain and / or a spinal cord is measured or determined by enzymatically digesting brains or spinal cord to general a whole brain or spinal cord extract, and FACS-sorting of GFP+ cells is performed on the whole brain or spinal cord extract, wherein a test therapeutic or a test drug that reduces or inhibits AD ARI expression or activity (optionally AD ARI expression or activity pl 50 proteinPATENT0321.158062PCT / SD2023 -391 -2PCT activity), and optionally also WNT / p-catenin pathway and / or APOBEC mutagenesis genes, is determined to be a new therapeutic effective against breast cancer (BC) and / or BC-caused brain metastasis (BM).

Images