DNA aptamer combined with thrombin and screened based on SELEX (systematic evolution of ligands by exponential enrichment) technology and application thereof
By screening out the high-affinity and stable DNA aptamer TB-apt69nt, the problem of unsatisfactory intracellular affinity and specificity of existing thrombin aptamers has been solved, realizing low-cost and efficient thrombin detection and functional regulation.
Patent Information
- Application Number
- CN202610044049.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-14
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2046-01-14
AI Technical Summary
Existing DNA aptamers for thrombin have unsatisfactory affinity and specificity within cells, resulting in poor detection and functional regulation, and are also costly.
A DNA aptamer, TB-apt69nt, containing a core sequence and flanking sequences, was designed and screened using SELEX technology. It exhibits high affinity and stability, can specifically bind to thrombin protein, and can be conjugated to detectable markers.
It achieves efficient and low-cost thrombin detection and functional regulation, improves detection sensitivity and treatment accuracy, and reduces experimental complexity and cost.
Smart Images

Figure CN121518482A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of analytical chemistry and biological detection, and particularly relates to a DNA aptamer binding to thrombin screened based on SELEX technology and application thereof. BACKGROUND
[0002] Studies have shown that thrombin in vivo plays a key role in the occurrence and development of cancer, such as enhancing the ability of local cell invasion through activating protease-activated receptors or hydrolyzing fibrinogen. In addition, the pro-coagulation effect of thrombin is closely related to thrombotic diseases, such as thrombin cutting fibrinogen to form fibrin, and continuous activation leading to abnormal increase of fibrin network to form a thrombus core. Currently, the drugs for regulating the activity of thrombin in clinical mainly include small molecule compounds, polypeptides and nucleic acid aptamers, etc.
[0003] Nucleic acid aptamer refers to an oligonucleotide isolated from a random library by SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology. It can specifically bind to various targets such as metal ions, small molecules, amino acids, polypeptides, proteins and cells, etc. Compared with antibodies, nucleic acid aptamer has the advantages of small molecular weight, good chemical stability, small immunogenicity, strong cell and tissue penetration ability, etc., and is widely used in many fields such as biological sensing, medical detection and disease treatment.
[0004] Screening of nucleic acid aptamer targeting thrombin protein can be integrated into a biosensor to monitor the concentration of thrombin in blood. For example, nanomaterials can be used as signal carriers to achieve primary signal amplification, and secondary signal amplification can be achieved by combining chemical dissolution, electrochemical deposition and other processes, so as to realize the ultra-sensitive detection of thrombin protein. It can also be used as a carrier to deliver antithrombotic drugs to the thrombus site to achieve precise treatment of thrombus. The existing DNA aptamer of thrombin is mostly rich in guanine G sequence, and the G-quadruplex structure formed by them is easily interfered by the widely existing G-quadruplex binding protein in cells, resulting in unsatisfactory affinity and specificity.
[0005] Therefore, for the detection and functional regulation of thrombin, it is urgent to develop nucleic acid aptamer anticoagulants with high affinity and low cost binding to thrombin. SUMMARY
[0006] The present application provides a nucleic acid aptamer targeting and binding to thrombin and application thereof.
[0007] In the first aspect of the present application, a DNA aptamer binding to thrombin protein is provided, and the core sequence of the DNA aptamer binding to the thrombin protein is shown as SEQ ID NO: 5.
[0008] In another preferred embodiment, a flanking sequence is present at the 5' end and / or 3' end of the core sequence.
[0009] In another preferred embodiment, the length of the flanking sequence is 1-80 bases, preferably 5-50 bases, most preferably 10-30 bases.
[0010] In another preferred embodiment, the thrombin protein is a human thrombin protein.
[0011] In another preferred embodiment, the affinity index of the DNA aptamer to the thrombin protein is K D the value is 1-100 nM, preferably 1-60 nM.
[0012] In another preferred embodiment, the DNA aptamer comprises a DNA sequence as set forth in SEQ ID NO: 4.
[0013] In another preferred embodiment, the DNA aptamer further comprises a DNA sequence having a sequence identity of > 85%, preferably > 90%, most preferably > 95% to SEQ ID NO: 4.
[0014] In another preferred embodiment, the DNA aptamer has a sequence as set forth in SEQ ID NO: 4.
[0015] In another preferred embodiment, one or more positions in the DNA aptamer sequence are modified selected from the group consisting of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, isotopic substitution, or a combination thereof.
[0016] In another preferred embodiment, the one or more is 1-10, preferably 1-5, most preferably 1-3.
[0017] In another preferred embodiment, the modified DNA aptamer has an affinity to bind to the thrombin protein equal to or higher than the parent DNA aptamer sequence before modification, and / or has higher stability.
[0018] In another preferred embodiment, the modification enhances the stability of the DNA aptamer sequence.
[0019] In a second aspect of the present application, a conjugate is provided, the conjugate comprising the DNA aptamer of the first aspect of the present application and a detectable label linked to the DNA aptamer.
[0020] In another preferred embodiment, the detectable label comprises biotin, a chemiluminescent group, a chemical fluorescent group, a fluorescent protein, an enzyme, colloidal gold, a radioisotope, a latex particle, an antibody, a ligand, an antigen, a receptor, or a combination thereof.
[0021] In a third aspect of the present application, there is provided a biochip comprising the DNA aptamer of the first aspect of the present application, or the conjugate of the second aspect of the present application.
[0022] In a fourth aspect of the present application, there is provided the use of the DNA aptamer of the first aspect of the present application, the conjugate of the second aspect of the present application, or the biochip of the third aspect of the present application, for: (Z1) preparing a kit for detecting thrombin protein; (Z2) preparing a reagent for imaging thrombin protein; (Z3) preparing a pharmaceutical composition targeted to thrombin protein; and / or (Z4) purifying thrombin protein.
[0023] In a fifth aspect of the present application, there is provided a detection kit comprising: the DNA aptamer of the first aspect of the present application, or the conjugate of the second aspect of the present application.
[0024] In a sixth aspect of the present application, there is provided the use of the detection kit of the fifth aspect of the present application, for preparing a kit for diagnosing thrombus disease caused by thrombin.
[0025] In another preferred embodiment, the thrombus disease comprises: congenital genetic thrombus and thrombus caused by external stimulus.
[0026] In another preferred embodiment, the external stimulus comprises: surgery, pregnancy, taking contraceptive, taking anti-phospholipid antibody, or a combination thereof.
[0027] In another preferred embodiment, the thrombus disease comprises: venous thrombotic disease and arterial thrombotic disease.
[0028] In another preferred embodiment, the thrombus disease comprises (but not limited to): cerebral embolism, stroke, and cardiac thrombus.
[0029] In a seventh aspect of the present application, there is provided a composition comprising: (a) the DNA aptamer of the first aspect of the present application; and (b) optionally, a pharmaceutically acceptable excipient.
[0030] In an eighth aspect of the present application, there is provided a nucleic acid sequence which is an antisense sequence of the sequence as set forth in SEQ ID NO: 4.
[0031] In a ninth aspect of the present application, there is provided a method for detecting thrombin protein for non-disease diagnosis and / or treatment, comprising the steps of: (S1) providing a sample to be detected; (S2) mixing the sample to be detected with the DNA aptamer according to the first aspect of the present application or the conjugate according to the second aspect of the present application to form a mixture; (S3) detecting the presence or absence of "thrombin protein-DNA aptamer complex" in the mixture, wherein if the complex is present, it indicates that thrombin protein is present in the sample; if the complex is absent, it indicates that thrombin protein is not present in the sample.
[0032] In another preferred embodiment, the detection includes qualitative detection and quantitative detection.
[0033] In another preferred embodiment, the method is an in vitro method.
[0034] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.
[0035] It should be understood that, within the scope of the present application, each of the above technical features of the present application and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they are not listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 The figure shows the data of detecting the affinity of full-length DNA aptamer TB-apt69nt and thrombin protein by surface plasmon resonance experiment in Example 2.
[0037] Figure 2 The figure shows the data of detecting the affinity of truncated DNA aptamer TB-apt40nt and thrombin protein by surface plasmon resonance experiment in Example 2.
[0038] Figure 3 The figure shows the data of detecting the affinity of truncated DNA aptamer TB-apt40nt-NO and thrombin protein by surface plasmon resonance experiment in Example 2. DETAILED DESCRIPTION
[0039] The present inventors have made extensive and in-depth research, and through a large number of screening, unexpectedly obtained a DNA aptamer (TB-apt69nt) with small molecular weight, stable chemical properties, easy to preserve and label, and capable of binding thrombin protein with high affinity and high specificity; and provided applications of the DNA aptamer. On this basis, the present application is completed.
[0040] TERMS To enable a better understanding of the present disclosure, certain terms are defined first. As used in this application, and unless specifically identified otherwise, each of the following terms shall have the meaning given below. Additional definitions are set forth throughout the application.
[0041] The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101, and all values in between.
[0042] As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of" or "consisting of".
[0043] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range is to be understood to include the interpretation of values within said range, as well as sub-ranges or fractions of the values within said range (e.g., tenths and hundredths of a value).
[0044] As used herein, the term "and / or" refers to any and all possible combinations of one or more of the associated listed items.
[0045] As used herein, the "core sequence" refers to a key sequence that binds to the thrombin protein, and is a decisive factor for the affinity of the DNA aptamer to bind to the thrombin protein. In certain embodiments, replacing the core sequence with any DNA sequence results in the disappearance or significant reduction of the affinity of the DNA aptamer to the thrombin protein. The significant reduction is statistically significant.
[0046] As used herein, the "flanking sequence" refers to a DNA sequence present at the 5' and / or 3' end of the core sequence of the DNA aptamer. In certain embodiments, the flanking sequence is involved in the binding of the DNA aptamer to the thrombin protein. In certain embodiments, the flanking sequence is not involved in the binding of the DNA aptamer to the thrombin protein. In certain embodiments, the presence or absence of the flanking sequence does not significantly affect the affinity of the DNA aptamer to the thrombin protein. In certain embodiments, the flanking sequence can be replaced by any DNA sequence.
[0047] As used herein, the terms "thrombin protein" and "thrombin" have the same meaning and are used interchangeably.
[0048] Thrombin Thrombin is a serine protease that normally acts at the site of vascular injury. Thrombin has both procoagulant and anticoagulant functions in the body. The procoagulant function is mainly reflected in the ability to convert soluble fibrinogen into insoluble fibrin clot. Thrombin can also bind to thrombomodulin expressed by endothelial cells, inhibiting its ability to hydrolyze fibrinogen, thereby achieving the balance of coagulation and anticoagulation in the body.
[0049] Thrombin is also involved in other coagulation-related reactions, such as promoting platelet aggregation and activating other coagulation factors. In clinical practice, thrombin is often used as a hemostatic agent, especially for hemostasis of small blood vessels, capillaries and parenchymal organ hemorrhage.
[0050] In addition to the procoagulant function, thrombin also has anticoagulant and antifibrinolytic activity in the presence of thrombomodulin. Studies have shown that the procoagulant function of thrombin plays a key role in coronary heart disease and other thrombotic diseases.
[0051] Currently, the drugs used to regulate the activity of thrombin in clinical practice mainly include small molecule compounds, polypeptides and nucleic acid aptamers, etc.
[0052] Nucleic acid aptamer Nucleic acid aptamer refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecule obtained by screening and isolation through the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technique, which can bind to various targets such as proteins, metal ions, small molecules, cells, bacteria, tissues and viruses with high affinity and specificity, and has attracted widespread attention in many fields such as biological analysis, environmental monitoring, biomedicine and drug synthesis. Compared with antibodies, nucleic acid aptamers have the advantages of small molecular weight, simple and rapid synthesis, high thermal stability, easy chemical modification and low immunogenicity. Screening of high specificity nucleic acid aptamers targeting thrombin protein helps to achieve high sensitivity detection of thrombin protein and targeted drug development for thrombin protein and other biomedical applications.
[0053] DNA aptamer of the present application The DNA aptamer of the present application refers to a DNA aptamer with small molecular weight, stable chemical properties, easy to preserve and label, and capable of binding to thrombin protein with high affinity, which is named TB-apt69nt, obtained by screening a random single-stranded DNA library and corresponding primers designed and synthesized by the inventors based on the SELEX technique. The dissociation constant (K D ) is determined by surface plasmon resonance experiment (SPR) to accurately determine the binding affinity, which shows that the DNA aptamer of the present application has high affinity and good specificity for thrombin protein.
[0054] In another preferred embodiment, the nucleic acid aptamer or nucleic acid aptamer structure of the present application comprises the following elements: (a) A core element, wherein the core element is a core sequence that binds to thrombin protein, the core sequence being shown in SEQ ID NO: 5; and (b) Optional flank elements, which are flank sequences located upstream and / or downstream of the core element.
[0055] The DNA aptamer of the present invention comprises a core sequence as shown in SEQ ID NO: 5.
[0056] In another preferred embodiment, the core sequence has flanking sequences at the 5' end and / or 3' end.
[0057] In another preferred embodiment, the length of the flanking sequence is 1-80 bases, preferably extended by 5-50 bases, and most preferably extended by 10-30 bases.
[0058] In another preferred embodiment, the thrombin protein is human thrombin protein.
[0059] In another preferred embodiment, the affinity index of the DNA aptamer to the thrombin protein is... K D The value is 1-100 nM, preferably 1-60 nM.
[0060] In another preferred embodiment, the DNA aptamer comprises a DNA sequence as shown in SEQ ID NO: 4.
[0061] In another preferred embodiment, the DNA aptamer further comprises a DNA sequence having ≥85%, preferably ≥90%, most preferably ≥95% sequence identity with SEQ ID NO: 4.
[0062] In another preferred embodiment, the ≥95% sequence identity includes 95%, 96%, 97%, 98%, and 99% sequence identity.
[0063] In another preferred embodiment, the DNA aptamer comprises the extended DNA sequence of SEQ ID NO: 4.
[0064] In another preferred embodiment, the extension refers to an extension of 1-20 bases, more preferably 1-10 bases, and most preferably 1-5 bases.
[0065] In another preferred embodiment, the DNA aptamer sequence is shown in SEQ ID NO: 4.
[0066] In another preferred embodiment, one or more sites in the DNA aptamer sequence are modified by a selection from the group consisting of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, isotopization, or combinations thereof.
[0067] In another preferred embodiment, the number of one or more is 1-10, more preferably 1-5, and most preferably 1-3.
[0068] In another preferred embodiment, the modification enhances the stability of the DNA aptamer sequence.
[0069] In another preferred embodiment, the DNA aptamer blocks the activity of thrombin protein.
[0070] In another preferred embodiment, the DNA aptamer inhibits the activity of thrombin protein.
[0071] In another preferred embodiment, the DNA aptamer, its conjugate, or its derivative may be used for one or more applications selected from the group consisting of: (1) Quantitative or qualitative detection of thrombin protein; (2) Purify thrombin protein; (3) Imaging of thrombin protein; (4) As an inhibitor of thrombin protein; (5) Preparation of drugs targeting thrombin protein; (6) Prepare reagents or drugs for the diagnosis and treatment of abnormal thrombin expression.
[0072] Filtering methods The present invention also provides a method for screening DNA aptamers of the present invention, the method comprising the following steps: (1) Based on thrombin protein, synthesize a random single-stranded DNA library and primers; (2) Magnetic bead screening: At least five rounds of reverse screening and selection are performed to obtain a number of preferred DNA aptamers; and (3) Optionally, the DNA aptamer with the highest affinity for thrombin protein is obtained through analysis and identification.
[0073] In another preferred embodiment, the DNA aptamer screening is performed under conventional conditions in an ion-buffered buffer.
[0074] application The DNA aptamers of this invention have undergone rigorous screening and possess stable chemical properties and good environmental adaptability. They can be used for qualitative and quantitative analysis of thrombin proteins through fluorescent labeling, electrochemical signals, or other chemical detection methods, and are widely applicable to fields such as medical diagnostics, drug development, and blood monitoring.
[0075] The DNA aptamer of this invention can be used as a substitute for traditional antibodies in immunoassays. Its highly specific binding to thrombin protein gives it extremely high detection sensitivity and stability in immunoassays. By introducing the DNA aptamer into immunoassay technology, the detection process can achieve faster and more accurate target molecule capture. At the same time, the chemical modification properties of the DNA aptamer make it compatible with existing immunoassay platforms, thereby expanding the application range of traditional immunoassays.
[0076] The main advantages of this invention include: (a) This invention accelerates the development of drugs targeting thrombin protein by rationally designing a library and screening it in a shorter number of screening rounds to obtain DNA aptamers that can bind to thrombin protein with high affinity and high specificity.
[0077] (b) Due to the reduction in the number of screening rounds, the consumption of corresponding experimental reagents and consumables will also be reduced, thereby reducing the direct cost of the screening process.
[0078] (c) This invention reduces the complexity and repetitiveness of experimental operations, lowers the requirements for manpower and time, and allows researchers to devote more energy to subsequent research and application development.
[0079] (d) The nucleic acid aptamers efficiently screened by this invention can be used for early diagnosis of diseases, reagents or drugs for targeted therapy of abnormal thrombin expression, etc., to improve the accuracy of diagnosis and the effect of treatment, and reduce damage to normal cells.
[0080] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.
[0081] Example 1: Screening of DNA aptamers that bind to thrombin protein In this embodiment, the method for screening DNA aptamers that bind to thrombin protein includes the following steps: 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences: Random single-stranded DNA library: Lib: 5'-TTCAGCACTCCACGATCTAN 30TTAGATCGTGCTACCGTGAA-3' (SEQ ID NO: 1); Among them, “N” 30 "" indicates 30 consecutive arbitrary nucleotides (A / G / C / T), and this library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0082] Primer information is shown in Table 1, synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0083] Table 1. Primers and their sequences Note: In primer names, S represents forward primer and A represents reverse primer.
[0084] The primers were prepared into 100 μM stock solutions using ddH2O and stored at -20 ℃ for later use.
[0085] 2. Magnetic bead screening: 1) Immobilization of thrombin protein with carboxyl magnetic beads Take 10 μL of thrombin protein (purchased from Abcam, Uniport ID: P00734, concentration 7.8 mg / mL), add 850 μL of 10mM sodium acetate at pH 4.5, mix well, and place on ice for later use.
[0086] Take 300 μL of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., product number: FM2221), wash once with 300 μL of 20 mM NaOH, then wash twice with 300 μL of ultrapure water. Use a magnet to hook the magnetic beads and discard the supernatant. Take 300 μL each of the prepared NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution), mix them in equal volumes, and add them to the magnetic beads. Incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads. After incubation, discard the supernatant and immediately wash once with 300 μL of ultrapure water to reduce protein self-coupling. Add the protein diluted with sodium acetate as described above, and incubate at room temperature for 60 minutes on a vertical mixer. Thrombin protein will couple to the surface of the magnetic beads through the amino groups on the protein surface.
[0087] After coupling, place the coupling tube on a magnetic rack, discard the supernatant, and add 300 μL of 1M ethanolamine (pH 8.5) to the magnetic beads. Incubate at 25 °C on a vertical mixer for 10 minutes to block unreacted activation sites on the surface of the magnetic beads. Place the tube on a magnetic rack and discard the blocking solution. Add 300 μL of 5 mM Mg... 2+ The magnetic beads were washed four times with 0.02% Tween 20 DPBS buffer and resuspended. They were labeled as MB-thrombin and stored at 4°C.
[0088] 2) Positive and negative sieving Preparation of reverse screening magnetic beads: Activate carboxyl magnetic beads, take 1000 μL of carboxyl magnetic beads, do not couple with protein, and follow the same steps. Label the coupled magnetic beads as MB-COOH.
[0089] Library dissolution and DNA preparation: The biosynthesized DNA library (as shown in SEQ ID NO: 1) was dissolved in 200 μL of a solution containing 5 mM Mg. 2+ In DPBS buffer,
[0090] The processed library was mixed with BSA and Hs-DNA to reduce non-specific binding and increase competition, and then added to 50 μL of a solution containing 5 mM Mg. 2+ MB-COOH magnetic beads were washed with DPBS buffer and the supernatant removed. The mixture was then incubated at room temperature for 60 minutes on a vertical mixer. The mixture was then placed on a magnetic rack, and the supernatant was collected and labeled "Pool-". This supernatant was used as a single-stranded nucleic acid library for positive screening with MB-thrombin magnetic beads. Before each round of positive screening, a reverse screening was performed using MB-COOH magnetic beads. The supernatant library after reverse screening was added to a solution containing 5 mM MgSO4. 2+ Wash 50 μL of MB-thrombin magnetic beads with DPBS buffer and remove supernatant, then incubate at room temperature for 60 minutes on a vertical mixer. Place on a magnetic rack, discard the supernatant, retain the magnetic beads, and incubate with 200 μL of DPBS (containing 5 mM MgSO4). 2+ Wash the magnetic beads four times. Finally, add 200 μL of ddH2O water to resuspend, boil in a water bath at 95°C for 10 minutes, collect the supernatant and label it as elution-thrombin.
[0091] PCR amplification of nucleic acid molecules in elution-thrombin was performed using Premix Taq™ (R004A) of premixed Taq enzyme. To prepare the reaction solution, 500 μL of Premix Taq, 194 μL of elution-thrombin, 5 μL of 100 μM S, 5 μL of 100 μM A, and 296 μL of ddH2O were mixed and aliquoted into 15 PCR tubes (67 μL per tube). The incubation cycle was 98℃ for 15 s, followed by 20 cycles (98℃ for 10 s, 60℃ for 30 s, and 72℃ for 1 min), 72℃ for 5 min, and then held at 4℃. The remaining 6 μL of elution-thrombin was monitored in real-time using qPCR.
[0092] The magnetic bead method was repeated for five rounds. Each round used the secondary library obtained from the previous round as the starting nucleic acid library. After renaturation treatment, the library was incubated with MB-thrombin magnetic beads. After screening, surface plasmon resonance (SPR) assays were used to detect the binding affinity of the DNA single-stranded library to thrombin protein.
[0093] 3) Analysis and identification of the obtained nucleic acid aptamers: After high-throughput sequencing analysis of the enriched library products, several sequences with the highest order were selected and synthesized by Genewiz Biotechnology (Jiangsu) Co., Ltd., and their affinity for thrombin protein was tested.
[0094] Finally, from the sequences obtained in round 5, one DNA aptamer sequence with the strongest binding ability was identified: TTCAGCACTCCACG ATCTAACGGGTTGGGTGCCGGTATTATTTTGGCGGTTAGA TCGTGCTACCGTGAA (SEQ ID NO: 4), named TB-apt69nt. The underlined sequence is the flanking primer sequence. The bolded part is the core sequence that binds to thrombin protein, obtained through SELEX screening.
[0095] The core sequence is as follows: ATCTAACGGGTTGGGTGCCGGTATTATTTTGGCGGTTAGA (SEQ ID NO: 5), it is named TB-apt40nt.
[0096] The test revealed that SEQ ID NO: 4 and SEQ ID NO: 5 exhibited similar binding affinity, indicating that bases 15 to 54 of the deoxyribonucleotide sequence shown in SEQ ID NO: 5, which corresponds to bases 1 to 40 of the deoxyribonucleotide sequence shown in SEQ ID NO: 4, constitute the key binding region between the nucleic acid aptamer and thrombin protein.
[0097] Example 2: Surface plasmon resonance (SPR) detection of binding affinity between DNA aptamers and thrombin protein The full-length DNA aptamer TB-apt69nt and its truncated DNA aptamers TB-apt40nt and TB-apt40nt-NO samples (provided by Sangon Biotech (Shanghai) Co., Ltd.) obtained through screening were annealed, extended, and transcribed, and then rinsed with DEPC-DPBS buffer (containing 5 mM Mg). 2+ It was serially diluted to 400 nM, 200 nM, 100 nM, 50 nM, and 25 nM.
[0098] 1. Couple thrombin protein to channel 2 on the surface of the CM5 chip. First, clean the chip with 50 mM NaOH, then inject 20 μL at a flow rate of 10 μL / min. Then, take an equal volume of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution), mix them, and inject 105 μL to activate the chip at a flow rate of 10 μL / min.
[0099] Thrombin protein was diluted with 10 mM sodium acetate at pH 4.5 to a final concentration of 50 μg / mL and then injected at a volume of 150 μL at a flow rate of 10 μL / min. The thrombin protein conjugation amount was approximately 11000 Ru. After injection, ethanolamine was injected into the blocking chip at a flow rate of 10 μL / min, with a volume of 210 μL. Channel 1 was treated as a control channel, but without conjugation of any protein; the activation and blocking steps were exactly the same.
[0100] 2. Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore 8K), set the detection parameters. The diluted DNA aptamer samples were sequentially flowed through channels 1 and 2, with the following program: injection flow rate of 30 μL / min for 3 minutes, dissociation rate of 30 μL / min for 3 minutes, regeneration with 2 M NaCl at a flow rate of 30 μL / min for 45 seconds. The diluted DNA aptamers were then sequentially injected.
[0101] Affinity assay data for DNA aptamer TB-apt69nt and thrombin protein are shown in [link to relevant data]. Figure 1 The results showed that TB-apt69nt has a strong affinity for thrombin protein. K D The value is 41.2 nM.
[0102] Affinity assay data for DNA aptamer TB-apt40nt and thrombin protein are shown in [link to relevant data]. Figure 2 The results showed that TB-apt40nt has a strong affinity for thrombin protein. K D The value is 56.0 nM.
[0103] Example 3 In the screening library obtained by this invention, the DNA aptamer (SEQ ID NO: 4 or 5) screened by this invention has the strongest affinity for thrombin protein. For example, another DNA aptamer sequence in the screening library, as shown in SEQ ID NO: 6 below, is identical to the flanking sequence of SEQ ID NO: 4, but SEQ ID NO: 6 has no affinity or low affinity for thrombin protein. The core sequence of SEQ ID NO: 6 is shown in SEQ ID NO: 7, which is highly similar to SEQ ID NO: 5.
[0104] TTCAGCACTCCACG ATCTAACGGGTTGGAAGCCGCGGTATATTGGTCGGTTAGA TCGTGCTACCGTGAA (SEQ ID NO: 6) The core sequence of this sequence is shown below: ATCTAACGGGTTGGAAGCCGCGGTATATTGGTCGGTTAGA (SEQ ID NO: 7), it is named TB-apt40nt-NO.
[0105] However, as Figure 3 The affinity test data shown indicates that the 40-nt truncated form TB-apt40nt-NO (SEQ ID NO: 7) of SEQ ID NO: 7 binds weakly to thrombin protein.
[0106] This further demonstrates that bases 15 to 54 of the deoxyribonucleotide sequence shown in SEQ ID NO: 5, i.e. bases 1 to 40 of the deoxyribonucleotide sequence shown in SEQ ID NO: 4, are the key binding region between the nucleic acid aptamer and the thrombin protein.
[0107] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A DNA aptamer that binds to thrombin protein, characterized in that, The DNA aptamer binds to the core sequence of the thrombin protein as shown in SEQ ID NO:
5.
2. The DNA aptamer as described in claim 1, characterized in that, The DNA aptamer contains a DNA sequence as shown in SEQ ID NO:
4.
3. A coupling agent, characterized in that, The conjugate includes the DNA aptamer of claim 1 and a detectable marker associated with the DNA aptamer.
4. The coupling as described in claim 3, characterized in that, The detectable markers include biotin, chemiluminescent groups, chemifluorescent groups, fluorescent proteins, enzymes, colloidal gold, radioisotopes, latex particles, antibodies, ligands, antigens, receptors, or combinations thereof.
5. A biochip, characterized in that, The biochip comprises the DNA aptamer of claim 1 or the conjugate of claim 3.
6. The use of the DNA aptamer of claim 1, the conjugate of claim 3, or the biochip of claim 5, characterized in that, For the following purposes: (Z1) A kit for preparing a thrombin protein detection kit; (Z2) Reagents used to prepare thrombin proteins for imaging; (Z3) Preparation of pharmaceutical compositions targeting thrombin protein; and / or (Z4) is used to purify thrombin protein.
7. A test kit, characterized in that, The detection kit includes: the DNA aptamer of claim 1, or the conjugate of claim 3.
8. The use of the test kit according to claim 7, characterized in that, This kit is used to prepare a diagnostic kit for thrombotic diseases caused by thrombin.
9. A composition, characterized in that, The composition comprises: (a) The DNA aptamer of claim 1; and (b) Pharmaceutically acceptable excipients.
10. A method for detecting thrombin protein for non-disease diagnosis and / or treatment, characterized in that, Includes the following steps: (S1) Provide the sample to be tested; (S2) The sample to be tested is mixed with the DNA aptamer of claim 1 or the conjugate of claim 3 to form a mixture; (S3) Detect the presence or absence of the "thrombin protein-DNA aptamer complex" in the mixture, wherein if the complex is present, it indicates that thrombin protein is present in the sample; if the complex is absent, it indicates that thrombin protein is absent in the sample.
Citation Information
Patent Citations
Method for improving aptamer affinity of thrombin
CN107236743A
Aptamer AS2-3 of human thrombin protein as well as screening method and application of aptamer AS2-3
CN115838729A
Thrombin-specific RNA aptamer screened based on SELEX technology and application of thrombin-specific RNA aptamer
CN119351407A
Method for screening targeted thrombin non-natural nucleic acid aptamer based on streptavidin magnetic beads and application
CN119899830A
Aptamers that bind thrombin with high affinity
US20090221680A1