Pantothenic acid synthase mutant and application thereof

Abstract

The invention discloses a pantothenic acid synthetase mutant and application thereof, and belongs to the technical field of gene engineering. The pantothenic acid synthetase mutant is obtained by mutating an amino acid sequence as shown in SEQ ID NO.1; the 175th amino acid is mutated into A from I. Compared with the existing wild-type pantothenic acid synthetase derived from Corynebacterium glutamicum, the pantothenic acid synthetase mutant disclosed by the invention has the advantages that the enzyme activity of the obtained pantothenic acid synthetase mutant is remarkably improved after the 175th amino acid is mutated from I to A, so that the yield of D-pantothenic acid is further improved when the D-pantothenic acid is synthesized.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a pantothenate synthetase mutant and application thereof. BACKGROUND

[0002] D-pantothenic acid (D-PA) is also known as vitamin B5, which is a water-soluble vitamin and widely exists in natural foods such as liver, kidney, egg, grain, wheat bran, rice bran and yeast. D-pantothenic acid is widely used in the fields of medicine, food industry and cosmetics. In the field of medicine, D-pantothenic acid is used as a nutritional supplement to prevent and treat vitamin B5 deficiency, and improve symptoms such as fatigue and skin inflammation. In the field of food industry, D-pantothenic acid is added to dairy products, beverages and infant formula as a nutritional fortifier. In the field of cosmetics, D-pantothenic acid is used as a moisturizing ingredient to enhance skin barrier function.

[0003] In the prior art, an engineered strain capable of catalyzing glucose to generate D-pantothenic acid can be constructed by gene editing technology, or D-pantothenic acid can be directly generated by using pantothenate synthetase to catalyze D-pantothenic acid and β-alanine. However, both methods are affected by the enzyme activity of pantothenate synthetase, resulting in limited yield of D-pantothenic acid. SUMMARY

[0004] Therefore, the present application aims to provide a pantothenate synthetase mutant and application thereof to overcome the problem of low enzyme activity of pantothenate synthetase in the prior art.

[0005] In a first aspect, the present application provides a pantothenate synthetase mutant, which is obtained by mutating the amino acid sequence shown in SEQ ID NO. 1. The 175th amino acid is mutated from I to A.

[0006] Compared with the wild-type pantothenate synthetase derived from Corynebacterium glutamicum, the enzyme activity of the pantothenate synthetase mutant obtained by mutating the 175th amino acid from I to A is significantly improved. When catalyzing D-pantothenic acid and β-alanine to generate D-pantothenic acid, the pantothenate synthetase mutant can significantly improve the conversion rate of D-pantothenic acid and the yield of D-pantothenic acid.

[0007] Further, the amino acid sequence of the pantothenate synthetase mutant is shown in SEQ ID NO. 3.

[0008] In a second aspect, the present application provides a nucleic acid molecule encoding the pantothenate synthetase mutant.

[0009] Optionally, the nucleotide sequence of the nucleic acid molecule encoding the pantothenate synthetase mutant is shown in SEQ ID NO. 4.

[0010] In a third aspect, the present application provides an expression vector comprising the nucleic acid molecule.

[0011] In a fourth aspect, the present application provides a recombinant strain comprising the nucleic acid molecule or the expression vector.

[0012] In a fifth aspect, the present application provides a method for preparing the pantothenate synthetase mutant, comprising the following steps: The recombinant strain is cultured in a liquid LB medium at 30-40°C and 120-220 rpm to obtain a seed liquid; The seed liquid is inoculated into another LB medium at a volume ratio of 1-3% to culture at 35-40°C until the OD600 value is 0.6-0.8, then the temperature is lowered to 15-20°C, and IPTG is added at a final concentration of 0.05-0.2 mM to induce the OD value to 3.0-7.0 to obtain a fermentation liquid containing the pantothenate synthetase mutant. The fermentation liquid is centrifuged to collect the bacterial cells, which are resuspended and then broken to centrifuge, and the obtained supernatant is the crude enzyme liquid of the pantothenate synthetase mutant.

[0013] Compared with the prior art, the pantothenate synthetase mutant crude enzyme liquid can be simply and quickly prepared by using the method.

[0014] In a sixth aspect, the present application provides the use of the pantothenate synthetase mutant, the nucleic acid molecule, the expression vector, the recombinant strain, or the pantothenate synthetase mutant crude enzyme liquid in the preparation of D-pantothenic acid.

[0015] Compared with the prior art, the pantothenate synthetase mutant obtained by mutation significantly improves the enzyme activity, thereby further improving the substrate conversion rate and the yield of D-pantothenic acid in the catalytic synthesis of D-pantothenic acid.

[0016] In a seventh aspect, the present application provides a method for preparing D-pantothenic acid, which uses the pantothenate synthetase mutant to catalyze the reaction of D-pantoic acid and β-alanine to generate D-pantothenic acid, and the concentrations of the components in the reaction system are as follows: D-pantoic acid 10-15 mg / mL, β-alanine 5-8 mg / mL, metal ion cofactor 45-65 mM, pantothenate synthetase mutant crude enzyme liquid 2-5 mg / mL, ATP 5-7 mM, and buffer 30-70 mM.

[0017] Compared with the prior art, the pantothenate synthetase mutant catalyzes the reaction of D-pantoic acid and β-alanine to generate D-pantothenic acid by using the above reaction system, which can effectively ensure the yield of D-pantothenic acid.

[0018] Further, the metal ion cofactor includes magnesium chloride and potassium chloride; the concentration of magnesium chloride in the reaction system is 20-30 mM, and the concentration of potassium chloride is 25-35 mM; and / or the buffer is sodium carbonate-sodium bicarbonate buffer, glycine-sodium hydroxide buffer or Tris-HCl buffer.

[0019] Further, the reaction temperature of the reaction system is 35-40℃, and the pH value is 8.0-10.0. DETAILED DESCRIPTION

[0020] In order to make the technical problems to be solved by the present application, technical solutions and beneficial effects more clear and explicit, the present application will be further described in detail below in combination with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.

[0021] It should be understood that the raw materials used in the following examples are commercially available unless otherwise specified.

[0022] Example 1 Construction of recombinant plasmid pET28a-panC Vector linearization: the expression vector pET28a was double-digested with restriction enzymes BamH I and Hind III at 37℃ for 20 min to obtain a linearized vector with enzyme cutting sites. The enzyme digestion system is shown in Table 1.

[0023] Table 1 Using the artificially synthesized panC gene as a template, primers F1 and R1 were used for PCR reaction, so that the obtained target gene had the same enzyme cutting sites as the above linearized vector fragment at both ends. The PCR reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0024] The above-mentioned panC gene is derived from Corynebacterium crenatum, and its nucleotide sequence is shown in SEQ ID NO. 2, and the amino acid sequence of the wild-type pantothenate synthetase encoded thereby is shown in SEQ ID NO. 1.

[0025] F1: CGCGGATCCGCGATGCAGGTAGCAACCACAAAGC (SEQ ID NO. 5); R1: CCAAGCTTGGCTAGAGCTCGATATTGTCGAT (SEQ ID NO. 6).

[0026] Table 2 PCR reaction system Table 3 PCR reaction conditions Ligation: The target gene obtained after the above PCR reaction was ligated between the two enzyme digestion sites of the linearized vector, and the recombination reaction was completed at 37°C for 30 min, obtaining the recombinant plasmid pET28a-panC. The ligation system is shown in Table 4.

[0027] Table 4 After the ligation was completed, the ligation product was transferred into E. coli DH5a competent cells, a single colony was picked for plasmid extraction, and the extracted plasmid was subjected to DNA sequencing.

[0028] Example 2 Construction of mutant plasmid The recombinant plasmid pET28a-panC sequenced correctly in the above Example 1 was used as a template, and the mutant primer I175A-F, I175A-R was used for reverse PCR on the template. After eliminating the template, the reverse PCR product was circularized and ligated, i.e. the mutant plasmid was obtained. The reverse PCR reaction system is shown in Table 5, and the reverse PCR reaction conditions are shown in Table 6.

[0029] I175A-F: CGTTCCGgccATTCGTGGCGCCGATGGCTTAG (SEQ ID NO. 7); I175A-R: CACGAATggcCGGAACGGGACGAATCTCCACG (SEQ ID NO. 8).

[0030] Table 5 Reverse PCR reaction system Table 6 Reverse PCR reaction conditions Template elimination: After the above reverse PCR was completed, 2 μL of restriction endonuclease Dpn I was added to the reaction solution (50 μL), mixed well by blowing, and reacted at 37°C for 1 h to obtain the enzyme digestion product. After the reaction was completed, the agarose gel electrophoresis was used to verify the obtained enzyme digestion product.

[0031] PCR product self-circularization: The reaction solution was prepared according to Table 7, mixed gently, and reacted at 16°C for 1 h.

[0032] Table 7 Circularization system Mutant plasmid verification: The circularized reaction product was transformed into E. coli DH5α competent cells via chemical transformation. Single colonies were picked for plasmid extraction and DNA sequencing. The successfully mutated plasmid was named pET28a-panC. I175A .

[0033] Mutant plasmid pET28a-panC I175A The gene contains the pantothenic acid synthase mutant I175A, the nucleotide sequence of which is shown in SEQ ID NO.4, and the amino acid sequence of the pantothenic acid synthase mutant I175A encoded by it is shown in SEQ ID NO.3.

[0034] Example 3 Preparation of crude enzyme solution Take 1 μL of the recombinant plasmid pET28a-panC that was correctly sequenced in Example 1 above, and 1 μL of the mutant plasmid pET28a-panC that was correctly sequenced in Example 2 above, respectively. I175A The bacterial culture was added to *E. coli* BL21(DE3) competent cells, incubated on ice for 30 min, then heat-shocked in a 42°C water bath for 60 s, and incubated on ice for 5 min. Two 500 μL volumes of LB broth were then added and the cells were allowed to recover at 37°C with shaking for 1 h. 100 μL of the bacterial culture was then plated to obtain recombinant strains containing the recombinant plasmid pET28a-panC and mutant strains containing the pET28a-panC, respectively. I175A Recombinant strains.

[0035] The two recombinant strains obtained above were cultured in liquid LB medium at 37°C and 120 rpm for 14 h to obtain two seed cultures. The two seed cultures were then inoculated into another LB medium at a 2% (v / v) inoculum and cultured at 37°C until OD (Organic Demand). 600 The value was 0.8, then the temperature was lowered to 18℃, and IPTG with a final concentration of 0.1 mM was added for 18 h to induce OD. 600 When the value reached 4.0, fermentation broth containing wild-type pantothenic acid synthase and fermentation broth containing pantothenic acid synthase mutant I175A were obtained respectively.

[0036] The two fermentation broths obtained above were centrifuged at 8000 rpm for 15 min at 4 °C, and the bacterial cells in the fermentation broths were collected. They were resuspended in 50 mmol / L sodium phosphate buffer (pH 9.0) and the bacterial cells were disrupted using an ultrasonic cell disruptor at a power of 450 W for 10 min. After cell disruption, the cells were centrifuged at 12000 rpm for 1 h at 4 °C to remove cell debris, and two supernatants were obtained, namely the crude enzyme solution of wild-type pantothenic acid synthase and the crude enzyme solution of pantothenic acid synthase mutant I175A. The concentration of both crude enzyme solutions was 5 mg / mL.

[0037] Example 4 Relative enzyme activity determination The enzyme activity was determined by configuring the following reaction system: Reaction system one: 50 mM sodium carbonate-sodium bicarbonate buffer (pH 9.0), 25 mM D-pantoate, 25 mM β-alanine, 4.5 mM ATP, 10 mM magnesium chloride, 15 mM potassium chloride, 4 mg / mL wild-type pantothenate synthetase crude enzyme solution. The total volume of the reaction system was 10 mL, and the reaction was carried out at 37°C for 45 min.

[0038] Reaction system two: 50 mM sodium carbonate-sodium bicarbonate buffer (pH 9.0), 25 mM D-pantoate, 25 mM β-alanine, 4.5 mM ATP, 10 mM magnesium chloride, 15 mM potassium chloride, 4 mg / mL pantothenate synthetase mutant I175A crude enzyme solution. The total volume of the reaction system was 10 mL, and the reaction was carried out at 37°C for 45 min.

[0039] The relative activity of the pantothenate synthetase mutant I175A was calculated based on 1 μM D-pantoic acid generated per minute as 1 unit of activity, and the enzyme activity of the wild-type pantothenate synthetase was 100%. The determination results are shown in Table 8.

[0040] Table 8 According to the above results, compared with the wild-type pantothenate synthetase derived from Corynebacterium glutamicum, the enzyme activity of the pantothenate synthetase mutant I175A obtained by mutation in the present application was increased by 85%.

[0041] Example 5 Preparation of D-pantothenic acid The following reaction system was configured to prepare D-pantothenic acid, and the volume of each reaction system was 10 mL. The concentrations of the components in the reaction system were as follows: D-pantoic acid 12 mg / mL, β-alanine 6 mg / mL, magnesium chloride 25 mM, potassium chloride 30 mM, wild-type pantothenate synthetase crude enzyme solution 4 mg / mL, ATP 6 mM, 50 mM sodium carbonate-sodium bicarbonate buffer with pH 9.0.

[0042] D-pantoic acid 12 mg / mL, β-alanine 6 mg / mL, magnesium chloride 25 mM, potassium chloride 30 mM, pantothenate synthetase mutant I175A crude enzyme solution 4 mg / mL, ATP 6 mM, 50 mM sodium carbonate-sodium bicarbonate buffer with pH 9.0.

[0043] The two reaction systems were reacted at 37℃ for 1h to obtain reaction liquid, the content of the remaining D-pantoic acid and the yield of the generated D-pantoic acid in the reaction liquid were detected, and the conversion rate of D-pantoic acid was calculated. The results are shown in Table 9.

[0044] The conversion rate of D-pantoic acid is: (moles of initial D-pantoic acid-moles of remaining D-pantoic acid after reaction) / moles of initial D-pantoic acid x 100%.

[0045] Table 9 From the above results, compared with wild-type pantothenate synthetase, the enzyme activity of the mutant pantothenate synthetase I175A obtained by the present application is significantly improved, thereby further improving the conversion rate of D-pantoic acid and the yield of D-pantoic acid.

[0046] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A pantothenic acid synthase mutant, characterized in that, The pantothenic acid synthase mutant was obtained by mutating the amino acid sequence shown in SEQ ID NO.1; The mutation is that the amino acid at position 175 is changed from I to A.

2. The pantothenic acid synthase mutant according to claim 1, characterized in that, The amino acid sequence of the pantothenic acid synthase mutant is shown in SEQ ID NO.

3.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the pantothenic acid synthase mutant as described in claim 1 or 2.

4. An expression carrier, characterized in that, The expression vector contains the nucleic acid molecule as described in claim 3.

5. A recombinant bacterial strain, characterized in that, The recombinant strain contains the nucleic acid molecule of claim 3 or the expression vector of claim 4.

6. A method for preparing a pantothenic acid synthase mutant, used to prepare the pantothenic acid synthase mutant according to claim 1 or 2, characterized in that, Includes the following steps: The recombinant strain described in claim 5 was cultured in liquid LB medium at 30℃~40℃ and 120rpm~220rpm to obtain seed culture; The seed culture was inoculated into another LB medium at an inoculum volume of 1% to 3% and cultured at 35°C to 40°C until OD. 600 The OD value was set at 0.6–0.8, then the temperature was lowered to 15–20°C, and IPTG with a final concentration of 0.05 mM–0.2 mM was added to induce an OD value of 3.0–7.0, thus obtaining a fermentation broth containing a pantothenic acid synthase mutant. The fermentation broth was centrifuged to collect the bacterial cells. After the bacterial cells were resuspended, they were broken up and centrifuged again. The resulting supernatant was the crude enzyme solution of the pantothenic acid synthase mutant.

7. The use of the pantothenic acid synthase mutant of claim 1 or 2, the nucleic acid molecule of claim 3, the expression vector of claim 4, the recombinant strain of claim 5, or the crude enzyme solution of the pantothenic acid synthase mutant prepared in claim 6 in the preparation of D-pantothenic acid.

8. A method for preparing D-pantothenic acid, characterized in that, The pantothenic acid synthase mutant according to claim 1 or 2 is used to catalyze the reaction of D-pantothenic acid with β-alanine to generate D-pantothenic acid. The concentrations of each component in the reaction system are as follows: D-Pantolytic acid 10~15mg / mL, β-alanine 5~8mg / mL, metal ion cofactor 45~65mM, crude enzyme solution of pantothenic acid synthase mutant 2~5mg / mL, ATP 5~7mM, buffer 30~70mM.

9. The preparation method according to claim 8, characterized in that, The metal ion cofactors include magnesium chloride and potassium chloride; the concentration of magnesium chloride in the reaction system is 20-30 mM, and the concentration of potassium chloride is 25-35 mM; and / or, The buffer solution is a sodium carbonate-sodium bicarbonate buffer, a glycine-sodium hydroxide buffer, or a Tris-HCl buffer.

10. The preparation method according to claim 8 or 9, characterized in that, The reaction temperature of the reaction system is 35℃~40℃, and the pH value is 8.0~10.0.

Images