Genetically engineered bacterium for efficiently producing D-pantothenic acid as well as construction method and application of genetically engineered bacterium

By editing the genes of Corynebacterium glutamicum, enhancing the expression of pantothenic acid main pathway genes, knocking out heteroacid pathway genes, and enhancing odx gene expression, the carbon metabolic flux was optimized, solving the problem of low yield in D-pantothenic acid fermentation production and achieving efficient and safe D-pantothenic acid production.

CN121518531APending Publication Date: 2026-02-13ZHEJIANG UNIV OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511643987.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

In existing technologies, the yield of D-pantothenic acid producing strains in fermentation production of D-pantothenic acid is low, and chemical synthesis methods are costly and cause serious environmental pollution, while enzyme synthesis methods require the addition of exogenous high-valence substrates. There is room for improvement in microbial fermentation methods.

Method used

By constructing a genetically engineered strain of Corynebacterium glutamicum, we enhanced the expression of pantothenic acid main pathway genes, knocked out heteroacid pathway genes, enhanced odx gene expression, and introduced plasmid pEC-XK99E-panBCilvC to optimize carbon metabolic flux and improve D-pantothenic acid synthesis efficiency.

Benefits of technology

It achieves efficient production of D-pantothenic acid, increases yield and conversion rate, has food-grade safety, and is suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518531A_ABST
    Figure CN121518531A_ABST
Patent Text Reader

Abstract

The invention discloses a genetically engineered bacterium for efficiently producing D-pantothenic acid as well as a construction method and application of the genetically engineered bacterium, the construction method comprises the following steps: (a) taking corynebacterium glutamicum DPA2 as a chassis bacterium, enhancing the expression of at least one pantothenic acid main pathway gene in a chassis bacterium genome, and introducing plasmid pEC-XK99E-panBCilvC to obtain an engineered strain for modifying the pantothenic acid main pathway gene; (b) knocking out at least one heteroacid pathway gene in the engineering strain obtained in the step (a), carrying out in-situ integration on a panBCC gene at an alaT gene locus, and introducing a plasmid pEC-XK99E-panBCilvC to obtain a heteroacid pathway modified engineering strain; and (c) knocking out the pyruvic acid shunt gene pyc in the heteroacid pathway modified strain obtained in the step (b), enhancing the expression of an odx gene, and introducing a plasmid pEC-XK99E-panBCilvC to obtain the engineering strain for regulating and controlling the pyruvic acid shunt. The genetically engineered bacterium has the beneficial effects that the genetically engineered bacterium for efficiently producing D-pantothenic acid is obtained, and the yield and the conversion rate are higher; the level of the modified strain in the aspect of fermentation production of D-pantothenic acid is obviously improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of metabolic engineering and relates to a genetically engineered bacterium that efficiently produces D-pantothenic acid, its construction method, and its application. Background Technology

[0002] Pantothenic acid, also known as vitamin B5, is an important α-hydroxy fatty acid, also called pantothenic acid. It is formed by the condensation of one molecule of β-alanine and one molecule of pantothenic acid, with the molecular formula C9H17O5N. It is readily soluble in water and ethanol. D-pantothenic acid is a precursor to coenzyme A, which plays a crucial role in cellular energy metabolism, participating in the tricarboxylic acid cycle, helping to break down carbohydrates, fats, and proteins into energy, and supporting protein synthesis and repair. D-pantothenic acid contributes to antibody production, maintains normal adrenal function, and thus enhances the immune system. Furthermore, it has a positive impact on skin and hair health, helping to maintain normal skin structure and function, and improving hair shine and texture. D-pantothenic acid can also reduce stress and anxiety, and through its antioxidant and anti-inflammatory effects, it helps protect cardiovascular health. Since animals cannot synthesize it themselves, it is widely used in cosmetics, food, medicine, and animal feed.

[0003] Currently, there are three main methods for producing D-pantothenic acid: chemical synthesis, enzymatic synthesis, and fermentation synthesis. Chemical synthesis involves first resolving D,L-pantolactone to obtain D-pantolactone, which is then reacted with β-alanine to produce calcium D-pantothenate. β-alanine is mainly synthesized via the acrylonitrile method, acrylic acid method, and succinic acid-imine method, while D,L-pantolactone is mainly prepared via the isobutyraldehyde-formaldehyde method, isobutyraldehyde-aldehydeacetic acid method, and isobutyraldehyde-chloroformane method. The disadvantages of the chemical method are the high cost of chiral resolving agents, difficulty in separation, and environmental pollution and toxicity issues. Enzymatic synthesis requires the exogenous addition of the substrates β-alanine and pantothenic acid to the host bacteria, but the extremely high market price of pantothenic acid severely restricts the industrialization of this production method. With the increasing pursuit of green and environmentally friendly practices, microbial fermentation for pantothenic acid production is gaining more and more attention. Compared with other production methods, microbial fermentation has a shorter cycle, lower cost, simpler cultivation methods, and can be used for large-scale production. As of 2019, China's annual D-pantothenic acid production reached approximately 24,000 tons, with a value of about US$1.08 billion, representing a 27% increase year-on-year. This indicates that the D-pantothenic acid market has high demand and development potential.

[0004] Corynebacterium glutamicum is a Gram-positive bacterium with advantages such as rapid growth and wide substrate adaptability. It does not produce endotoxins and is an internationally recognized food-grade strain, ensuring production safety. It serves as a microbial chassis for large-scale fermentation, efficiently synthesizing target products such as amino acids, organic acids, and vitamins. It is an important strain for the industrial production of amino acids, including L-valine, L-proline, L-leucine, and L-isoleucine. Because the D-pantothenic acid synthesis pathway highly overlaps with the branched-chain amino acid synthesis pathway, Corynebacterium glutamicum is also a promising chassis bacterium for D-pantothenic acid production.

[0005] Therefore, there is an urgent need to develop a new approach for the efficient production of D-pantothenic acid by genetically engineered bacteria. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Corynebacterium glutamicum for the efficient production of D-pantothenic acid and its construction method, and apply it to the fermentation production of D-pantothenic acid, so as to overcome the problem of low yield of D-pantothenic acid produced by existing D-pantothenic acid producing strains in the fermentation production of D-pantothenic acid.

[0007] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows:

[0008] In a first aspect, the present invention proposes a method for constructing a genetically engineered bacterium that efficiently produces D-pantothenic acid, which is constructed through the following method:

[0009] (a) Using Corynebacterium glutamicum DPA2 as the substrate bacteria, the expression of at least one pantothenic acid main pathway gene in the substrate bacteria genome was enhanced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain an engineered strain with modified pantothenic acid main pathway genes; the pantothenic acid main pathway genes include ilvBN gene, ilvC gene, ilvD gene, panBC gene or panE gene;

[0010] (b) Knock out at least one heteroacid pathway gene in the engineered strain obtained in step (a), and integrate the panBC gene in situ at the alaT gene site, and introduce the plasmid pEC-XK99E-panBCilvC to obtain an engineered strain modified with heteroacid pathway; the heteroacid pathway gene includes the alaT gene, avtA gene, ldhA gene or pta gene.

[0011] (c) Knock out the pyruvate shunting gene pyc in the hybrid acid pathway modified strain obtained in step (b), enhance the expression of the odx gene, and introduce the plasmid pEC-XK99E-panBCilvC to obtain an engineered strain that regulates pyruvate shunting.

[0012] This invention replaces the original promoters of pantothenic acid major pathway genes (including ilvBN, ilvC, ilvD, panBC, and panE genes) with P. tuf A strong promoter is used to enhance the expression intensity of genes in the pantothenic acid main pathway by superimposing effective sites; genes in the heteroacid pathway (alaT, avtA, ldhA, and pta) are knocked out, and the alaT gene is replaced in situ with the strong promoter P at the alaT gene site. tuf The panBC gene was regulated to increase its copy number, thereby reducing carbon metabolic flux loss. The pyruvate diversion gene (pyc gene) was knocked out, and the odx gene expression was enhanced to enrich the pyruvate pool and promote D-pantothenic acid synthesis. The plasmid pEC-XK99E-panBCilvC, constructed by tandemly expressing the endogenous panBC and ilvC genes of Corynebacterium glutamicum on plasmid pEC-XK99E, was introduced into the engineered strain to increase D-pantothenic acid production.

[0013] Preferred, strong promoter P tuf The nucleotide sequence is shown in SEQ ID NO.1.

[0014] Preferably, the nucleotide sequence of the ilvBN gene is shown in SEQ ID NO.2.

[0015] Preferably, the nucleotide sequence of the ilvC gene is shown in SEQ ID NO.3.

[0016] Preferably, the nucleotide sequence of the ilvD gene is shown in SEQ ID NO.4.

[0017] Preferably, the nucleotide sequence of the panBC gene is shown in SEQ ID NO.5.

[0018] Preferably, the nucleotide sequence of the panE gene is shown in SEQ ID NO.6.

[0019] Preferably, the nucleotide sequence of the alaT gene is shown in SEQ ID NO.7.

[0020] Preferably, the nucleotide sequence of the avtA gene is as shown in SEQ ID NO.8.

[0021] Preferably, the nucleotide sequence of the ldhA gene is shown in SEQ ID NO.9.

[0022] Preferably, the nucleotide sequence of the pta gene is shown in SEQ ID NO.10.

[0023] Preferably, the nucleotide sequence of the pyc gene is shown in SEQ ID NO.11.

[0024] Preferably, the nucleotide sequence of the odx gene is shown in SEQ ID NO.12.

[0025] Preferably, in step (a), the method for enhancing the expression of at least one pantothenic acid major pathway gene in the *Bacillus thuringiensis* genome is to replace the original promoter of at least one pantothenic acid major pathway gene in *Bacillus thuringiensis* with a strong promoter P. tuf .

[0026] Preferably, step (a) includes:

[0027] (a1) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the ilvBN gene in the substrate bacteria genome was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA1;

[0028] (a2) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the ilvC gene in the genome of strain CDPA1 was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA2;

[0029] (a3) Using Corynebacterium glutamicum as the chassis bacteria, homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB was used to replace the original promoter of the ilvD gene in the chassis bacteria genome with the strong promoter P. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA3;

[0030] (a4) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the panBC gene in the genome of strain CDPA1 was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA4;

[0031] (a5) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the panE gene in the genome of strain CDPA1 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA5;

[0032] (a6) Using strain CDPA1 as the chassis strain, the original promoter of the ilvC gene in the genome of strain CDPA5 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA6;

[0033] (a7) Using strain CDPA6 as the chassis bacteria, homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB was used to replace the original promoter of the ilvD gene in the CDPA6 genome with P. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the genetically engineered bacterium CDPA7.

[0034] (a8) Using strain DPA7 as the chassis bacteria, the original promoter of the panBC gene in the genome of strain CDPA7 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA8.

[0035] Preferably, step (b) includes:

[0036] (b1) Using strain CDPA8 as the chassis bacteria, the alaT gene in the chassis bacteria genome was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA9.

[0037] (b2) Using strain CDPA9 as the chassis bacteria, the alaT gene was knocked out using homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB, and a strong promoter P was simultaneously knocked in. tuf The panBC gene was regulated and introduced into the plasmid pEC-XK99E-panBCilvC to obtain strain CDPA10.

[0038] (b3) Using strain CDPA8 as the chassis bacteria, the avtA gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the engineered strain CDPA11.

[0039] (b4) Using strain CDPA8 as the chassis bacteria, the ldhA gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and introduced into plasmid pEC-XK99E-panBCilvC to obtain strain CDPA12.

[0040] (b5) Using strain CDPA8 as the substrate bacteria, the pta gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA13.

[0041] Preferably, step (c) includes:

[0042] (c1) Using strain CDPA8 as the substrate bacteria, the pyc gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the genetically engineered strain CDPA14.

[0043] (c2) Using strain CDPA14 as the chassis strain, the original promoter of the odx gene in the CDPA14 genome was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA15.

[0044] Preferably, the method for introducing plasmid pEC-XK99E-panBCilvC is electroporation.

[0045] Secondly, the present invention provides a genetically engineered bacterium constructed by the aforementioned construction method.

[0046] Thirdly, the present invention provides the application of the genetically engineered bacteria described above or the genetically engineered bacteria constructed by the construction method in the fermentation production of D-pantothenic acid.

[0047] Preferably, the application involves inoculating the genetically engineered bacteria into a fermentation medium at a 2% inoculum and fermenting it at 30°C and 180-220 rpm. The obtained fermentation broth is then separated and purified to obtain D-pantothenic acid.

[0048] Preferably, the fermentation medium composition is: glucose 30 g·L -1 25 g·L corn steep liquor -1 15 g·L ammonium sulfate -1 Ammonium acetate 15 g·L -1 urea 2 g·L -1 Sodium citrate 2 g·L -1 K2HPO4·3H2O 1.3 g·L -1 MgSO4·7H2O 0.5 g·L -1 MnSO4·H2O 0.01, Biotin 1×10 -4 g·L -1Vitamin B1 2×10 -4 g·L -1 CaCO3 20 g·L -1 pH 7.0-7.2. Sterilize at 115 ℃ for 15 min.

[0049] Preferably, before fermentation culture, slant activation and seed culture are performed, and then the seed liquid is inoculated into the fermentation medium.

[0050] Preferably, the slant activation method is as follows: *Corynebacterium glutamicum* is inoculated onto an LB agar plate and cultured overnight at 30 °C to obtain slant cells; the seed culture method is as follows: a single colony of the slant cells is picked and inoculated into LB liquid medium and cultured overnight at 30 °C and 180-200 rpm to obtain a seed culture. The seed culture is then inoculated into the fermentation medium at a volume concentration of 2%.

[0051] Compared with existing technologies, the main advantages of this invention are: it constructs a genetically engineered bacterium for the efficient production of D-pantothenic acid. This strain was obtained by modifying *Corynebacterium glutamicum*, a food-grade safe strain, as the substrate bacterium. The modified *Corynebacterium glutamicum* produces D-pantothenic acid better than the substrate strain, exhibiting higher yield and conversion rate. The optimal-performing strain obtained after modification shows a significant improvement in D-pantothenic acid production through fermentation compared to the original strain DPA2. Therefore, the *Corynebacterium glutamicum* provided by this invention has significant industrial application value. Attached Figure Description

[0052] Figure 1 This is a schematic diagram of the shake-flask fermentation performance of strains CDPA1-CDPA8.

[0053] Figure 2 This is a schematic diagram of the shake-flask fermentation performance of strain CDPA8-CDPA13.

[0054] Figure 3 This is a schematic diagram of the shake-flask fermentation performance of strains CDPA13-CDPA15. Detailed Implementation

[0055] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0056] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0057] Unless otherwise specified, the experimental materials used in the following examples are all conventional biochemical reagents. The term "enhancement" refers to increasing the activity of an enzyme encoded by the corresponding polynucleotide. This can be achieved by increasing the copy number of the gene or replacing the expression regulatory sequence of the gene on the genome (promoter substitution, etc.). The term "weakening" refers to reducing the activity of an enzyme encoded by the corresponding polynucleotide. This can be achieved by replacing the expression regulatory sequence of the gene on the genome (non-coding region sequence substitution, etc.).

[0058] LB liquid medium composition: 10 g / L peptone -1 5 g·L yeast powder -1 Sodium chloride 10 g·L -1 The solvent is deionized water, and the pH value is natural.

[0059] LB solid medium is LB liquid medium supplemented with a final concentration of 2 g·L⁻¹ -1 Agar.

[0060] BHISG medium composition: 37 g·L⁻¹ bovine brain heart extract powder -1 10 g·L glucose -1 D-sorbitol 91 g·L -1 Glycine 40 g·L -1 The solvent is deionized water, and the pH value is natural.

[0061] The Corynebacterium glutamicum DPA2 in this application has been disclosed in patent publication number CN119286745A and was provided by the Microbial Culture Collection Room of Zhejiang University of Technology.

[0062] Example 1: Promoter substitution of the ilvBN gene

[0063] Corynebacterium glutamicum DPA2 (ilvA) GTG Δpqo::panBCE) was used as the starting strain, and CRISPR-Cpf1 gene editing technology was employed, using the endogenous strong promoter P. tuf (The nucleotide sequence is shown in SEQ ID NO.1). The original promoter of the ilvBN gene is replaced in the genome, which enhances the expression intensity of the ilvBN gene and thus increases the production of D-pantothenic acid.

[0064] The specific steps are as follows:

[0065] With plasmid pEC-XK99E-P tuf Using ilvBN (disclosed in patent publication number CN119286745A, provided by the Microbial Culture Collection Laboratory of Zhejiang University of Technology) as a template, primers 1 and 2 were used to obtain the downstream homologous arm of the ilvBN gene and the strong promoter P by PCR.tuf Using a single colony of *Corynebacterium glutamicum* ATCC 13032 as a template, the upstream homologous arm of the gene *ilvBN* was obtained by PCR using primers 3 and 4. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band was extracted and purified using the Qingke gel extraction kit.

[0066] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0067] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0068] The obtained ilvBN upstream homologous arm and promoter, downstream homologous arm, and linearized pJYS3 vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 1.

[0069] Table 1 Reaction System and Conditions Components Dosage μL C115 enzyme 5 downstream homologous arms and promoters of ilvBN 1 ilvBN upstream homologous arm 1 Linearized pJYS3 vector 1 ddH2O 2 .

[0070] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0071] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 9 and 10. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-P was extracted using a plasmid extraction kit. tuf -ilvBN.

[0072] Preparation of electrocompetent cells for Corynebacterium glutamicum: A single colony of Corynebacterium glutamicum DPA2 was picked and inoculated into a small shaker containing 10 mL of LB medium. The colony was incubated overnight at 30 °C and 200 rpm. 1 mL of the overnight culture was transferred to a 500 mL Erlenmeyer flask containing 50 mL of BHISG medium and incubated at 30 °C and 200 rpm for 6 hours until the OD of the culture was reached. 600 Greater than 0.8. Place the cultured bacterial solution on ice for about 30 minutes, pour into 50 mL centrifuge tubes, centrifuge at 5000 rpm for 10 min at 4 ℃, discard the supernatant and retain the bacterial cells, add about 20 mL of pre-sterilized and pre-cooled 10% glycerol solution, resuspend in an ice-water bath, centrifuge at 5000 rpm for 8 min at 4 ℃, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend in an ice-water bath, and aliquot into 1.5 mL sterile centrifuge tubes.

[0073] plasmid pJYS3-P tuf -ilvBN imports engineered bacteria DPA2: Take 1 ng of pJYS3-P tuf The -ilvBN plasmid was added to competent cells and gently tapped to mix. The cells were then incubated on ice for 5 min, followed by two electroporations at 1.8 kV. 1 mL of preheated LB broth (46 °C) was added to the competent cells, and the cells were immediately heat-shocked at 46 °C for 6 min, then incubated at 30 °C for 200 rpm for 2-3 h. The cells were then plated on kanamycin-resistant plates and incubated at 30 °C for 48 h. Colony PCR was performed using primers 11 and 12, followed by primers 12 and 13. PCR products with the correct bands were sequenced using primer 14. Strains with correctly sequenced products were successfully edited.

[0074] Plasmid removal: Colonies with correct sequencing were inoculated into 10 mL LB broth and cultured for 18 h. The bacterial culture was then streaked onto antibiotic-free LB agar plates and incubated at 30 ℃ for 36–48 h. Single colonies were then spotted onto kanamycin-resistant and antibiotic-free LB agar plates. Strains that grew on antibiotic-free plates but not on kanamycin-resistant plates were selected, indicating successful plasmid removal. Competent cells were then prepared. The plasmid pEC-XK99E-panBCilvC (plasmid preserved in the laboratory) was introduced to obtain the engineered strain CDPA1.

[0075] Fermentation of strain CDPA1: Using DPA2 as a control strain, both CDPA1 and DPA2 were inoculated into 10 mL of LB medium and cultured at 30 ℃ and 200 rpm to prepare seed culture. After 12 h, 1 mL of seed culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented at 30 ℃ and 180 rpm for 48 h. After fermentation, 1 mL of fermentation broth was centrifuged at 12000 rpm for 2 min at room temperature, and the supernatant was collected for HPLC analysis. Another 1 mL of fermentation broth was used to determine the biomass OD. 600 .

[0076] HPLC detection: (1) Chromatographic conditions: C18 column (250×4.6mm, particle size 5μm, Agilent Technologies Co., Santa Clara, CA, USA); detection wavelength: 200nm; column temperature: 30℃; (2) Sample preparation: dilute the sample with ultrapure water to maintain the D-pantothenic acid content at 0.05-0.40g / L; (3) Mobile phase: acetonitrile / water / phosphoric acid (volume ratio 50 / 949 / 1); (4) Data acquisition time: 15min. This method was used for the detection of D-pantothenic acid in the following examples.

[0077] OD 600 Detection: After fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 2 min at room temperature, add 20% glacial acetic acid to the precipitate to react with the residual calcium carbonate, dilute 40 times, and measure OD. 600 .

[0078] Example 2: Promoter substitution of gene ilvC

[0079] With DPA2(ilvA GTG Δpqo::panBCE) was used as the starting strain, and CRISPR-Cpf1 gene editing technology was employed, using the endogenous strong promoter P. tufThe promoter (nucleotide sequence shown in SEQ ID NO.1) replaces the original promoter of the ilvC gene in the genome, enhancing the expression intensity of the ilvC gene and thus increasing the production of D-pantothenic acid. The specific steps are as follows:

[0080] Using a single colony of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of the ilvC gene was obtained by PCR using primers 15 and 16, with pEC-xk99E-P tuf Using the ilvC plasmid (disclosed in patent publication number CN119286745A, provided by the Microbial Culture Collection Laboratory of Zhejiang University of Technology) as a template, the downstream homologous arm of the ilvC gene, the strong promoter P, was obtained by PCR using primers 1 and 17. tuf The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0081] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0082] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0083] The obtained upstream homologous arm and promoter of ilvC, downstream homologous arm, and linearized pJYS3 vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 2.

[0084] Table 2 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm and promoter of ilvC 1 ilvC downstream homologous arm 1 Linearized pJYS3 vector 1 ddH2O 2 .

[0085] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0086] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 18 and 19. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-P was obtained by extraction using a plasmid extraction kit. tuf -ilvC.

[0087] The preparation method and electroporation method of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0088] After the transformants grow, colony PCR is performed using primers 11 and 20 for verification, followed by colony PCR using primers 20 and 21. PCR products with the correct bands are selected for sequencing using primer 22. If the sequencing results are correct, the strain has been successfully edited.

[0089] The plasmid removal method was the same as in Example 1. Competent cells were prepared and the plasmid pEC-XK99E-panBCE (the plasmid was preserved in the laboratory) was introduced to obtain the genetically engineered bacteria CDPA2.

[0090] Fermentation of strain CDPA1 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0091] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0092] Example 3: Promoter substitution of gene ilvD

[0093] With DPA2(ilvA GTG Using Δpqo::panBCE as the starting strain, the original promoter of the ilvD gene was replaced by homologous recombination gene editing technology mediated by shuttle plasmid pk18mobsacB, and replaced with the endogenous strong promoter P. tuf The promoter (nucleotide sequence shown in SEQ ID NO.1) replaces the original promoter of the ilvD gene in the genome, enhancing the expression intensity of the ilvD gene and thus increasing the production of D-pantothenic acid. The specific steps are as follows:

[0094] pEC-xk99E-P tufUsing the ilvD plasmid (disclosed in patent publication number CN119286745A, provided by the Microbial Culture Collection Laboratory of Zhejiang University of Technology) as a template, the downstream homologous arm of the ilvD gene and the strong promoter P were obtained by PCR using primers 1 and 23. tuf Using a single colony of *Corynebacterium glutamicum* ATCC 13032 as a template, the downstream homologous arm of the gene *ilvD* was obtained by PCR using primers 24 and 25. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0095] E. coli carrying the empty plasmid pk18mobSacB was first streaked in LB solid medium supplemented with kanamycin for 12-16 h. Then, single colonies were picked and cultured in LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0096] Using the diluted pk18mobsacB vector as a template, linearized pk18mobsacB vector was obtained by PCR using primers 26 and 27. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 56 ℃ for 30 s, 72 ℃ for 5 min 15 s, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added, and the mixture was placed in a 37 ℃ water bath for 30 min to eliminate the template.

[0097] The obtained upstream homologous arm and promoter of ilvD, downstream homologous arm, and linearized pk18mobsacB vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 3.

[0098] Table 3 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm and promoter of ilvD 1 ilvD downstream homologous arm 1 Linearized pk18mobsacB vector 1 ddH2O 2 .

[0099] After reacting at 50 ℃ for 30 min, the ligation product was obtained. This ligation product was transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. Successful colony PCR was performed using primers 28 and 29, followed by sequencing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pk18mobSacB-P was obtained by extracting the plasmid using a plasmid extraction kit. tuf -ilvD.

[0100] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0101] After transformants grew, colony PCR was performed using primers 30 and 31 for verification. Correct colonies were picked and inoculated into LBS liquid medium for 24 hours. The colonies were then streaked onto LBS plates for a second screening. Single colonies were picked from the LBS medium and spotted onto kanamycin-resistant and antibiotic-free LB plates. Colonies that grew on the antibiotic-free plate but not on the kanamycin-resistant plate were selected for colony PCR. Colony PCR using primers 32 and 33 verified successful promoter replacement. Colony PCR amplification using primers 33 and 34 was followed by sequencing with primer 35. Successfully sequenced strains were prepared as competent cells and introduced into plasmid pEC-XK99E-panBCE to obtain the genetically engineered bacterium CDPA3.

[0102] Fermentation of strain CDPA3 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0103] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0104] Example 4: Promoter replacement of the panBC gene

[0105] With DPA2(ilvA GTG Δpqo::panBCE) was used as the starting strain, and CRISPR-Cpf1 gene editing technology was employed, using the endogenous strong promoter P. tuf The promoter (nucleotide sequence shown in SEQ ID NO.1) replaces the original promoter of the panBC gene in the genome, enhancing the expression intensity of the panBC gene and thus increasing the production of D-pantothenic acid. The specific steps are as follows:

[0106] pEC-XK99E-P tuf Using the panBC plasmid (from a laboratory collection) as a template, primers 1 and 36 were used to obtain the downstream homologous arm of the panBC gene and the strong promoter P via PCR. tuf Using a single colony of *Corynebacterium glutamicum* ATCC 13032 as a template, the upstream homologous arm of the *panBC* gene was obtained by PCR using primers 37 and 38. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0107] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0108] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0109] The obtained upstream homologous arm and promoter of ilvD, downstream homologous arm, and linearized pJYS3 vector were used for multi-fragment ligation with C115 enzyme. The reaction system and conditions are shown in Table 4.

[0110] Table 4 Reaction System and Conditions Components Dosage μL C115 enzyme 5 panBC upstream homologous arm and promoter 1 panBC downstream homologous arm 1 Linearized pJYS3 vector 1 ddH2O 2 .

[0111] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0112] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 39 and 40. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-P was extracted using a plasmid extraction kit. tuf -panBC.

[0113] After the transformants grow, colony PCR is performed using primers 41 and 42 for verification, followed by colony PCR using primers 42 and 43. PCR products with the correct bands are selected for sequencing using primer 44. If the sequenced strain is deplasmidized, the editing is successful.

[0114] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA4.

[0115] Fermentation of strain CDPA4 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0116] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0117] Example 5: Promoter replacement of the panE gene

[0118] With DPA2(ilvA GTG Δpqo::panBCE) was used as the starting strain, and CRISPR-Cpf1 gene editing technology was employed, using the endogenous strong promoter P. tuf The promoter (nucleotide sequence shown in SEQ ID NO. 6) replaces the original promoter of the panE gene in the genome, enhancing the expression intensity of the panE gene and thus increasing the production of D-pantothenic acid. The specific steps are as follows:

[0119] pEC-XK99E-P tuf Using the panE plasmid (from a laboratory collection) as a template, primers 1 and 45 were used to obtain the downstream homologous arm of the panE gene and the strong promoter P via PCR. tuf Using a single colony of *Corynebacterium glutamicum* ATCC 13032 as a template, the upstream homologous arm of the *panE* gene was obtained by PCR using primers 46 and 47. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0120] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0121] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0122] The obtained panE upstream homologous arm and promoter, downstream homologous arm, and linearized pJYS3 vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 5.

[0123] Table 5 Reaction System and Conditions Components Dosage μL C115 enzyme 5 panE downstream homologous arms and promoters 1 panE upstream homologous arm 1 Linearized pJYS3 vector 1 ddH2O 2 .

[0124] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0125] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 48 and 49. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-P was obtained by extracting the plasmid using a plasmid extraction kit. tuf -panE.

[0126] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0127] After the transformants grow, colony PCR is performed using primers 11 and 50 for verification, followed by colony PCR using primers 50 and 51. PCR products with the correct bands are selected for sequencing using primer 51. If the sequencing results are correct, the strain has been successfully edited.

[0128] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA5.

[0129] Fermentation of strain CDPA5 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0130] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0131] Example 6: Superimposed replacement of the ilvC promoter

[0132] Using pJYS3-P tuf-ilvC plasmid is used for promoter replacement.

[0133] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0134] The method for verifying ilvC promoter substitution in the genome is the same as in Example 2.

[0135] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA6.

[0136] Fermentation of strain CDPA6 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0137] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0138] Example 7: Superimposed replacement of the ilvD promoter

[0139] Using pk18mobSacB-P tuf -ilvD performs genome promoter substitution.

[0140] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0141] The method for verifying ilvC promoter substitution in the genome is the same as in Example 2.

[0142] The plasmid removal method was the same as in Example 3. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA7.

[0143] Fermentation of strain CDPA4 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0144] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0145] Example 8: Superimposed replacement of panBC promoters

[0146] Using pJYS3-P tuf -The panBC plasmid is used for promoter replacement.

[0147] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0148] The method for verifying the replacement of the panBC promoter in the genome is the same as in Example 4.

[0149] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA8.

[0150] Fermentation of strain CDPA8 was carried out in the same manner as in Example 1, with DPA2 as the control strain.

[0151] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0152] Example 9: Knockout of the alaT gene

[0153] The alaT gene was knocked out in the genome using CRISPR-based gene editing technology.

[0154] Using a single colony of *Corynebacterium glutamicum* ATCC 13032 as a template, the upstream homologous arm of the *alaT* gene was obtained by PCR using primers 52 and 53, and the downstream homologous arm was obtained by PCR using primers 54 and 55. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0155] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0156] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0157] The obtained upstream and downstream homologous arms of alaT and the linearized pJYS3 vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 6.

[0158] Table 6 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm of alaT 1 alaT downstream homologous arm 1 Linearized pJYS3 vector 1 ddH2O 2 .

[0159] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0160] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 56 and 57. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Chinco gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-ΔalaT was obtained by extracting the plasmid using a plasmid extraction kit.

[0161] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0162] Method for verifying alaT gene knockout in the genome: Colony PCR verification was performed using primers 58 and 59. After successful verification, single colonies with the correct band size were picked and inoculated for preservation.

[0163] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA9.

[0164] The fermentation of strain CDPA8 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0165] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0166] Example 10: Knockout of the alaT gene and integration of panBC

[0167] To reduce L-alanine production and strengthen the main pathway, directing more metabolic flux toward pantothenic acid synthesis, CDPA8 was used as the starting strain. Homologous recombination gene editing technology mediated by shuttle plasmid pk18mobsacB was employed to knock out the alaT gene and add a panBC copy at the original site.

[0168] Using Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of alaT was obtained by PCR using primers 52 and 53, and the downstream homologous arm of alaT was obtained by PCR using primers 54 and 55. The PCR reaction conditions were as follows: 98℃ for 10 min; 98℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s, for 32 cycles.

[0169] Using plasmid pEC-XK99E-panBCE (preserved in the laboratory) as a template, primers 1 and 60 were used to obtain the plasmid with a strong promoter P by PCR. tuf The panBC gene fragment was extracted, and the PCR reaction conditions were as follows: 95 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 1 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was extracted and purified using the Qingke gel extraction kit.

[0170] E. coli carrying the empty plasmid pk18mobSacB was streaked onto LB solid medium supplemented with kanamycin for 12-16 h. Single colonies were then picked and cultured on LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0171] Using the diluted pk18mobSacB vector as a template, linearized pk18mobsacB vector was obtained by PCR using primers 26 and 27. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added and the reaction was carried out at 37 ℃ for 1 h to eliminate the template.

[0172] The resulting upstream and downstream homologous arms of alaT, with strong promoter P, are... tuf The panBC gene fragment and the linearized pk18mobSacB vector were used for multi-fragment ligation using C115. The reaction system and conditions are shown in Table 7.

[0173] Table 7 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm of alaT 1 alaT downstream homologous arm 1 PanBC gene fragment with strong promoter P tuf ​ 1 Linearized pk18mobSacB vector 1 ddH2O 1 .

[0174] After reacting at 50 ℃ for 30 min, the ligation product was obtained. This ligation product was transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 28 and 29, a single colony that had been verified was picked and inoculated into a test tube. The recombinant plasmid pk18mobSacB-ΔalaT::panBC was obtained by extracting the plasmid using a plasmid extraction kit. 10 μL of the plasmid was sent for sequencing, and the remaining plasmid was stored at -20 ℃.

[0175] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0176] First single-exchange verification: After successful colony PCR verification using primers 58 and 31, select the correct band size and inoculate it into 10 mL of liquid LBS medium and incubate for 24 hours. Then, streak the bacterial culture onto LBS plates and incubate at 30°C for 48 hours. Select single colonies and spot them onto kanamycin-resistant and antibiotic-free LB solid medium. Select strains that grow on antibiotic-free plates but not on kanamycin-resistant plates, indicating successful plasmid removal, and proceed to the next verification step.

[0177] Second single-exchange verification: Use primers 11 and 59 to verify if there is a correct band. If there is a correct band, use primers 58 and 59 to verify. Use primer 61 to sequence whether the replacement was successful. If the sequencing is correct, prepare competent cells and introduce plasmid pEC-XK99E-panBCE bacteria CDPA10.

[0178] Fermentation of strain CDPA10 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0179] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0180] Example 11 Knockout of the avtA gene

[0181] To reduce L-alanine production and strengthen the main pathway, directing more metabolic flux toward pantothenic acid synthesis, the avtA gene was knocked out using CRISPR-Cpf1 gene editing technology with CDPA8 as the starting strain.

[0182] Using Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of avtA was obtained by PCR using primers 62 and 63, and the downstream homologous arm of avtA was obtained by PCR using primers 64 and 65. The PCR reaction conditions were as follows: 98℃ for 10 min; 98℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s, for 32 cycles.

[0183] E. coli carrying the pJYS3 empty plasmid were first streaked in LB solid medium supplemented with kanamycin for 12-16 h. Then, single colonies were picked and cultured in LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0184] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added and the reaction was carried out at 37 ℃ for 1 h to eliminate the template.

[0185] The obtained upstream and downstream homologous arms of avtA and the linearized pJYS3 vector were used for multi-fragment ligation using C115. The reaction system and conditions are shown in Table 8.

[0186] Table 8 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm of avtA 1 avtA downstream homologous arm 1 Linearized pJYS3 vector 1 <![CDATA[ddH2O]]> 2 .

[0187] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, sequencing is performed. If the sequencing is correct, the recombinant plasmid can be extracted using a plasmid extraction kit.

[0188] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 66 and 67. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-ΔavtA was obtained by extraction using a plasmid extraction kit.

[0189] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0190] After the transformants grow, colony PCR is performed using primers 68 and 69 to verify the results. If the colony PCR bands are correct, the strain has been successfully edited.

[0191] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA11.

[0192] Fermentation of strain CDPA11 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0193] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0194] Example 12 Knockout of the ldhA gene

[0195] To reduce lactic acid production and strengthen the main pathway, directing more metabolic flux toward pantothenic acid synthesis, the CDPA8 strain was used as the starting strain, and the ldhA gene was knocked out using CRISPR-Cpf1 gene editing technology.

[0196] Using Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of ldhA was obtained by PCR using primers 70 and 71, and the downstream homologous arm of ldhA was obtained by PCR using primers 72 and 73. The PCR reaction conditions were as follows: 98℃ for 10 min; 98℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s, for 32 cycles.

[0197] E. coli carrying the pJYS3 empty plasmid were first streaked in LB solid medium supplemented with kanamycin for 12-16 h. Then, single colonies were picked and cultured in LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0198] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added and the reaction was carried out at 37 ℃ for 1 h to eliminate the template.

[0199] The obtained ldhA upstream and downstream homologous arms and the linearized pJYS3 vector were used for multi-fragment ligation using C115. The reaction system and conditions are shown in Table 9.

[0200] Table 9 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm of ldhA 1 ldhA downstream homologous arm 1 Linearized pJYS3 vector 1 <![CDATA[ddH2O]]> 2 .

[0201] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, sequencing is performed. If the sequencing is correct, the recombinant plasmid can be extracted using a plasmid extraction kit.

[0202] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 74 and 75. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-ΔldhA was obtained by extracting the plasmid using a plasmid extraction kit.

[0203] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0204] After the transformants grow, colony PCR with primers 76 and 77 is used for verification. If the colony PCR bands are correct, the strain has been successfully edited.

[0205] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA12.

[0206] Fermentation of strain CDPA12 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0207] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0208] Example 13: Knockout of the pta gene

[0209] To reduce lactic acid production and strengthen the main pathway, directing more metabolic flux toward pantothenic acid synthesis, the pta gene was knocked out using CRISPR-Cpf1 gene editing technology with CDPA8 as the starting strain.

[0210] Using Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of PTA was obtained by PCR using primers 78 and 79, and the downstream homologous arm of PTA was obtained by PCR using primers 80 and 81. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles.

[0211] E. coli carrying the pJYS3 empty plasmid were first streaked in LB solid medium supplemented with kanamycin for 12-16 h. Then, single colonies were picked and cultured in LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0212] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added and the reaction was carried out at 37 ℃ for 1 h to eliminate the template.

[0213] The obtained ldhA upstream and downstream homologous arms and the linearized pJYS3 vector were used for multi-fragment ligation using C115. The reaction system and conditions are shown in Table 10.

[0214] Table 10 Reaction System and Conditions Components Dosage μL C115 enzyme 5 PTA upstream homologous arm 1 PTA downstream homologous arm 1 Linearized pJYS3 vector 1 <![CDATA[ddH2O]]> 2 .

[0215] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, sequencing is performed. If the sequencing is correct, the recombinant plasmid can be extracted using a plasmid extraction kit.

[0216] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 82 and 83. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-Δpta was obtained by extracting the plasmid using a plasmid extraction kit.

[0217] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0218] After the transformants grow, colony PCR is performed using primers 84 and 85 to verify the results. If the colony PCR bands are correct, the strain has been successfully edited.

[0219] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA13.

[0220] Fermentation of strain CDPA13 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0221] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0222] Example 14: Knockout of the pyc gene

[0223] To reduce lactic acid production and strengthen the main pathway, directing more metabolic flux toward pantothenic acid synthesis, the CDPA8 strain was used as the starting strain, and the pyc gene was knocked out using CRISPR-Cpf1 gene editing technology.

[0224] Using Corynebacterium glutamicum ATCC 13032 as a template, the upstream homologous arm of pyc was obtained by PCR using primers 86 and 87, and the downstream homologous arm of pyc was obtained by PCR using primers 88 and 89. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles.

[0225] E. coli carrying the pJYS3 empty plasmid were first streaked in LB solid medium supplemented with kanamycin for 12-16 h. Then, single colonies were picked and cultured in LB liquid medium supplemented with kanamycin at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected, and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0226] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added and the reaction was carried out at 37 ℃ for 1 h to eliminate the template.

[0227] The obtained ldhA upstream and downstream homologous arms and the linearized pJYS3 vector were used for multi-fragment ligation using C115. The reaction system and conditions are shown in Table 11.

[0228] Table 11 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arm of pyc 1 downstream homologous arms of pyc 1 Linearized pJYS3 vector 1 <![CDATA[ddH2O]]> 2 .

[0229] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, sequencing is performed. If the sequencing is correct, the recombinant plasmid can be extracted using a plasmid extraction kit.

[0230] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 90 and 91. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-Δpyc was obtained by extracting the plasmid using a plasmid extraction kit.

[0231] The preparation and electroporation methods of Corynebacterium glutamicum electroporation competent cells are the same as in Example 1.

[0232] After the transformants grow, colony PCR with primers 92 and 93 is used for verification. If the colony PCR bands are correct, the strain has been successfully edited.

[0233] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCE was introduced to obtain the genetically engineered bacteria CDPA14.

[0234] Fermentation of strain CDPA14 was carried out in the same manner as in Example 1, with DPA8 as the control strain.

[0235] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0236] Example 15 Promoter replacement of gene odx

[0237] To increase pyruvate accumulation, CRISPR-Cpf1 gene editing technology was used, employing the endogenous strong promoter P. tuf The promoter (nucleotide sequence shown in SEQ ID NO.1) replaces the original promoter of the odx gene in the genome, enhancing the expression intensity of the odx gene and thus increasing the production of D-pantothenic acid. The specific steps are as follows:

[0238] Using Corynebacterium glutamicum ATCC 13032 as a template, primers 94 and 95, 95 and 96, and 95 and 97 were used in three rounds of PCR to obtain the downstream homologous arm of the odx gene and the strong promoter P. tufUsing a single colony of *Corynebacterium glutamicum* ATCC13032 as a template, the upstream homologous arm of the *odx* gene was obtained by PCR using primers 98 and 99. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct bands were extracted and purified using the Qingke gel extraction kit.

[0239] Streaking E. coli carrying the pJYS3 empty plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0240] The diluted pJYS3 vector was used as a template, and linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0241] The obtained upstream homologous arm and promoter of odx, downstream homologous arm, and linearized pJYS3 vector were used for multi-fragment ligation using C115 enzyme. The reaction system and conditions are shown in Table 12.

[0242] Table 12 Reaction System and Conditions Components Dosage μL C115 enzyme 5 upstream homologous arms and promoters of odx 1 odx downstream homologous arm 1 Linearized pJYS3 vector 1 <![CDATA[ddH2O]]> 2 .

[0243] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0244] The correctly sequenced plasmid was introduced into the PAM site via PCR using primers 100 and 101. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 6 min, for 32 cycles. After confirmation by nucleic acid gel electrophoresis, the correct band fragment was purified using the Qingke gel extraction kit and directly transformed into E. coli DH5α competent cells. The cells were incubated overnight at 37 ℃. After successful colony PCR verification using primers 7 and 8, the cells were sent for testing. Single colonies with correct sequencing were picked and inoculated into test tubes. The recombinant plasmid pJYS3-P was obtained by extraction using a plasmid extraction kit. tuf -odx.

[0245] After the transformants grow, colony PCR is performed using primers 41 and 102 for verification, followed by colony PCR using primers 102 and 103. PCR products with the correct bands are selected for sequencing using primer 104. If the sequenced strain is deplasmidized, the editing is successful.

[0246] The plasmid removal method was the same as in Example 1. After plasmid removal, competent cells were prepared and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the genetically engineered bacteria CDPA15.

[0247] Fermentation of strain CDPA15 was carried out in the same manner as in Example 1, with DPA14 as the control strain.

[0248] HPLC detection and OD 600 The measurement method is the same as in Example 1.

[0249] Example 16 Construction of plasmid pEC-XK99E-panBCilvC

[0250] Using Corynebacterium glutamicum ATCC13032 as a template, the gene panBC and the strong promoter P were obtained by three rounds of PCR using primers 105 and 106, primers 96 and 106, and primers 97 and 106. tuf The ilvC gene was obtained using primers 107 and 108. The PCR reaction conditions were as follows: 98 ℃ for 10 min; 98 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 45 s, for 32 cycles.

[0251] Streaking E. coli carrying the empty pEC-XK99E plasmid onto LB solid medium supplemented with kanamycin and activating for 12-16 h. Single colonies were picked and cultured on LB liquid medium supplemented with kanamycin and incubated at 37 ℃ for 12-16 h. 2-4 mL of fresh bacterial culture was collected and plasmids were extracted according to the instructions of the Qingke Plasmid Mini-Prep Kit.

[0252] The diluted pEC-XK99E vector was used as a template, and linearized pEC-XK99E vector was obtained by PCR using primers 109 and 110. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 5 min, for 32 cycles. After verification by nucleic acid electrophoresis, DpnI was added to eliminate the template.

[0253] The obtained panBC and strong promoter P tuf The gene ilvC and the linearized pEC-XK99E vector were used for multi-fragment ligation using the C115 enzyme. The reaction system and conditions are shown in Table 13.

[0254] Table 13 Reaction System and Conditions Components Dosage μL C115 enzyme 5 <![CDATA[panBC and strong promoter P tuf > 1 ilvC gene 1 Linearized pEC-XK99E vector 1 <![CDATA[ddH2O]]> 2 .

[0255] After reacting at 50 ℃ for 30 min, the ligation product can be obtained. The ligation product is transformed into E. coli DH5α competent cells and cultured overnight at 37 ℃. After successful colony PCR verification using primers 111 and 112, the cells are sequenced. Single colonies with correct sequencing are picked and inoculated into test tubes. The recombinant plasmid can be obtained by extracting the plasmid using a plasmid extraction kit.

[0256] In summary, the modified Corynebacterium glutamicum provided by this invention can produce D-pantothenic acid better than the chassis strain, with higher yield and conversion rate. The best-performing strain obtained after modification shows a significant improvement in D-pantothenic acid production compared to the original strain DPA2, generally producing higher pantothenic acid yields. The final optimal strain is DPA15, with a yield of approximately 1.65 g / L, nearly twice that of strain DPA2 (yield approximately 0.9 DPA). Therefore, the Corynebacterium glutamicum provided by this invention has significant industrial application value.

[0257] Table 14 Primer Table Primer 1 AATGTCCACAGGGTAGCTGGTA Primer 2 agtagaacaactgttcacctTGATTCTTGCCGATTTCGGCAG Primer 3 ggactgagctagctgtcaatctCTTCAGAGCGCGCGATGACA Primer 4 TACCAGCTACCCTGTGGACATTCCAAGCCGATTTCAACTCAGC Primer 5 agattgacagctagctcagtcc Primer 6 aggtgaacagttgttctacttttg Primer 7 aggacgctgatgcaaacggc Primer 8 ggatctcgtaaccgaacttgag Primer 9 ATAAGGATTTTCACAGGACCCGTCatctacaacagtagaaattcggatcc Primer 10 GACGGGTCCTGTGAAAATCCTTATatttaaataaaacgaaaggctcagtcg Primer 11 CACAGGGTAGCTGGTAGTTTGA Primer 12 TGGAAACAGCCGTCGCCG Primer 13 TTGCACGAGGAAACGCATGG Primer 14 TGTAGCATGACACACCATGAC Primer 15 ggactgagctagctgtcaatctACTAAACTTCGTAACCAGGGC Primer 16 TACCAGCTACCCTGTGGACATTCCCACTGTAAATCGTGGGAG Primer 17 agtagaacaactgttcacctGAGCGTCAACCTTGACCCAG Primer 18 ACATCTTTTCACCAAAATTTTTACatctacaacagtagaaattcggatcc Primer 19 GTAAAAATTTTGGTGAAAAGATGTatttaaataaaacgaaaggctcagtcg Primer 20 CAGCCCTGCGTAAGCGGATG Primer 21 AAACCTGGGCATGGTTCGCC Primer 22 GGAACCATTCGGAATCCGCG Primer 23 CGACGGCCAGTGCCAAGCTTGCGGTGGACGTCTTCCATGT Primer 24 TACCAGCTACCCTGTGGACATTCAACGGCACTTTGAAAACTTGG Primer 25 GCTATGACCATGATTACGAATTCAGTAAGCACGCCTTCGATGA Primer 26 GAATTCGTAATCATGGTCATAGC Primer 27 AAGCTTGGCACTGGCCGTC Primer 28 TGAAGCTAGCTTATCGCGCC Primer 29 AGGTTTCCCGACTGGAAAGC Primer 30 TGGACGTCCTTGTTCAGCAG Primer 31 CAGGTTTCCCGACTGGAAAG Primer 32 CTATATCTCCTTCATGGTCTTAC Primer 33 AACTCCAGTGGATGGCTGTCA Primer 34 TGGACGTCCTTGTTCAGCAG Primer 35 TGGGCAAGCCAGTTCAGTTG Primer 36 ggactgagctagctgtcaatctCCGAGTGCTTCAAACTGCAG Primer 37 TACCAGCTACCCTGTGGACATTACTGTTCAGGGGTGTTGCTC Primer 38 agtagaacaactgttcacctCCGCTCACTCACAATCGATG Primer 38 AGTATAGATGTGATGACCAGCTCAatctacaacagtagaaattcggatcc Primer 39 TGAGCTGGTCATCACATCTATACTatttaaataaaacgaaaggctcagtcg Primer 41 CGCCGTTGCCCTTAGGATTCA Primer 42 TTGAACAGCTTCGCCACCAC Primer 43 AAGCTCTACATCAATCCGCAG Primer 44 ATCTGTTGTACATTCTCGGCC Primer 45 aaagtagaacaactgttcacctCTAAAGTGAATTTTCCTCTTCTTT Primer 46 ggactgagctagctgtcaatctGCGAAATTACAGCGAACAACTC Primer 47 TACCAGCTACCCTGTGGACATTTCTACAAAGGAGTCATCAATGG Primer 48 TTGCCTGAGCACAGATAAGATTTGatctacaacagtagaaattcggatcc Primer 49 CAAATCTTATCTGTGCTCAGGCAAatttaaataaaacgaaaggctcagtcg Primer 50 ACATGGCAGTCCACATAG Primer 51 GGGGATAGATGTCACCGTCG Primer 51 GCGATCCGCCAAATCATGGG Primer 52 actgagctagctgtcaatctACCCTTTCACCGAAGTGACAC Primer 53 CCGCTCAATGTTGCCACTTTG Primer 54 AAAGTGGCAACATTGAGCGGGTTAGGATTCACCACGAATCTCAG Primer 55 GGAGTCGCGTGCACGATAAC Primer 56 CATGACCTGCTGATTTTGGCCGATatctacaacagtagaaattcggatcc Primer 57 ATCGGCCAAAATCAGCAGGTCATGatttaaataaaacgaaaggctcagtcg Primer 58 TCAAGGGTGATGCCAAACGAG Primer 59 ACCCTCCACCCACGGCTTAC Primer 60 GGAAACAGCTATGACCATGATTACGAATTCGGAGTCGCGTGCACGATAAC Primer 61 CGGACGTGAATATTGCCGAAG Primer 62 GCCTATCTGCGTACTGCTTTTA Primer 63 AGTAGAACAACTGTTCACCTTCATGGCTGCGCAGGGTGTT Primer 64 GACTGAGCTAGCTGTCAATCTATGGTGAGGTATCCGCGAAGA Primer 65 TAAAAGCAGTACGCAGATAGGCCAGCGACTAGGTTAGTTTCGG Primer 66 CAATCGGTGTGACCAGCTCATCTGatctacaacagtagaaattcggatcc Primer 67 CAGATGAGCTGGTCACACCGATTGatttaaataaaacgaaaggctcagtcg Primer 68 TTACTTCGTGTGCGGTTTCGC Primer 69 GGCCGTAGGTGAGGGGTTC Primer 70 ggactgagctagctgtcaatctTGGTCACGGTGAATGCTCGG Primer 71 ATCTTTGGCGCCTAGTTGGC Primer 72 GCCAACTAGGCGCCAAAGATTTTCGATCCCACTTCCTGATTTC Primer 73 caaaagtagaacaactgttcacctTCATACGACCACGGGCTACC Primer 74 GGCATCTCTCCTCGTGGCGTCatctacaacagtagaaattcggatcc Primer 75 GACGCCACGAGGAAGATGCCatttaaataaaacgaaaggctcagtcg Primer 76 GTAGGTGAGTTCTTCGTCGG Primer 77 ATGACAAGATCCACCTGATCG Primer 78 GATGGAAGATGAACCGGAGTTGACTGGTTCGAGGTTGCTGT Primer 79 caaaagtagaacaactgttcacctGATCAATCTGCACGTCCGTG Primer 80 ggactgagctagctgtcaatctGCATCCTCACGGACAAACTG Primer 81 AACTCCGGTTCATCTTCCATC Primer 82 ATGTCAGGGACTGTTGCGCCACGGatctacaacagtagaaattcggatcc Primer 83 CCGTGGCGCAACAGTCCCTGACATatttaaataaaacgaaaggctcagtcg Primer 84 AGAGCTAAGCGAACTTCACCG Primer 85 GTAGCGCCAGTGGAGAACAC Primer 86 ggactgagctagctgtcaatctACTGTTGGTTCCATTCCAAACA Primer 87 CGGGGCTTTTTACAGAAAGGTGTGTGAGTCGACACTAGAGTA Primer 88 ACCTTTCTGTAAAAAGCCCCG Primer 89 agtagaacaactgttcacctCCTCCGGTTTTGGCAATAGT Primer 90 GACTGCTCACTGCAGCGTCGTCACatctacaacagtagaaattcggatcc Primer 91 GTGACGACGCTGCAGTGAGCAGTCatttaaataaaacgaaaggctcagtcg Primer 92 ACGTGCTGGAAACCGTTCTG Primer 93 TCATTTGTCTCCTTGTGTCATTG Primer 94 AGACCATGAAGGAGATATAGATGCGTTTTGGACGAATTGCC Primer 95 agtagaacaactgttcacctCTTCGCCACAGCCAATGTCT Primer 96 TTTGAAAATCAACGCCGTTGCCCTTAGGATTCAGTAAGACCATGAAGGAGATATAGATG Primer 97 AATGTCCACAGGGTAGCTGGTAGTTTGAAAATCAACGCCGTTGCC Primer 98 ggactgagctagctgtcaatctGATGGATATTAAGAAGGGTGGC Primer 99 TACCAGCTACCCTGTGGACATTCCCAAATATCTTTGAGGGTGTT Primer 100 GGTCATCGTGCAGGCCCCCACACCatctacaacagtagaaattcggatcc Primer 101 GGTGTGGGGGCCTGCACGATGACCatttaaataaaacgaaaggctcagtcg Primer 102 CCGGATTCGATGGCGAATTC Primer 103 CGAGATGGCTAAGGATGTCC Primer 104 TCAAGCATTTCGGAACGCTTC Primer 105 AAGACCATGAAGGAGATATAGATGCCCATGTCAGGCATTGA(panBC-F Primer 106 TCTCATCCGCCAAAACAGCCCTAGAGCTCGATATTGTCGATCAACC(panBC-R Primer 107 GACCATGAAGGAGATATAGATGGCTATTGAACTGCTTTATGATGC Primer 108 TCTCATCCGCCAAAACAGCCTTAAGCGGTTTCTGCGCGAGC Primer 109 GGCTGTTTTGGCGGATGAGA Primer 110 CATGGTCTGTTTCCTGTGTGAA Primer 111 CATCCGGCTCGTATAATGTGTGG Primer 112 CAGACCGCTTCTGCGTTCTG .

[0258] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in methods and compositions, will be apparent to those skilled in the art without departing from the scope and spirit of this invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A method for constructing a genetically engineered bacterium that efficiently produces D-pantothenic acid, characterized in that, Build using the following method: (a) Using Corynebacterium glutamicum DPA2 as the substrate bacteria, the expression of at least one pantothenic acid main pathway gene in the substrate bacteria genome was enhanced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain an engineered strain with modified pantothenic acid main pathway genes; the pantothenic acid main pathway genes include ilvBN gene, ilvC gene, ilvD gene, panBC gene or panE gene; (b) Knock out at least one heteroacid pathway gene in the engineered strain obtained in step (a), and integrate the panBC gene in situ at the alaT gene site, and introduce the plasmid pEC-XK99E-panBCilvC to obtain an engineered strain modified with heteroacid pathway; the heteroacid pathway gene includes the alaT gene, avtA gene, ldhA gene or pta gene. (c) Knock out the pyruvate shunting gene pyc in the heteroacid pathway modified strain obtained in step (b), enhance the expression of the odx gene, and introduce the plasmid pEC-XK99E-panBCilvC to obtain an engineered strain that regulates pyruvate shunting, which is a genetically engineered strain that produces D-pantothenic acid efficiently.

2. The construction method according to claim 1, characterized in that, strong promoter P tuf The nucleotide sequences of the following genes are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively.

3. The construction method according to claim 1, characterized in that, In step (a), the method for enhancing the expression of at least one pantothenic acid major pathway gene in the *Bacillus thuringiensis* genome is to replace the original promoter of at least one pantothenic acid major pathway gene in *Bacillus thuringiensis* with a strong promoter P. tuf .

4. The construction method according to claim 3, characterized in that, Step (a) includes: (a1) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the ilvBN gene in the substrate bacteria genome was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA1; (a2) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the ilvC gene in the genome of strain CDPA1 was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA2; (a3) Using Corynebacterium glutamicum as the chassis bacteria, homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB was used to replace the original promoter of the ilvD gene in the chassis bacteria genome with the strong promoter P. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA3; (a4) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the panBC gene in the genome of strain CDPA1 was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA4; (a5) Using Corynebacterium glutamicum as the substrate bacteria, the original promoter of the panE gene in the genome of strain CDPA1 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA5; (a6) Using strain CDPA1 as the chassis strain, the original promoter of the ilvC gene in the genome of strain CDPA5 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA6; (a7) Using strain CDPA6 as the chassis bacteria, homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB was used to replace the original promoter of the ilvD gene in the CDPA6 genome with P. tuf A strong promoter was introduced, and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the genetically engineered bacterium CDPA7. (a8) Using strain DPA7 as the chassis bacteria, the original promoter of the panBC gene in the genome of strain CDPA7 was replaced with P using the CRISPR-Cpf1 gene editing method. tuf A strong promoter was introduced, and plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA8.

5. The construction method according to claim 4, characterized in that, Step (b) includes: (b1) Using strain CDPA8 as the chassis bacteria, the alaT gene in the chassis bacteria genome was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA9. (b2) Using strain CDPA9 as the chassis bacteria, the alaT gene was knocked out using homologous recombination gene editing technology mediated by shuttle plasmid pk18mobSacB, and a strong promoter P was simultaneously knocked in. tuf The panBC gene was regulated and introduced into the plasmid pEC-XK99E-panBCilvC to obtain strain CDPA10; (b3) Using strain CDPA8 as the chassis bacteria, the avtA gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the engineered strain CDPA11. (b4) Using strain CDPA8 as the chassis bacteria, the ldhA gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and introduced into plasmid pEC-XK99E-panBCilvC to obtain strain CDPA12. (b5) Using strain CDPA8 as the substrate bacteria, the pta gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA13.

6. The construction method according to claim 4, characterized in that, Step (c) includes: (c1) Using strain CDPA8 as the substrate bacteria, the pyc gene in the genome of strain CDPA8 was knocked out by CRISPR-Cpf1 gene editing method and the plasmid pEC-XK99E-panBCilvC was introduced to obtain the genetically engineered strain CDPA14. (c2) Using strain CDPA14 as the substrate bacteria, the original promoter of the odx gene in the CDPA14 genome was replaced with the strong promoter P using the CRISPR-Cpf1 gene editing method. tuf The plasmid pEC-XK99E-panBCilvC was introduced to obtain strain CDPA15.

7. A genetically engineered bacterium constructed by the construction method of any one of claims 1-6.

8. The application of the genetically engineered bacteria constructed by the construction method of any one of claims 1 to 6 or the genetically engineered bacteria of claim 7 in the fermentation production of D-pantothenic acid.

9. The application according to claim 8, characterized in that, The application involves inoculating the genetically engineered bacteria into a fermentation medium at a 2% inoculum and fermenting it at 30°C and 180-220 rpm. The fermentation broth is then separated and purified to obtain D-pantothenic acid.

10. The application according to claim 8, characterized in that, Before fermentation, the culture is first activated by slant culture and then seed culture is performed. The seed culture is then inoculated into the fermentation medium.

Citation Information

Patent Citations

  • Corynebacterium glutamicum producing strain for efficiently producing D-pantothenic acid as well as construction method and application of corynebacterium glutamicum producing strain

    CN119286745A