Use of slc36a1 agonists for the preparation of a medicament for the prevention and / or treatment of colitis

Abstract

The application provides application of a Slc36a1 agonist in preparation of a drug for preventing and / or treating colitis, and belongs to the technical field of biotechnology. 4-GBA or sarcosine is applied to a colitis model mouse, and the DSS-induced colitis clinical and histological phenotype can be significantly improved. Through colon organoid and mouse experiments, it is known that 4-GBA enhances the intestinal mucosal barrier by up-regulating Slc36a1 and promotes intestinal homeostasis. The application takes the 4-GBA or sarcosine molecule targeting Slc36a1 as a core, solves the linkage mechanism of "stem cell regeneration-cup cell differentiation-mucus barrier repair" synchronously, and breaks through the limitation of the existing treatment strategy.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the application of Slc36a1 agonists in the preparation of drugs for the prevention and / or treatment of colitis. Background Technology

[0002] Inflammatory bowel disease (IBD), especially ulcerative colitis (UC), is a chronic, relapsing intestinal disease characterized by intestinal barrier dysfunction, goblet cell depletion, mucus layer defects, and crypt stem cell homeostasis imbalance. Current mainstream clinical treatment strategies primarily rely on immunosuppressants (such as corticosteroids) and biologics (such as anti-TNF-α antibodies). However, these drugs only temporarily alleviate the inflammatory response and cannot achieve substantial repair of the intestinal barrier. Long-term use is often accompanied by complications such as drug dependence, increased risk of infection, and systemic toxicity. Mechanistically, the maintenance of intestinal barrier function depends on three core elements: mucin MUC2 secreted by goblet cells forms a physical mucus barrier, blocking pathogen invasion; epithelial tight junction proteins (such as Occludin and ZO-1) maintain intercellular sealing; and Lgr5... + Intestinal stem cells continuously proliferate and differentiate to repair epithelial damage. While existing therapies can temporarily suppress the immune response, they struggle to simultaneously activate these three repair mechanisms, resulting in low mucosal healing rates and high recurrence rates. Therefore, developing novel treatment strategies that simultaneously target barrier repair and stem cell regeneration has become an urgent need in the field of IBD. Summary of the Invention

[0003] In view of this, the purpose of this invention is to provide the application of Slc36a1 agonists in the preparation of drugs for the prevention and / or treatment of colitis. The Slc36a1 agonist takes 4-guanidinobutyric acid (4-GBA) or sarcosine molecules that target Slc36a1 as the core, and achieves the purpose of treating colitis by simultaneously solving the linkage mechanism of "stem cell regeneration-goblet cell differentiation-mucus barrier repair", with high safety.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] This invention provides the use of Slc36a1 agonists in the preparation of drugs for the prevention and / or treatment of colitis, wherein the Slc36a1 agonists include one or both of 4-guanidinobutyric acid and sarcosine.

[0006] Preferably, the Slc36a1 agonist upregulates Slc36a1 expression.

[0007] Preferably, the Slc36a1 agonist activates the proliferation of intestinal stem cells, directionally induces goblet cell differentiation, and upregulates the expression of MUC2 protein.

[0008] Preferably, the colitis includes bacterial colitis and chemical colitis.

[0009] Preferably, the effective dose of the Slc36a1 agonist is 50-200 mg / kg.

[0010] This invention provides the application of Slc36a1 as a target in the preparation and screening of drugs for the prevention and / or treatment of colitis.

[0011] Preferably, drugs that upregulate Slc36a1 expression have a preventive and / or therapeutic effect on colitis.

[0012] The present invention provides a medicament for the prevention and / or treatment of colitis, the medicament comprising the Slc36a1 agonist and a pharmaceutically acceptable carrier thereof.

[0013] Preferably, the dosage form of the drug includes powder, granules, capsules, tablets, pills, and injections.

[0014] Preferably, the total active ingredient content in the drug is 0.5-95%.

[0015] The beneficial effects of this invention are:

[0016] This invention reveals for the first time the targeted pathway of "Slc36a1 agonist → Slc36a1 → stem cell activation + goblet cell differentiation," solving the problem that existing therapies cannot simultaneously repair the intestinal mucosal barrier. It also proposes the potential of the 4-GBA transporter Slc36a1 as a biomarker and therapeutic target in ulcerative colitis. For the treatment of colitis, this invention provides a safe and well-targeted small molecule therapy, distinct from the side effects risks of traditional anti-inflammatory drugs. Attached Figure Description

[0017] Figure 1 The results of 4-GBA in relieving enteritis are as follows: A. DAI score; B. Colon length measurement results; C. HE staining results of colon tissue; D. AB-PAS staining results; E. Immunohistochemical analysis results of MUC2 protein in colon tissue; F. C.rodentium Flowchart of mouse infection; G. HE staining results of colon tissue; H. Bacterial count in colon tissue; I. Bacterial count in feces.

[0018] Figure 2 Safety validation of 4-GBA in mice. A. Mouse body weight measurement results; B. Colon length measurement results; C. HE staining results of colon, liver, kidney and lung tissues.

[0019] Figure 3To validate the significant enhancement of intestinal barrier function by 4-GBA. AC. Immunohistochemical staining analysis of the expression of OCCLUDIN, Ki67, and cleaved Caspase-3 in colonic tissue; D. AB-PAS staining results; EG. Immunohistochemical staining analysis of the expression of MUC2, CHGA, and DCLK1 in colonic tissue; H. Immunofluorescence analysis of the expression of Tomato and Ki67 in colonic tissue.

[0020] Figure 4 To validate the effect of 4-GBA on enhancing the stemness of mouse colonic organoids and regulating goblet cell differentiation. A. Assessment of organoid formation capacity; B. Immunofluorescence detection results of Ki67 protein in colonic organoids; C. AB-PAS staining results of changes in goblet cell number in colonic organoids; D. Immunofluorescence detection results of MUC2 protein in colonic organoids; E. Stemness detection results of organoid stem cells.

[0021] Figure 5 The effect of 4-GBA knockdown of Slc36a1 on the stemness and goblet cell differentiation of colonic organoids. A. RT-qPCR detection of Slc36a1 expression in colonic organoids and colonic tissue after 4-GBA treatment; B. Immunohistochemical staining analysis of Slc36a1 expression in colonic tissue; C. Organoid formation capacity assessment results; D. Colonic organoid Ki-67 + Immunofluorescence detection results of proliferating cells and MUC2 protein.

[0022] Figure 6 To validate the effect of Forskolin treatment on 4-GBA-mediated intestinal barrier function. A. Schematic diagram of the experimental procedure; B. HE staining results of colon tissue; C. Colon length measurement results; D. Immunohistochemical detection of tight junction protein Occludin expression results; E. Immunofluorescence analysis of Tomato and Ki67 expression in colon tissue; F. AB-PAS staining results; G. Immunohistochemical analysis of MUC2 protein in colon tissue; H. Immunohistochemical analysis of Ki67 in colon tissue.

[0023] Figure 7 To validate the effect of upregulating Slc36a1 expression on sarcosine in alleviating enteritis. A. Immunohistochemical analysis results of Slc36a1 protein in colon tissue; B. Schematic diagram of experimental procedure; C. DAI score; D. Colon length measurement results; E. HE staining results of colon tissue. Detailed Implementation

[0024] This invention provides the use of Slc36a1 agonists in the preparation of drugs for the prevention and / or treatment of colitis, wherein the Slc36a1 agonist comprises one or both of 4-guanidinobutyric acid and sarcosine. Unless otherwise specified, the 4-guanidinobutyric acid and sarcosine used in this invention are derived from commercially available products well-known in the art. Preferably, the CAS number of the 4-guanidinobutyric acid is 463-00-3, and the CAS number of the sarcosine is 107-97-1.

[0025] In this invention, the Slc36a1 agonist upregulates Slc36a1 expression; the Slc36a1 agonist activates intestinal stem cell proliferation, directionally induces goblet cell differentiation, and upregulates MUC2 protein expression. The Slc36a1 described in this invention plays a crucial role in 4-GBA-mediated enhancement of intestinal stem cell function and goblet cell differentiation, acting as an important mediator of 4-GBA action and influencing the maintenance of colonic epithelial homeostasis.

[0026] In this invention, the colitis includes bacterial colitis and chemical colitis. The bacterial colitis described in this invention is caused by *Citrobacter murineis* (…). Citrobacter rodentium ATCC 51116 induced; the chemical colitis was induced by sodium dextran sulfate (DSS).

[0027] In this invention, the effective dose of the Slc36a1 agonist is 50-200 mg / kg, preferably 80-180 mg / kg, and more preferably 150 mg / kg. The effective dose described in this invention is a dose determined for mouse experiments.

[0028] In this invention, in experiments on a mouse model of colitis, 4-GBA treatment resulted in less colonic damage, a significant increase in colonic goblet cells, and a significant increase in MUC2 expression, indicating that 4-GBA is effective in treating colitis. In a bacterial-induced colitis model, the 4-GBA-treated group showed less colonic tissue damage and higher levels of MUC2 expression in the colon and feces. C.rodentium The significant reduction in bacterial count indicates that 4-GBA can alleviate the symptoms. C.rodentium Induced enteritis damage.

[0029] In this invention, 4-GBA significantly increased the expression of the tight junction protein Occludin in normal male mice, Ki67. + The number of proliferating cells increases, as does the number of goblet cells and the expression of their secreted mucins, DCLK1. + The number of cluster cells was significantly reduced compared to the control group. This invention was applied in a TdTomato-Lgr5-Cre gene-modified mouse model.

[0030] 4-GBA treatment significantly increased the amount of tomato in the intestinal crypts. +The number of cells indicated that 4-GBA could effectively promote Lgr5 + The expansion or maintenance of stem cells enhances stem cell function. The above results of this invention indicate that 4-GBA enhances the regenerative capacity of the intestinal epithelium and promotes the maintenance of intestinal barrier homeostasis by regulating the proliferation and differentiation of intestinal epithelial cells.

[0031] In this invention, 4-GBA enhanced the stemness of mouse colonic organoids and regulated goblet cell differentiation, significantly increasing the proliferative activity of cells in colonic organoids, suggesting that 4-GBA promotes intestinal epithelial cell proliferation. After 4-GBA treatment of colonic organoids, goblet cells and their secreted MUC2 increased, indicating that 4-GBA can promote goblet cell differentiation and maturation, thus enhancing mucus barrier function. Simultaneously, the expression level of Slc36a1 protein in mouse colonic epithelial cells was significantly increased, suggesting that 4-GBA can induce Slc36a1 expression. These results indicate that 4-GBA regulates intestinal homeostasis through the Slc36a1-mediated transmembrane transport pathway.

[0032] In this invention, the results of 4-GBA on the expression changes of Slc36a1 in colonic organoids and mouse colonic tissue showed that 4-GBA treatment significantly upregulated the expression of Slc36a1 mRNA in organoids and mouse colonic tissue, and 4-GBA significantly increased the expression level of Slc36a1 protein in mouse colonic epithelial cells, indicating that 4-GBA regulates intestinal homeostasis through the Slc36a1-mediated transmembrane transport pathway.

[0033] In this invention, by constructing a colonic organoid model with Slc36a1 knockdown, after Slc36a1 knockdown, 4-GBA enhances organoid formation efficiency and promotes budding, and the enhancement and promotion effect completely disappears.

[0034] In this invention, 4-GBA significantly enhanced the efficiency of colonic organoid formation and promoted budding, while knockdown of Slc36a1 completely eliminated this enhancing effect. Simultaneously, 4-GBA treatment significantly upregulated the protein expression levels of the proliferation marker Ki67 and the goblet cell marker MUC2 in organoids, but this effect also disappeared after Slc36a1 knockdown. This indicates that Slc36a1 plays a crucial role in 4-GBA-mediated enhancement of intestinal stem cell function and goblet cell differentiation, acting as an important mediator of 4-GBA action and influencing the maintenance of colonic epithelial homeostasis.

[0035] This invention also provides the application of Slc36a1 as a target in the preparation and screening of drugs for the prevention and / or treatment of colitis. Drugs that upregulate Slc36a1 expression according to this invention have preventive and / or therapeutic effects on colitis.

[0036] This invention provides a medicament for the prevention and / or treatment of colitis, the medicament comprising the Slc36a1 agonist and a pharmaceutically acceptable carrier thereof. The dosage forms of the medicament of this invention include powder, granules, capsules, tablets, pills, and injections. The total active ingredient content of the medicament of this invention is 0.5-95%, preferably 5-85%, and more preferably 10-70%.

[0037] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Unless otherwise specified, the following embodiments are all conventional methods.

[0039] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0040] Example 1

[0041] 1. 4-GBA effectively alleviates DSS-induced enteritis damage.

[0042] (a) Male C57BL / 6J mice, aged 6–8 weeks, were randomly divided into a blank control group (Control), an experimental group (4-GBA), and a negative control group (Ectoine) after 3 days of acclimatization, with 8 mice in each group. Each male mouse in the experimental and negative control groups was administered 200 μL of 4-GBA (Sigma-Aldrich; CAS#463-00-3; 150 mg / kg) and Ectoine (tetrahydropyrimidine, Sigma-Aldrich; CAS#96702-03-3; 150 mg / kg) by gavage once daily, respectively. The control group was administered an equal volume of PBS by gavage daily. 2.5% DSS was added to the drinking water of each treatment group, and the drinking water was changed every 2–3 days. Changes in mouse weight and feces were recorded daily, and the Disease Activity Index (DAI) was calculated. The scoring criteria are shown in Table 1. The results are as follows: Figure 1 As shown in Figure A, compared with the blank control group and the negative control group, the DAI score of the 4-GBA treatment group was significantly reduced.

[0043] Table 1 Disease Activity Index Scoring Criteria

[0044]

[0045] (b) After 7 days of DSS treatment in each treatment group, the mice were euthanized, and the length of the intact colon was measured. The results are as follows: Figure 1 As shown in Figure B, the colon length was longer in the 4-GBA treatment group compared to the blank control group and the negative control group.

[0046] A segment of colon was sectioned, stained with hematoxylin and eosin (HE), and histologically scored. The specific steps are as follows: 1) A 1-2 cm segment of intestinal tissue from the terminal end of the colon was taken and placed in an embedding cassette, which was then placed in a pre-prepared 4% paraformaldehyde solution. 2) After 24 hours of fixation, the intestinal segment was removed and placed back into the tissue embedding cassette. The embedding cassette was then immersed in 70% ethanol solution for 1 hour, followed by the following dehydration treatments: 1 hour in 80% ethanol, 1 hour in 90% ethanol, 1 hour in anhydrous ethanol, 50 minutes in xylene I, 50 minutes in xylene II, 30 minutes in liquid paraffin I, and 60 minutes in liquid paraffin II. 3) The embedding machine was preheated, and a small amount of liquid paraffin was dripped onto the bottom of the steel holder of the embedding cassette. The embedding cassette was placed in a 4°C environment to allow it to solidify rapidly for a few seconds. The tissue block was then quickly placed into the liquid paraffin, ensuring that the tissue block had as much contact area as possible with the bottom of the embedding cassette. After the bottom layer of paraffin has solidified, cover it with a plastic embedding cassette and add liquid paraffin to completely submerge the tissue block. Transfer the embedding cassette to the specimen fixation area at 4°C and wait for the paraffin to completely solidify. 4) After the paraffin has completely solidified, remove the wax block from the steel holder and store it at room temperature for long-term preservation. 5) Set the microtome to a section thickness of 5μm, fix the wax block, and section at a uniform speed. Ensure that no scratches or creases occur during the sectioning process. After sectioning, place the slides in a 60°C oven for overnight baking, after which the slides can be stored at room temperature for long-term preservation. 6) Dewaxing and hydration of paraffin sections: Take out the organoid paraffin sections and dewax and hydrate them using the following procedure: xylene I 15 min, xylene II 15 min, anhydrous ethanol I 2 min, anhydrous ethanol II 2 min, 90% ethanol 2 min, 80% ethanol 2 min, 70% ethanol 2 min, and deionized water 2 min. Then wash the sections with PBS twice, 2 min each time. 7) Immerse the slide in hematoxylin staining solution for 3 minutes, then remove it and rinse with tap water to stop staining. Wash 5 times to remove excess stain. 8) Immerse the slide in hydrochloric acid ethanol for 10 seconds, then rinse with tap water. 9) Immerse the slide in ammonia solution for 15 seconds, then rinse with tap water. 10) Immerse the slide in eosin staining solution for 1 minute, then rinse with tap water. 11) Dehydration of slides: Dehydrate the slides in the following order: 70% ethanol for 1 second, 80% ethanol for 1 second, 90% ethanol for 1 second, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, xylene I for 5 minutes, xylene II for 5 minutes. 12) Mount the dehydrated slides with neutral resin and leave them overnight in a fume hood to evaporate excess xylene. The next day, collect images under a microscope and perform histological and pathological scoring. The results are as follows: Figure 1 As shown in Figure C, colonic damage was less severe after 4-GBA treatment.

[0047] The specific steps for AB-PAS staining of colon tissue are as follows: 1) Section and dewax to water as with HE staining. 2) Wash sections with distilled water for 2 min. 3) Stain with Alcian blue solution for 10 min. 4) Wash sections three times with distilled water, 2 min each time. 5) Add oxidizing agent to the tissue sections, oxidize for 5 min, then wash twice with distilled water, 2 min each time. 6) Add Schiff Reagent to the tissue sections, then place the sections in a humidified chamber, cover to prevent evaporation of the staining solution, and stain for 20 min. 7) Discard the Schiff Reagent and rinse the sections with tap water for 10 min. 8) Stain the cell nuclei with hematoxylin solution for 1 min, then rinse with tap water to remove any excess stain. 9) Stain with acidic differentiation solution for 10 s, then rinse with tap water for 1 min. 10) Re-blue with Scott's blue solution for 15 s, then rinse with tap water for 2 min. 11) After stepwise ethanol dehydration, immerse in xylene for 2 minutes. 12) Mount the dehydrated sections with neutral resin, leave overnight in a fume hood to evaporate excess xylene, and acquire images using a microscope the following day. Figure 1 As shown in Figure D, the number of goblet cells in the colon of mice treated with 4-GBA increased significantly.

[0048] Simultaneously, MUC2 immunohistochemical staining was performed on the colon tissue. The specific steps are as follows: 1) Sectioning and dewaxing to water were performed as with HE staining. 2) Antigen retrieval: The slides washed with PBS were transferred to an autoclave containing sodium citrate retrieval solution. The autoclave was pressurized for 3 minutes (timing started when the pressure was built up and began to release pressure). After the pressure was reduced, the lid was opened and the slides were cooled to room temperature. The entire process took about 40 minutes. 3) The slides that had returned to room temperature were washed with PBS. Wash twice, 3 minutes each time. 4) 3% H2O2 was added to the tissue spots on the slides and incubated in a humidified chamber at room temperature for 15 minutes to remove endogenous peroxidase from the tissue spots. 5) The slides were washed with PBS for 5 minutes each time, 3 times. 6) 30 μL of MUC2 primary antibody dilution solution was added to each tissue spot and incubated overnight at 4°C in a humidified chamber. 7) The next morning, the humidified chamber was removed and allowed to warm to room temperature for 30 minutes. 8) The slides were washed with PBS for 5 minutes each time, 5 times. 9) Add 30 μL of secondary antibody dilution to each tissue spot and incubate in a humidified chamber at room temperature for 30 min. 10) Wash the sections with PBS for 5 min each time, for a total of 5 washes. 11) Prepare DAB staining solution, adjusting the DAB staining time according to different staining indices, and stop the staining process by soaking in tap water. 12) The nuclear staining procedure is the same as for HE staining. 13) The section dehydration and mounting procedures are the same as for HE staining. 14) Observe the staining of the sections under a standard upright microscope, acquire image information, and take images of each tissue sample from 5 different high-power fields. Use Image Pro Plus software to count the number of positive cells and analyze the staining intensity. The results are as follows: Figure 1 As shown in Figure E, 4-GBA treatment significantly increased MUC2 expression in mice.

[0049] Based on the above, it can be concluded that the metabolite 4-GBA can effectively alleviate enteritis in mice, providing an effective method for the clinical treatment of enteritis.

[0050] 2. 4-GBA relief Citrobacter rodentium ATCC 51116 ( C.rodentium Bacterial-induced enteritis damage

[0051] Male 6-8 week old C57BL / 6J mice were randomly divided into a water control group (Control) and an experimental group (4-GBA) after 3 days of acclimatization feeding, with 5 mice in each group; Figure 1 As shown in Figure F, mice in each group were fasted for 12 hours the day before infection, and each mouse was colonized with 10 [units of something] at a time. 9 CFU C.rodentium Bacterial suspension (resuspended in 200 μL PBS) was administered via gavage for 1 hour, after which mice resumed eating. Mice were sacrificed on day 14 of infection for tissue collection. After sacrifice, colonic hematoxylin and eosin (HE) staining was performed. Mouse feces and distal colon were homogenized and serially diluted for plating. C.rodentiumThe bacteria will grow into colonies on LB agar plates containing nalidixinol, allowing for quantitative analysis of bacterial counts in mouse feces and distal colon 14 days after infection. Figure 1 As shown in the GI, the 4-GBA treatment group had less colonic tissue damage and lower levels of [unclear - possibly referring to a specific substance or concentration] in the colon and feces. C.rodentium The significant reduction in bacterial count indicates that 4-GBA can alleviate the symptoms. C.rodentium Induced enteritis damage.

[0052] Example 2: 4-GBA High Biocompatibility Determination

[0053] 1. Normal C57BL / 6J mice were administered experimental doses (150 mg / kg) of 4-GBA and water by gavage for one week, respectively. Daily changes in mouse body weight were recorded. The results are as follows: Figure 2 As shown in Figure A; after 7 days of treatment, the mice were euthanized, and the length of the intact colon was measured. The results are as follows. Figure 2 As shown in Figure B, 4-GBA treatment had no effect on the body weight and colon length of mice.

[0054] 2. To assess the biosafety of 4-GBA, normal mice were administered experimental doses of 4-GBA and water via gavage for one week. Colon, liver, kidney, and lung tissues were then fixed, sectioned, and analyzed using hematoxylin and eosin (HE) staining. Results are as follows: Figure 2 C,4-GBA did not cause damage to major organs and tissues in mice. 4-Guidinobutyric acid, as a natural small molecule compound, exhibits high safety, laying the foundation for its further application in the biomedical field.

[0055] Example 3: Verification of 4-GBA significantly enhancing intestinal barrier function

[0056] 1. Male C57BL / 6J mice, aged 6-8 weeks, were randomly divided into a blank control group (Control) and an experimental group (4-GBA) after 3 days of acclimatization, with 8 mice in each group. Each male mouse in the experimental group was administered 200 μL of 4-GBA (150 mg / kg) by gavage once daily, while the control group was administered an equal volume of PBS by gavage daily. After 7 days of treatment, the male mice were euthanized, and colonic tissue was collected for AB-PAS and immunohistochemical staining analysis of mucosal barrier-related indicators. Figure 3 As can be seen from the AG, 4-GBA significantly increased the expression of the tight junction protein Occludin in normal male mice, Ki67. + The number of proliferating cells increases, Cleaved caspase-3 + The number of apoptotic cells remained unchanged, while the number of goblet cells and the expression of their secreted mucins increased. CHGA + The number of endocrine cells did not change significantly, while DCLK1 +The number of cluster cells was significantly reduced compared to the control group.

[0057] 2. In the TdTomato-Lgr5-Cre gene mouse model (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.), this model specifically marks Lgr5. + Cells expressed Tomato fluorescent protein. Mice were treated with 4-GBA and water (control group) as described in Example 2, and immunofluorescence staining was performed. The specific steps are as follows: 1) A segment of colon was embedded in OCT embedding medium and flash-frozen in liquid nitrogen. 2) The tissue block was sectioned to a thickness of 3 μm and frozen at -80°C. 3) The tissue sections were removed from the -80°C freezer and placed at room temperature for 30 min–1 h, while pre-cooling with acetone (-20°C) during this time. 4) Fixation was performed in acetone at 4°C for 10 min. 5) Washing was performed three times with PBS, 3 min each time. 6) H2O2 was dissolved in methanol to a final concentration of 3%, and incubated for another 10 min. 7) Washing was performed three times with PBS, 3 min each time. 8) Blocking: 5% BSA, room temperature for 1 h. 9) Adding an appropriate proportion of primary antibody, incubated overnight at 4°C. 10) The next day, the sections were removed from the freezer and placed at room temperature for 1 h. 11) Washing was performed three times with PBS, 3 min each time. 12) Secondary antibody: appropriate titer, room temperature, 1 hour, protected from light. 13) Remove the washed slide, aspirate any residual PBS around the tissue spots, add DAPI to the tissue spots for nuclear staining, and incubate at room temperature for 10 minutes. 14) Discard the DAPI, wash once with PBS, mount with anti-fluorescence attenuation mounting medium, and perform confocal microscopy immunofluorescence imaging.

[0058] like Figure 3 The H-value showed that 4-GBA treatment significantly increased the amount of tomato in the intestinal crypts. + The number of cells indicated that 4-GBA could effectively promote Lgr5 + The expansion or maintenance of stem cells enhances stem cell function. These results indicate that 4-GBA enhances the regenerative capacity of the intestinal epithelium and promotes the maintenance of intestinal barrier homeostasis by regulating the proliferation and differentiation of intestinal epithelial cells.

[0059] Example 4: Validation of 4-GBA enhancing the stemness of mouse colonic organoids and regulating goblet cell differentiation.

[0060] 1. Colonic organoids derived from WT mice were treated with 4-GBA (800 μM) for 4 days to investigate the effects of 4-GBA on the activity of colonic organoids and epithelial cells. The control group was treated with water.

[0061] The results of the assessment of the organoid formation capacity of the treated colon are as follows: Figure 4The results showed that, compared to the water control group, 4-GBA treatment significantly improved organoid formation efficiency, and the number of buds per organoid also increased significantly, suggesting that 4-GBA may enhance the self-renewal capacity and cell proliferation activity of the intestinal epithelium. Ki-67 immunofluorescence staining was performed, as shown... Figure 4 As shown in Figure B, 4-GBA treatment significantly increased the proliferative activity of cells in colonic organoids, suggesting that 4-GBA promotes the proliferation of intestinal epithelial cells.

[0062] 2. The goblet cells and their secreted MUC2 in colonic organoids after 4-GBA treatment were detected using AB-PAS staining and immunohistochemical staining. Results are as follows: Figure 4 As shown in CD, after organoid treatment with 4-GBA, goblet cells and their secreted MUC2 increased, indicating that 4-GBA can promote the differentiation and maturation of goblet cells and enhance the function of the mucus barrier.

[0063] 3. Apply the specific marker Lgr5 + Colonic organoids expressing Tomato fluorescent protein were treated with 4-GBA to investigate the effect of 4-GBA on colonic organoid stem cells. The activity of intestinal stem cells was detected using a Tomato fluorescent labeling reporter system. Results are as follows: Figure 4 E indicates that 4-GBA treatment significantly enhanced the intensity of Tomato fluorescence signal in organoids, further demonstrating that 4-GBA can effectively improve the activity of intestinal stem cells.

[0064] Example 5: 4-GBA enhances the intestinal mucosal barrier by upregulating Slc36a1.

[0065] 1. Proton-coupled amino acid transporter 1 (Slc36a1) is a transmembrane transporter of 4-guanidinobutyric acid. The expression changes of Slc36a1 in colonic organoids and mouse colonic tissue were detected by RT-qPCR and immunohistochemistry.

[0066] The specific steps for RT-qPCR are as follows: 1) Extract RNA from organoids using the RNA extraction kit from Beijing Solarbio Co., Ltd. 2) Use MonScript... TMThe RTIII All-in-One Mix reverse transcribed the extracted RNA into cDNA. For reaction system preparation and amplification procedures, please refer to the kit instructions. 3) Design suitable PCR primers. The primer sequences (5'-3') used are as follows: Slc36a1-F: GACTACAGTTCCACAGACGTG (SEQ ID No. 1), Slc36a1-R: CCAGGGAATCGGTAGACATCG (SEQ ID No. 2), β-actin-F: CACTGTCGAGTCGCGTCCA (SEQ ID No. 3), β-actin-R: GACCCATTCCCACCATCACA (SEQ ID No. 4), synthesized by Sangon Biotech Co., Ltd. RT-qPCR was performed using the RT-qPCR SYBR Green Kit (Nanjing Novizan Biotechnology Co., Ltd.). ΔΔ The CT method was used to initially organize the PCR data, and then the PCR data was imported into Prism analysis software for further analysis.

[0067] like Figure 5 As shown in Figure A, 4-GBA treatment significantly upregulated the levels of [unclear - possibly referring to a specific substance or component] in organoids and mouse colon tissue. Slc36a1 mRNA expression.

[0068] Immunohistochemical analysis of Slc36a1 was performed according to the above immunohistochemical staining method, and the results are as follows: Figure 5 As shown in Figure B, the expression level of Slc36a1 protein in mouse colonic epithelial cells was significantly increased, suggesting that 4-GBA can induce Slc36a1 expression. This indicates that 4-GBA may regulate intestinal homeostasis through the Slc36a1-mediated transmembrane transport pathway.

[0069] 2. By constructing a colonic organoid model with Slc36a1 knockdown, we will investigate whether 4-GBA regulates gene and protein expression in intestinal stem cells and goblet cells through Slc36a1. The specific steps are as follows:

[0070] 1) Preparation of transfection complex: Mix psPAX2:pMD2.G:target plasmid (purchased from Hanheng Biotechnology Co., Ltd.) at a ratio of 3:2:4 (μg), let stand for 5 min, then add PEI (3:1 plasmid ratio), mix well, let stand for 20 min, and transfect into 293T cells at a density of 70%~80%. 2) Virus production: Replace with fresh serum-containing culture medium after 6 h (add the medium while ensuring adherence; do not add too quickly, as 293T cells are easily blown away); collect the supernatant containing virus particles after 36-48 h and 60-72 h, filter using a 20 mL syringe with a 0.45 μm filter (to remove cell debris), and obtain the virus supernatant (store at 4℃; long-term storage is at -80℃). 3) Virus concentration: Concentrate the virus supernatant using 5×PEG8000, adding 7.5 mL of 5×PEG8000 to every 30 mL of virus supernatant, and incubate overnight at 4℃. 4) Aliquoting and Storage After Concentration: The next day, centrifuge the virus suspension at 3000g for 30 minutes at 4℃, discard the supernatant, add an appropriate amount of PBS to precipitate and resuspend the virus, thus obtaining the concentrated virus. Aliquot the virus suspension and store at -80℃. 5) Collect organoids that have grown to 300~400μm, digest them into single cells, and then quantify them at 10 cells per well. 5 Cells were seeded at a density suitable for 24-well plates. 6) The original culture medium was replaced with 500 μL of fresh organoid medium containing 6 μg / mL polybrene, followed by 100 μL of virus suspension. Infection was carried out at 37°C for 24 h. 7) After infection, the organoids were resuspended and collected in centrifuge tubes. The supernatant was removed after centrifugation at 300g for 3 min at 4°C. 8) Infected organoids were cultured according to the C57BL / 6 mouse colon organoid culture method. 9) Two to three days post-infection, when organoid growth was stable, the culture medium was replaced with organoid medium containing 1 μg / mL puromycin to screen for successfully transfected organoids. The Scramble group used a control plasmid without knockdown of any genes to prevent off-target effects.

[0071] The assessment of the organoid formation capacity of the treated colon was as follows: Figure 5 The results showed that 4-GBA significantly enhanced organoid formation efficiency and promoted budding, while knockdown of Slc36a1 completely eliminated this enhancing effect. Immunofluorescence staining of Ki67 and MUC2 using the above method showed the following results: Figure 5 As shown in Figures D and E, 4-GBA treatment significantly upregulated the protein expression levels of the proliferation marker Ki67 and the goblet cell marker MUC2 in organoids, while this effect disappeared upon Slc36a1 knockdown. This indicates that Slc36a1 plays a crucial role in 4-GBA-mediated enhancement of intestinal stem cell function and goblet cell differentiation, acting as an important mediator of 4-GBA action and influencing the maintenance of colonic epithelial homeostasis.

[0072] 3. To investigate the role of Slc36a1-mediated transmembrane transport in promoting intestinal homeostasis with 4-GBA, the following was conducted: Figure 6 The experimental procedure shown in Figure A involved treating mice with the Slc36a1 inhibitor forsocrine, followed by gavage administration of 4-GBA in the forsocrine-treated mice, and evaluating intestinal histology and barrier-related parameters as described in Example 3. Figure 6 As shown in the BH diagram, there was no significant difference in the overall morphology of the intestine after forscorin treatment, and no significant change was observed in colon length measurement, suggesting that 4-GBA did not significantly affect colon structure under the background of forscorin intervention; forscorin treatment eliminated the increase in tight junction protein expression induced by 4-GBA; forscorin treatment blocked the increase in goblet cells and the upregulation of MUC2 expression mediated by 4-GBA; forscorin treatment eliminated the 4-GBA-mediated intestinal stem cell (Lgr5) expression. + ) and proliferating cells (Ki67) + The increased proportion of 4-GBA indicates that Slc36a1-mediated transmembrane transport plays a key role in the process by which 4-GBA promotes intestinal barrier homeostasis.

[0073] Example 6: The compound sarcosine, which targets Slc36a1, effectively alleviates DSS-induced colonic injury in mice.

[0074] Sarcosine (Selleck; CAS#107-97-1), a compound that can induce Slc36a1, was screened and administered, and its effect on the progression of colitis was evaluated as in Example 1. Figure 7 As shown in Figure A, creatine treatment (500 mg / kg) significantly increased the expression of Slc36a1 in mouse colon tissue. According to... Figure 7 As shown in Figure B, creatine was used to treat WT mice, such as... Figure 7 As shown in the CE, compared with the saline control group, sarcosine administration significantly improved the clinical and histological phenotype of DSS-induced colitis, suggesting that sarcosine, a drug that upregulates Slc36a1, may be a feasible strategy for treating colitis.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

The use of 1,4-guanidinobutyric acid in the preparation of drugs for the prevention and / or treatment of colitis.

2. The application as described in claim 1, characterized in that, The 4-guanidinobutyric acid upregulated Slc36a1 expression.

3. The application as described in claim 1, characterized in that, The 4-guanidinobutyric acid activates the proliferation of intestinal stem cells, induces goblet cell differentiation, and upregulates the expression of MUC2 protein.

4. The application as described in claim 1, characterized in that, The colitis mentioned includes bacterial colitis and chemical colitis.

5. The application as described in claim 1, characterized in that, The effective dose of the 4-guanidinobutyric acid is 50-200 mg / kg.

6. The application as described in claim 1, characterized in that, The drug includes 4-guanidinobutyric acid and its pharmaceutically acceptable carrier.

7. The application as described in claim 1, characterized in that, The dosage forms of the drug include powder, granules, capsules, tablets, pills, and injections.

8. The application as described in claim 1, characterized in that, The total active ingredient content of the drug is 0.5-95%.

Images