Anti-BCMA single-domain antibody and application thereof
By designing single-domain antibodies that specifically target BCMA, the targeting and cytotoxicity issues in existing technologies have been resolved, enabling precise treatment of diseases with high BCMA expression.
Patent Information
- Application Number
- CN202411106978.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-13
- Publication Date
- 2026-02-17
AI Technical Summary
Existing technologies make it difficult to develop single-domain antibodies that can specifically target BCMA for the treatment of diseases with high BCMA expression, such as multiple myeloma, and traditional antibodies may cause cytotoxicity during the targeting process.
A single-domain antibody that specifically targets BCMA was designed and developed. It uses a specific combination of VHH chain CDR sequence and frame region, combined with human, mouse or camel frame regions, and has high affinity and specificity. It does not contain Fc domain to avoid ADCC effect.
It achieves highly efficient targeting of BCMA, reduces cytotoxicity, and provides the possibility of precise targeting of tumor cells for drug delivery, applicable to the treatment of a variety of diseases with high BCMA expression.
Smart Images

Figure BDA0004991106410000041 
Figure BDA0004991106410000171 
Figure BDA0004991106410000201
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to a single-domain antibody against BCMA and its application. Background Technology
[0002] BCMA (B cell maturation antigen), also known as TNFRSF17 (TNF receptor superfamily member 17) or CD269, plays a major role in the maturation and differentiation of B cells into plasma cells.
[0003] BCMA consists of three main domains: an extracellular domain (1-54), a transmembrane domain (55-77), and an intracellular domain (78-184). BCMA, along with its family members TACI and BAFF-R, can bind to either BAFF or APRIAL ligands, respectively. BCMA is primarily expressed in plasma cells and mature B lymphocytes, with virtually no expression in other normal tissues. Related studies have shown that BCMA is the most selectively expressed receptor in multiple myeloma cell lines; therefore, BCMA is an ideal target for the treatment of multiple myeloma.
[0004] Single-domain antibodies are a novel type of antibody molecule discovered in camels by the research group of Belgian immunologists Hamers-Casterman. Compared to traditional antibodies, they have a smaller molecular weight, about one-tenth the size of traditional IgG antibodies. Therefore, they have a simpler structure, are easier to modify, exhibit strong tissue infiltration, and have low immunogenicity. Furthermore, single-domain antibodies do not contain an Fc domain, so they do not mediate ADCC effects to cause cytotoxicity when used as targeting molecules. In addition, they possess advantages such as good stability, resistance to high temperatures and extreme pH environments, and low production costs. Therefore, single-domain antibodies are excellent targeting molecules with significant value for targeted drug development.
[0005] Therefore, developing single-domain antibodies that can specifically target BCMA, thereby specifically targeting the cell surface where BCMA is highly expressed, is of great significance as a drug delivery carrier and for precise targeting of tumor cells. Summary of the Invention
[0006] This invention provides a single-domain antibody that can specifically target BCMA.
[0007] In a first aspect of the invention, a single-domain antibody against BCMA is provided, the single-domain antibody having three complementarity-determining regions (CDRs) derived from the VHH chain represented by any of the following amino acid sequences: SEQ ID NO:8, SEQ ID NO:15, SEQ ID NO:21, SEQ ID NO:24 or SEQ ID NO:26;
[0008] The CDRs are CDR1, CDR2, and CDR3 determined by any one of the IMGT rule, Kabat rule, Chothia rule, AbM rule, or Contact rule.
[0009] In another preferred embodiment, CDR1, CDR2 and CDR3 are selected from the group consisting of:
[0010] (1) CDR1 with amino acid sequence as shown in SEQ ID NO:2, CDR2 with amino acid sequence as shown in SEQ ID NO:4 and CDR3 with amino acid sequence as shown in SEQ ID NO:6;
[0011] (2) CDR1 with amino acid sequence as shown in SEQ ID NO:10, CDR2 with amino acid sequence as shown in SEQ ID NO:12 and CDR3 with amino acid sequence as shown in SEQ ID NO:14;
[0012] (3) CDR1 with amino acid sequence as shown in SEQ ID NO:10, CDR2 with amino acid sequence as shown in SEQ ID NO:18 and CDR3 with amino acid sequence as shown in SEQ ID NO:20;
[0013] (4) CDR1 with amino acid sequence as shown in SEQ ID NO:25, CDR2 with amino acid sequence as shown in SEQ ID NO:12 and CDR3 with amino acid sequence as shown in SEQ ID NO:14.
[0014] In another preferred embodiment, the amino acid sequence of the VHH chain of the single-domain antibody is as shown in any of the following: SEQ ID NO:8, SEQ ID NO:15, SEQ ID NO:21, SEQ ID NO:24 or SEQ ID NO:26.
[0015] In another preferred embodiment, the CDR region of the single-domain antibody VHH chain contains an amino acid sequence having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to any of the above sequences.
[0016] In another preferred embodiment, any of the above-mentioned amino acid sequences further includes a derivative sequence that has optionally been added, deleted, modified, and / or substituted at least one amino acid and is capable of retaining BCMA binding affinity.
[0017] In another preferred embodiment, the number of added, deleted, modified and / or substituted amino acids is 1-3, more preferably 1-2, and even more preferably 1.
[0018] In another preferred embodiment, the VHH chain of the single-domain antibody further includes a framework region (FR).
[0019] In another preferred embodiment, CDR1, CDR2 and CDR3 are separated by the frame regions FR1, FR2, FR3 and FR4 of the VHH chain.
[0020] In another preferred embodiment, the frame region FR is of human, mouse, rabbit, or camel origin.
[0021] In another preferred embodiment, the single-domain antibody binds to human, mouse, or monkey-derived BCMA.
[0022] In another preferred embodiment, the antibody is a heavy chain antibody, which includes heavy chain constant regions CH2 and CH3 (Fc segment).
[0023] In another preferred embodiment, the VHH chain of the single-domain antibody targeting BCMA has an amino acid sequence that is ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99% homology with the amino acid sequence shown in SEQ ID NO:8, 15, 21, 24, or 26.
[0024] In another preferred embodiment, the VHH chain of the anti-BCMA single-domain antibody has one or more amino acid sequences as shown in SEQ ID NO:8, 15, 21, 24 or 26.
[0025] In another preferred embodiment, the anti-BCMA single-domain antibody includes a monomer, a bivalent (bivalent antibody), a tetravalent (tetravalent antibody), and / or a multivalent (multivalent antibody).
[0026] In another preferred embodiment, the amino acid sequence of the VHH chain of the single-domain antibody is selected from the group consisting of any one of the sequences shown in SEQ ID NO: 8, 15, 21, 24 or 26.
[0027] In another preferred embodiment, the single-domain antibody is a monovalent, bivalent, trivalent, or quadrivalent single-domain antibody.
[0028] In a second aspect of the invention, a single-domain antibody fusion protein is provided, the fusion protein containing an anti-BCMA single-domain antibody as a first fusion element according to the first aspect of the invention.
[0029] In another preferred embodiment, the fusion protein is fused together with a first fusion element.
[0030] In another preferred embodiment, the additional fusion element includes an antibody, a peptide, or a combination thereof.
[0031] In another preferred embodiment, the fusion protein is a bispecific or trispecific antibody.
[0032] The single-domain antibody fusion protein has the structure shown in Formula I from the N-terminus to the C-terminus:
[0033] Z1-Z2-L-Z3(I)
[0034] In the formula,
[0035] Z1 is the VHH chain of the anti-BCMA single-domain antibody as described in the first aspect of the present invention;
[0036] Z2 is the Fc segment with no or no immunoglobulin;
[0037] L represents the connector sequence;
[0038] Z3 is an additional fusion element.
[0039] In a third aspect of the invention, a polynucleotide is provided that encodes a single-domain antibody against BCMA as described in the first aspect of the invention or a single-domain antibody fusion protein as described in the second aspect of the invention.
[0040] In another preferred embodiment, the polynucleotide includes DNA and RNA.
[0041] In a fourth aspect of the invention, an expression vector is provided, the expression vector containing the polynucleotide described in the third aspect of the invention.
[0042] In a fifth aspect of the invention, a host cell is provided, the host cell containing the expression vector described in the fourth aspect of the invention, or the genome integrating the polynucleotides described in the third aspect of the invention.
[0043] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.
[0044] In another preferred embodiment, the host cell is selected from the group consisting of Escherichia coli, yeast cells, mammalian cells, bacteriophages, or combinations thereof.
[0045] In a sixth aspect of the invention, a method for generating a single-domain antibody against BCMA is provided, comprising the steps of:
[0046] (a) Culturing the host cells described in the fifth aspect of the invention under conditions suitable for generating single-domain antibodies, thereby obtaining a culture or single-domain antibody fusion protein containing the said anti-BCMA single-domain antibody; and
[0047] (b) Isolate or recover the anti-BCMA single-domain antibody or single-domain antibody fusion protein from the culture.
[0048] In another preferred embodiment, the anti-BCMA single-domain antibody has an amino acid sequence as shown in any of the following sequences: SEQ ID NO: 8, 15, 21, 24 or 26.
[0049] In another preferred embodiment, the anti-BCMA single-domain antibody has an amino acid sequence as shown in any of the following sequences: SEQ ID NO: 8, 15, 21, 24 or 26.
[0050] In a seventh aspect of the invention, an immunoconjugate is provided, the immunoconjugate comprising:
[0051] (a) A single-domain antibody against BCMA as described in the first aspect of the invention; and
[0052] (b) The coupling part selected from the following group: detectable marker, drug, or combination thereof.
[0053] In another preferred embodiment, the immunoconjugate is an antibody-drug conjugate.
[0054] In another preferred embodiment, the antibody portion is coupled to the coupling portion via a chemical bond or a linker.
[0055] In another preferred embodiment, the detectable marker is a chemical marker, a biological marker, or a combination thereof.
[0056] In another preferred embodiment, the chemical label is an isotope, an immunotoxin, and / or a chemical drug.
[0057] In another preferred embodiment, the biomarker is biotin, avidin, or an enzyme label.
[0058] In another preferred embodiment, the drug is a small molecule drug, a biological factor, an oligonucleotide, or a combination thereof.
[0059] In another preferred embodiment, the oligonucleotide is an antisense oligonucleotide, small interfering RNA, microRNA, nucleic acid aptamer, or a combination thereof.
[0060] In another preferred embodiment, the drug is a cytotoxic drug (toxin).
[0061] In another preferred embodiment, the cytotoxic drug is selected from the group consisting of: anti-tubulin drugs (such as MMAF or MMAE), DNA minor groove binding agents, DNA replication inhibitors, alkylating agents, antibiotics, folic acid antagonists, antimetabolites, chemosensitizers, topoisomerase inhibitors, vinca alkaloids, or combinations thereof.
[0062] In another preferred embodiment, the coupling portion is a detectable marker.
[0063] In another preferred embodiment, the detectable marker includes a radionuclide, wherein the radionuclide comprises:
[0064] (i) a detection isotope selected from the group consisting of: Tc-99m, Ga-68, F-18, I-123, I-125, I-131, In-111, Ga-67, Cu-64, Zr-89, C-11, Lu-177, Re-188, or combinations thereof; and / or
[0065] (ii) Therapeutic isotopes, wherein the therapeutic isotopes are selected from the group consisting of: Lu-177, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au-198, Ho-166, I-125, I-131, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177, or combinations thereof.
[0066] In another preferred embodiment, the conjugate is selected from: fluorescent or luminescent markers, radiolabels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes, radionuclides, biotoxins, cytokines (such as IL-2), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorobars, viral particles, viral capsid proteins (VLPs), liposomes, magnetic nanoparticles, prodrug-activating enzymes (e.g., DT-cardiacinoflavin (DTD) or biphenyl hydrolase-like protein (BPHL)), chemotherapeutic agents (e.g., cisplatin), or any form of nanoparticles.
[0067] In another preferred embodiment, the immunoconjugate has the following molecular formula:
[0068]
[0069] in:
[0070] nAb is a single-domain antibody against BCMA as described in the first aspect of the present invention;
[0071] LU represents a chemical bond or linker;
[0072] D is the coupling part;
[0073] p is the average number of conjugated portions in the immunoconjugate, and p is a value selected from 1 to 10.
[0074] In an eighth aspect of the invention, a recombinant protein is provided, said recombinant protein having:
[0075] (i) The sequence of the VHH chain of a single-domain antibody as described in the first aspect of the present invention;
[0076] (ii) Optional Fc segment; and
[0077] (ii) Optional tag sequences to assist in expression and / or purification.
[0078] In another preferred embodiment, the tag sequence includes Fc tag, HA tag, GGGS sequence, FLAG tag, Myc tag, 6His tag, or a combination thereof.
[0079] In another preferred embodiment, the recombinant protein specifically binds to the BCMA protein.
[0080] In another preferred embodiment, the recombinant protein is a monomer, a dimer, or a polymer.
[0081] In a ninth aspect of the invention, a multimeric protein complex based on a mutually compatible nucleic acid backbone is provided, the complex being a multimer formed by the aggregation of n monomers having mutually compatible nucleic acid backbones, wherein the n monomers are composed of the following:
[0082] (i) At least one targeting module containing a single-domain antibody against BCMA, which consists of a single-domain antibody against BCMA as described in the first aspect of the invention and a single strand of nucleic acid linked thereto;
[0083] (ii) Optional no or one or more other targeting modules, which consist of a targeting molecule and a single strand of nucleic acid linked thereto;
[0084] (iii) Optional no or one or more pharmacological modules, which consist of a pharmacological molecule and a single strand of nucleic acid linked thereto;
[0085] (iv) Optional monomers with one or more backbones, which are composed of single strands of nucleic acids;
[0086] Where n is a positive integer from 2 to 8, each single strand of nucleic acid from a monomer forms a double strand with the single strands of nucleic acid from 1, 2 or 3 other monomers through base complementarity, thereby forming a complementary nucleic acid backbone structure.
[0087] In another preferred embodiment, the targeting module containing the anti-BCMA single-domain antibody has a structure of formula IIa or IIb:
[0088] A–W(IIa); WA(IIb)
[0089] The pharmacodynamic module described herein has a structure of formula IIIa or IIIb:
[0090] D–W(IIIa); WD(IIIb)
[0091] The other targeting modules described have a structure of form IVa or IVb:
[0092] T–W (IVa); WT (IVb)
[0093] In the formula,
[0094] A is a single-domain antibody against BCMA as described in the first aspect of the present invention;
[0095] W represents a single-stranded nucleic acid;
[0096] D represents the pharmacologically active molecule;
[0097] T represents other targeted molecules;
[0098] Each "-" represents a connector or key independently.
[0099] In another preferred embodiment, "-" represents a covalent bond, a linker, or a combination of both.
[0100] In another preferred embodiment, in the polymer, each element D in each pharmacological module is independently selected from the group consisting of: cytotoxic small molecules, polypeptide toxins (such as MMAF, MMAE), oligonucleotide molecules that regulate gene expression, or combinations thereof.
[0101] In another preferred embodiment, the nucleic acid single strand is degradation-resistant.
[0102] In another preferred embodiment, the nucleic acid single strand is selected from the group consisting of: L-type nucleic acid, peptide nucleic acid, locked nucleic acid, morpholine phosphate nucleic acid, L-morpholine phosphate nucleic acid, thio-modified nucleic acid, 2'-fluoro-modified nucleic acid, 5-hydroxymethylcytosine nucleic acid, or combinations thereof, preferably, the nucleic acid single strand is morpholine phosphate nucleic acid.
[0103] In another preferred embodiment, in the polymer, the element D in each pharmacological module is the same or different.
[0104] In another preferred embodiment, in the polymer, each element T in each targeting module is independently selected from the group consisting of antibodies, natural ligands, targeting small molecules, or combinations thereof.
[0105] In another preferred embodiment, the T is a single-domain antibody.
[0106] In another preferred embodiment, the W of each monomer in the polymer is different.
[0107] In another preferred embodiment, the nucleotides at both ends and / or in the middle of W are chemically modified to link the pharmacological molecule D, the targeting molecule T, or a single-domain antibody against BCMA.
[0108] In a tenth aspect of the present invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising:
[0109] (i) a single-domain antibody against BCMA as described in the first aspect of the present invention, or a fusion protein as described in the second aspect of the present invention, or an immunoconjugate as described in the seventh aspect of the present invention, or a recombinant protein as described in the eighth aspect of the present invention, or a multimeric protein complex as described in the ninth aspect of the present invention, or a combination thereof; and
[0110] (ii) Pharmaceutically acceptable carriers.
[0111] In another preferred embodiment, the pharmaceutical composition is an injectable dosage form.
[0112] In another preferred embodiment, the pharmaceutical composition is used to prepare a medicament for treating BCMA-positive diseases.
[0113] In another preferred embodiment, the pharmaceutical composition is used to prepare a medicament for treating diseases with high BCMA expression.
[0114] In another preferred embodiment, the disease includes cancer or tumor.
[0115] In another preferred embodiment, the disease is selected from the group consisting of: multiple myeloma, relapsed multiple myeloma, acute lymphoblastic leukemia, immunoglobulin light chain amyloidosis, non-Hodgkin's lymphoma, systemic lupus erythematosus, paraproteinemia, or combinations thereof.
[0116] In another preferred embodiment, the pharmaceutical composition further contains other drugs for treating diseases with high BCMA expression.
[0117] In another preferred embodiment, the other drugs for treating diseases with high BCMA expression are selected from the group consisting of: γ-secretase inhibitors, chemotherapeutic drugs, bortezomib, dexamethasone, or combinations thereof.
[0118] In an eleventh aspect of the present invention, a use of an active ingredient is provided, said active ingredient being selected from the group consisting of: a single-domain antibody against BCMA as described in the first aspect of the present invention, or a fusion protein as described in the second aspect of the present invention, or an immunoconjugate as described in the seventh aspect of the present invention, or a recombinant protein as described in the eighth aspect of the present invention, or a multimeric protein complex as described in the ninth aspect of the present invention, or a pharmaceutical composition as described in the tenth aspect of the present invention, or a combination thereof, wherein said active ingredient is used for:
[0119] (a) Preparation of detection reagents, detection plates or kits; and / or
[0120] (b) To prepare medicines for the prevention and / or treatment of diseases.
[0121] In another preferred embodiment, the disease is a BCMA-positive disease.
[0122] In another preferred embodiment, the disease is one in which BCMA is highly expressed.
[0123] In another preferred embodiment, the disease includes cancer or tumor.
[0124] In another preferred embodiment, the disease is selected from the group consisting of: multiple myeloma, relapsed multiple myeloma, acute lymphoblastic leukemia, immunoglobulin light chain amyloidosis, non-Hodgkin's lymphoma, systemic lupus erythematosus, paraproteinemia, or combinations thereof.
[0125] In another preferred embodiment, the detection reagent, detection plate, or kit is used for:
[0126] (1) Detect BCMA protein in the sample; and / or
[0127] (2) Detect cells expressing BCMA protein.
[0128] In another preferred embodiment, the test reagent, test plate, or kit is used to diagnose BCMA-related diseases.
[0129] In another preferred embodiment, the detection includes flow cytometry and cell immunofluorescence detection.
[0130] In another preferred embodiment, the active ingredient is also used for one or more of the following purposes:
[0131] (i) Used to detect human BCMA molecules;
[0132] (ii) Used for flow cytometry detection;
[0133] (iii) Used for cell immunofluorescence detection;
[0134] (iv) Used to treat tumors;
[0135] (v) Used for tumor diagnosis.
[0136] In a twelfth aspect of the present invention, a method for detecting BCMA protein in a sample is provided, the method comprising the steps of:
[0137] (1) Contact the sample with a single-domain antibody against BCMA as described in the first aspect of the present invention;
[0138] (2) Detecting whether an antigen-antibody complex is formed, wherein the formation of a complex indicates the presence of BCMA protein in the sample. In a thirteenth aspect of the invention, a BCMA protein detection reagent is provided, the detection reagent comprising:
[0139] (i) the anti-BCMA single-domain antibody according to the first aspect of the present invention, or the immunoconjugate according to the seventh aspect of the present invention, or the recombinant protein according to the eighth aspect of the present invention; and
[0140] (ii) A detectable carrier.
[0141] In another preferred embodiment, the coupling portion of the immunoconjugate is a detection isotope.
[0142] In another preferred embodiment, the detection-acceptable carrier is a non-toxic, inert aqueous carrier medium.
[0143] In another preferred embodiment, the detection reagent is one or more reagents selected from the group consisting of isotope tracers, contrast agents, flow cytometry reagents, cell immunofluorescence reagents, magnetic nanoparticles, and imaging agents.
[0144] In another preferred embodiment, the detection reagent is used for in vivo detection.
[0145] In another preferred embodiment, the test reagent is in liquid or powder form (such as aqueous solution, injection, lyophilized powder, tablet, lozenge, or inhaler).
[0146] In a fourteenth aspect of the invention, a BCMA protein detection kit is provided, the kit containing the immunoconjugate described in the seventh aspect of the invention or the detection reagent described in the thirteenth aspect of the invention, and an instruction manual.
[0147] In another preferred embodiment, the specification states that the kit is used for non-invasive detection of BCMA expression in a test subject.
[0148] In a fifteenth aspect of the invention, a method for treating a disease is provided, the method comprising administering to a desired subject a single-domain antibody against BCMA as described in the first aspect of the invention, or an immunoconjugate as described in the seventh aspect of the invention, or a recombinant protein as described in the eighth aspect of the invention, or a multimeric protein complex as described in the ninth aspect of the invention, or a pharmaceutical composition as described in the tenth aspect of the invention.
[0149] In another preferred embodiment, the object includes a human or a non-human mammal.
[0150] In another preferred embodiment, the non-human mammals include rodents (such as mice and rabbits) and non-human primates (such as monkeys).
[0151] In another preferred embodiment, the disease is a BCMA-positive disease.
[0152] In another preferred embodiment, the disease is one in which BCMA is highly expressed.
[0153] In another preferred embodiment, the disease is a tumor.
[0154] In another preferred embodiment, the disease is selected from the group consisting of: multiple myeloma, relapsed multiple myeloma, acute lymphoblastic leukemia, immunoglobulin light chain amyloidosis, non-Hodgkin's lymphoma, systemic lupus erythematosus, paraproteinemia, or combinations thereof.
[0155] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0156] Figure 1 The expression and purification of the anti-BCMA single-domain antibody are shown. Left: SDS-PAGE purity assessment; Right: Summary table of expression levels.
[0157] Figure 2 This demonstrates the ability of ELISA to detect the binding of anti-BCMA single-domain antibody to human BCMA antigen.
[0158] Figure 3 This demonstrates the ability of ELISA to detect the binding of anti-BCMA single-domain antibody to mouse BCMA antigen.
[0159] Figure 4 The results demonstrate the ability of ELISA to detect the binding of anti-BCMA single-domain antibody to rat BCMA antigen.
[0160] Figure 5The results demonstrate the ability of ELISA to detect the binding of anti-BCMA single-domain antibody to its family proteins BAFF-R and TACI.
[0161] Figure 6 This study demonstrates the ELISA assay for the blocking activity of the ligand hBAFF of the anti-BCMA single-domain antibody.
[0162] Figure 7 The results show the APRIL blocking activity assay for the anti-BCMA single-domain antibody detected by ELISA.
[0163] Figure 8 The binding ability of the anti-BCMA single-domain antibody to CHO-K1 cells with high hBCMA expression was demonstrated by flow cytometry.
[0164] Figure 9 A schematic diagram and SDS-PAGE electrophoresis image of the anti-BCMA single-domain antibody MMAF toxin conjugate are shown.
[0165] Figure 10 The study demonstrated the in vitro tumor cell killing effect of the anti-BCMA single-domain antibody-MMAF toxin conjugate. Detailed Implementation
[0166] Through extensive and in-depth research and numerous screenings, the inventors have developed, for the first time, a single-domain antibody targeting BCMA. This single-domain antibody exhibits cross-binding activity between humans and mice, specifically binding to human BCMA protein without binding to BCMA family members TACI and BAFF-R. Furthermore, it possesses blocking activity against ligands BAFF and APRI, effectively blocking the binding of BAFF and APRIL to BCMA. Based on this, the present invention was completed.
[0167] the term
[0168] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.
[0169] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0170] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.
[0171] As used herein, the term "pharmaceutically acceptable carrier" refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio.
[0172] As used herein, the term "therapeutic effective amount" refers to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals. Those skilled in the art will understand that the "therapeutic effective amount" can vary depending on the form of the pharmaceutical composition, the route of administration, the excipients used, the severity of the disease, and whether it is used in combination with other drugs.
[0173] BCMA
[0174] BCMA (B cell maturation antigen), also known as TNFRSF17 (TNF receptor superfamily member 17) or CD269, plays a major role in the maturation and differentiation of B cells into plasma cells.
[0175] BCMA consists of three main domains: an extracellular domain (1-54), a transmembrane domain (55-77), and an intracellular domain (78-184). BCMA, along with its family members TACI and BAFF-R, can bind to either BAFF or APRIAL ligands, respectively. BCMA is primarily expressed in plasma cells and mature B lymphocytes, with virtually no expression in other normal tissues. Related studies have shown that BCMA is the most selectively expressed receptor in multiple myeloma cell lines; therefore, BCMA is an ideal target for the treatment of multiple myeloma.
[0176] Anti-BCMA single-domain antibody
[0177] As used herein, the terms "anti-BCMA single-domain antibody of the present invention," "single-domain antibody of the present invention," "BCMA single-domain antibody of the present invention," "anti-BCMA nanobody of the present invention," "nanobody of the present invention," and "BCMA nanobody of the present invention" are used interchangeably and all refer to single-domain antibodies that specifically recognize and bind to BCMA. Particularly preferred are single-domain antibodies with VHH chain amino acid sequences as shown in any of SEQ ID NO: 8, 15, 21, 24, or 26.
[0178] As used herein, the terms "antibody" or "immunoglobulin" refer to isotetraglycoproteins of approximately 150,000 Daltons with identical structural features, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to the heavy chain by a covalent disulfide bond, although the number of disulfide bonds between heavy chains varies among different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable region (VH) at one end, followed by multiple constant regions. Each light chain has a variable region (VL) at one end and a constant region at the other; the constant regions of the light chains are opposite the first constant region of the heavy chains, and the variable regions of the light chains are opposite the variable regions of the heavy chains. Specific amino acid residues form interfaces between the variable regions of the light and heavy chains.
[0179] As used herein, the terms "single-domain antibody (VHH)" and "nanobody" have the same meaning: to clone the variable region of an antibody heavy chain to construct a single-domain antibody (VHH) consisting of only one heavy chain variable region. It is the smallest antigen-binding fragment with complete function. Typically, antibodies that are naturally missing the light chain and the heavy chain constant region 1 (CH1) are first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single-domain antibody (VHH) consisting of only one heavy chain variable region.
[0180] As used herein, the term "variable" refers to the fact that certain portions of the variable region of an antibody differ sequentially, contributing to the binding and specificity of various specific antibodies to their specific antigens. However, variability is not uniformly distributed throughout the entire variable region of an antibody. It is concentrated in three segments within the variable regions of the light and heavy chains, known as complementarity-determining regions (CDRs) or hypervariable regions. The more conserved portions of the variable region are called framework regions (FRs). The variable regions of the native heavy and light chains each contain four FRs, which are generally β-sheet configurations linked by three CDRs forming a linking loop, and in some cases, partially β-sheet structures. The CDRs in each chain are tightly packed together by the FR regions and, together with the CDRs of the other chain, form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pp. 647-669 (1991)). Constant regions do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cytotoxicity.
[0181] As those skilled in the art will recognize, immunoconjugates and fusion expression products include conjugates formed by binding drugs, toxins, cytokines, radionuclides, enzymes, and other diagnostic or therapeutic molecules to the antibodies or fragments thereof of the present invention. The present invention also includes cell surface markers or antigens that bind to the described anti-BCMA protein single-domain antibody or fragments thereof.
[0182] As used in this article, the terms "heavy chain variable region" and "V" are used interchangeably.H "They can be used interchangeably."
[0183] As used in this article, the terms “complementarity determining region” and “CDR” are used interchangeably.
[0184] In a preferred embodiment of the present invention, the heavy chain variable region of the antibody includes three complementarity-determining regions CDR1, CDR2, and CDR3.
[0185] In a preferred embodiment of the present invention, the heavy chain of the antibody includes the aforementioned heavy chain variable region and heavy chain constant region.
[0186] In this invention, the terms "antibody of the invention," "protein of the invention," or "peptide of the invention" are used interchangeably and all refer to peptides that specifically bind to BCMA proteins, such as proteins or peptides having a heavy chain variable region. They may or may not contain initiating methionine.
[0187] The present invention also provides other proteins or fusion expression products having the antibodies of the present invention. Specifically, the present invention includes any protein or protein conjugate and fusion expression product (e.g., immunoconjugate and fusion protein) having a heavy chain containing a variable region, provided that the variable region is the same as or at least 90% homologous to the heavy chain variable region of the antibody of the present invention, preferably at least 95% homologous.
[0188] This invention includes not only complete antibodies, but also fragments, derivatives and analogs of said antibodies.
[0189] As used herein, the terms “fragment,” “derivative,” and “analyte” refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having substituent groups in one or more amino acid residues; or (iii) polypeptides formed by fusing a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusing an additional amino acid sequence to this polypeptide sequence (e.g., a leader sequence or secretion sequence, or a sequence used to purify this polypeptide, or a proteogenic sequence, or a fusion protein formed with a 6His tag). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope well known to those skilled in the art.
[0190] The term "antibody of the present invention" refers to a polypeptide containing the aforementioned CDR region that has BCMA protein-binding activity. This term also includes variants of polypeptides containing the aforementioned CDR region that have the same function as the antibodies of the present invention. These variants include (but are not limited to): deletions, insertions, and / or substitutions of one or more amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10), and the addition of one or more amino acids (typically less than 20, preferably less than 10, more preferably less than 5) to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. Similarly, the addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein. This term also includes active fragments and active derivatives of the antibodies of the present invention.
[0191] The variant forms of the polypeptide include: homologous sequences, conserved variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low severity conditions, and polypeptides or proteins obtained using antiserum against the antibody of the present invention.
[0192] The present invention also provides other polypeptides, such as fusion proteins comprising a single-domain antibody or a fragment thereof. In addition to nearly full-length polypeptides, the present invention also includes fragments of the single-domain antibody of the present invention. Typically, the fragment has at least about 50 consecutive amino acids, preferably at least about 80 consecutive amino acids, and more preferably at least about 100 consecutive amino acids of the antibody of the present invention.
[0193] In this invention, "a conserved variant of the antibody of the present invention" refers to a polypeptide formed by replacing up to 10, preferably up to 8, more preferably up to 5, and most preferably up to 3 amino acids with amino acids of similar or analogous properties compared to the amino acid sequence of the antibody of the present invention. These conserved variant polypeptides are preferably generated by amino acid substitutions according to Table A.
[0194] Table A
[0195] The initial residues Representative substitution Preferred replacement Ala(A) Val; Leu; Ile Val Arg(R) Lys;Gln;Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg;Gln;Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu
[0196] The single-domain antibody of the present invention specifically binds to BCMA, but does not bind to TACI and BAFF-R, which are members of the BCMA family. In one embodiment, the single-domain antibody of the present invention exhibits cross-reactivity in human and monkey-derived BCMA.
[0197] Polynucleotides, vectors and host cells
[0198] The present invention also provides a polynucleotide molecule encoding the above-described antibody or a fragment thereof or a fusion protein thereof. The polynucleotide of the present invention may be in DNA or RNA form. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.
[0199] The polynucleotide encoding the mature polypeptide of the present invention includes: a coding sequence that encodes only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence.
[0200] The term "polynucleotide encoding a polypeptide" can refer to a polynucleotide that includes the polypeptide, or it can also include additional coding and / or non-coding sequences.
[0201] The term "vector" refers to a polynucleotide molecule capable of transporting another polynucleotide linked to it. One type of vector is the "plasmid," which is a circular double-stranded DNA loop in which an additional DNA segment can be attached. Another type of vector is a viral vector, in which the additional DNA segment can be attached to the viral genome. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and attachable mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can integrate into the host cell's genome after introduction into the host cell, thereby replicating along with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. Typically, expression vectors useful in recombinant DNA technologies are in the form of plasmids.
[0202] As used herein, the term "antigen" or "target antigen" refers to a molecule or part of a molecule that can be bound by an antibody or antibody-like binding protein. The term further refers to a molecule or part of a molecule that can be used in animals to produce an antibody capable of binding to an epitope of that antigen. A target antigen may have one or more epitopes. For each target antigen recognized by an antibody or by an antibody-like binding protein, the antibody-like binding protein can compete with the intact antibody that recognizes the target antigen.
[0203] As used herein, the term "linker" refers to one or more amino acid residues inserted into an immunoglobulin domain that provide sufficient mobility for both the light and heavy chain domains to fold into an exchangeable dual variable region immunoglobulin. Suitable examples of linkers include monoglycine (Gly) or serine (Ser) residues, and the identification and sequence of amino acid residues in the linker may vary depending on the type of secondary structural element to be achieved in the linker. Preferred linkers may be (GS)n, (G3S)n, or (G4S)n (n selected from 1-6).
[0204] As used herein, a “variant” of an antibody, antibody fragment, or antibody domain means that the antibody, antibody fragment, or antibody domain: (1) has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the original antibody, antibody fragment, or antibody domain, and (2) specifically binds to the same target that specifically binds to the original antibody, antibody fragment, or antibody domain. It should be understood that when sequence identity is expressed in the form of “at least x% identical” or “at least x% identity,” such embodiments include any and all numerical percentages equal to or higher than the lower limit. Furthermore, it should be understood that the presence of an amino acid sequence in this application should be interpreted as additional disclosure or inclusion of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with that amino acid sequence.
[0205] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.
[0206] The full-length nucleotide sequence or fragments of the antibody of the present invention can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis. One feasible method is to synthesize the relevant sequence artificially, especially when the fragment length is short. Typically, long fragments can be obtained by first synthesizing multiple small fragments and then ligating them. Furthermore, the coding sequence of the heavy chain and an expression tag (such as 6His) can be fused together to form a fusion protein.
[0207] Once the relevant sequence is obtained, it can be obtained in large quantities using recombination methods. This typically involves cloning it into a vector, transforming it into cells, and then isolating the sequence from the proliferated host cells using conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in this invention include biomolecules existing in isolated forms.
[0208] Currently, the DNA sequence encoding the protein of this invention (or a fragment thereof, or a derivative thereof) can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. Furthermore, mutations can be introduced into the protein sequence of this invention through chemical synthesis.
[0209] The present invention also relates to vectors comprising the aforementioned suitable DNA sequences and suitable promoters or control sequences. These vectors can be used to transform suitable host cells to enable them to express proteins.
[0210] The host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; and animal cells of CHO, COS7, and 293 cells.
[0211] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0212] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.
[0213] The recombinant peptides used in the methods described above can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant proteins can be separated and purified using various separation methods based on their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.
[0214] The antibodies of the present invention can be used alone or in combination or conjugated with detectable markers (for diagnostic purposes), therapeutic agents, PK (protein kinase) modified parts, or any combination of the above substances.
[0215] Detectable markers for diagnostic purposes include, but are not limited to: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing detectable products.
[0216] Therapeutic agents that can bind to or conjugate with the antibodies of the present invention include, but are not limited to: 1. radionuclides; 2. biotoxicants; 3. cytokines such as IL-2; 4. gold nanoparticles / nanorobars; 5. viral particles; 6. liposomes; 7. magnetic nanoparticles; 8. prodrug-activating enzymes (e.g., DT-cardiac flavinase (DTD) or biphenyl hydrolase-like protein (BPHL)); 10. chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, etc.
[0217] Immunoconjugates
[0218] The present invention also provides immunoconjugates based on the antibodies of the present invention, preferably nanobody-drug conjugates (NDCs).
[0219] Typically, the antibody-drug conjugate comprises an antibody and an effector molecule, wherein the antibody is conjugated to the effector molecule, preferably chemically conjugated. The effector molecule is preferably a drug with therapeutic activity. Furthermore, the effector molecule may be one or more of the following: a toxic protein, a chemotherapeutic drug, a small molecule drug, an agonist small molecule (STING, TLR7, TLR8, etc.), an oligonucleotide, or a radionuclide.
[0220] The antibody and the effector molecule of this invention can be coupled via a coupling agent. Examples of the coupling agent include any one or more of non-selective coupling agents, carboxyl-based coupling agents, peptide chains, and disulfide bonds. The non-selective coupling agent refers to a compound that covalently links the effector molecule and the antibody, such as glutaraldehyde. The carboxyl-based coupling agent can be any one or more of maleic aconitine-based coupling agents (e.g., maleic aconitine) and acylhydrazone-based coupling agents (with an acylhydrazone as the coupling site).
[0221] Certain residues on antibodies (such as Cys or Lys) are used to link to a variety of functional groups, including imaging reagents (e.g., chromophores and fluorophores), diagnostic reagents (e.g., MRI contrast agents and radioisotopes), stabilizers (e.g., ethylene glycol polymers), and therapeutic agents. Antibodies can be conjugated to functional agents to form antibody-functional agent conjugates. Functional agents (e.g., drugs, detection reagents, stabilizers) are conjugated (covalently linked) to antibodies. Functional agents can be directly attached to antibodies or indirectly through linkers.
[0222] Single-domain antibodies can be conjugated to drugs to form single-domain antibody-drug conjugates (NDCs). Typically, an NDC contains a linker between the drug and the antibody. The linker can be degradable or non-degradable. Degradable linkers are typically readily degraded in intracellular environments, such as at the target site, thereby releasing the drug from the antibody. Suitable degradable linkers include, for example, enzyme-degradable linkers, including peptide-containing linkers that can be degraded by intracellular proteases (e.g., lysosomal proteases or endosomal proteases), or sugar linkers, such as glucuronidase-containing linkers. Peptide linkers can include, for example, dipeptides, such as valine-citrulline, phenylalanine-lysine, or valine-alanine. Other suitable degradable linkers include, for example, pH-sensitive linkers (e.g., linkers that hydrolyze at pH less than 5.5, such as hydrazone linkers) and linkers that degrade under reducing conditions (e.g., disulfide linkers). Non-degradable linkers typically release the drug under conditions where the antibody is hydrolyzed by proteases.
[0223] Prior to attachment to the antibody, the linker has a reactive group capable of reacting with certain amino acid residues, and the attachment is achieved through the reactive group. Thiol-specific reactive groups are preferred and include, for example, maleimide compounds, haloamides (e.g., iodinated, brominated, or chlorinated); haloesters (e.g., iodinated, brominated, or chlorinated); halomethyl ketones (e.g., iodinated, brominated, or chlorinated); benzyl halides (e.g., iodinated, brominated, or chlorinated); vinyl sulfones; pyridyl disulfides; mercury derivatives such as 3,6-di-(mercurymethyl)dioxane, with the counter ion being acetate, chloride, or nitrate; and polymethylene dimethyl sulfide thiosulfonate. The linker may include, for example, a polyethylene glycol-modified SMCC crosslinking agent (SM(PEG)2), or a maleimide attached to the antibody via a thiosuccinimide.
[0224] The drug can be any cytotoxic, cell growth-inhibiting, or immunosuppressive drug. In one embodiment, the linker connects the antibody and the drug, and the drug has a functional group that can bond with the linker. For example, the drug may have an amino, carboxyl, thiol, hydroxyl, or ketone group that can bond with the linker. In the case where the drug is directly linked to the linker, the drug has a reactive group before being linked to the antibody.
[0225] Useful drug classes include, for example, anti-tubulin drugs, DNA minor groove binding agents, DNA replication inhibitors, alkylating agents, antibiotics, folic acid antagonists, antimetabolites, chemotherapy sensitizers, topoisomerase inhibitors, and vinca alkaloids. Examples of particularly useful cytotoxic drugs include, for example, DNA minor groove binding agents, DNA alkylating agents, and tubulin inhibitors. Typical cytotoxic drugs include, for example, auristatins, camptothecins, duocarmycins, etoposides, maytansines and maytansinoids (e.g., DM1 and DM4), taxanes, benzodiazepines or benzodiazepine-containing drugs (e.g., pyrrolo[1,4]benzodiazepines (PBDs), indolinobenzodiazepines and oxazolidinobenzodiazepines) and vinca alkaloids.
[0226] The immunoconjugated drug of the present invention can also be a radionuclide conjugated drug (RDC), which is composed of the antibody of the present invention conjugated with a radionuclide.
[0227] The immunoconjugated drug of the present invention can also be an antibody-oligonucleotide conjugate (AOC), which is composed of a single-domain antibody of the present invention conjugated with a therapeutic oligonucleotide. Oligonucleotides that can be used in the AOC of the present invention include, but are not limited to, antisense oligonucleotides, small interfering RNA, microRNAs, and nucleic acid aptamers.
[0228] In this invention, the drug-linker can be used to form NDC in a simple step. In other embodiments, bifunctional linker compounds can be used to form NDC in a two- or multi-step process. For example, cysteine residues react with the reactive portion of the linker in a first step, and in a subsequent step, the functional groups on the linker react with the drug to form NDC.
[0229] Typically, functional groups on the linker are selected to facilitate specific reaction with suitable reactive groups on the drug moiety. As a non-limiting example, azide-based moieties can be used to specifically react with reactive alkynyl groups on the drug moiety. The drug is covalently bound to the linker via a 1,3-dipolar cycloaddition between the azide and alkynyl groups. Other useful functional groups include, for example, ketones and aldehydes (suitable for reaction with hydrazides and alkoxyamines), phosphine (suitable for reaction with azides); isocyanates and isothiocyanates (suitable for reaction with amines and alcohols); and activated esters, such as N-hydroxysuccinimide esters (suitable for reaction with amines and alcohols). These and other linking strategies, such as those described in Bioconjugation Techniques, Second Edition (Elsevier), are well known to those skilled in the art. Those skilled in the art will understand that for selective reaction between the drug moiety and the linker, when a complementary pair of reactive functional groups is selected, each member of that complementary pair can be used for either the linker or the drug.
[0230] The present invention also provides a method for preparing NDC, which may further include: binding an antibody to a drug-adaptor compound under conditions sufficient to form an antibody-drug conjugate (NDC).
[0231] In some embodiments, the method of the present invention includes binding an antibody to a bifunctional adapter compound under conditions sufficient to form an antibody-adaptor conjugate. In these embodiments, the method of the present invention further includes binding the antibody-adaptor conjugate to a drug moiety under conditions sufficient to covalently link a drug moiety to the antibody via the adapter.
[0232] In some embodiments, the structure of the immunoconjugate, preferably a single-domain antibody-drug conjugate NDC, is shown in the following molecular formula:
[0233]
[0234] in:
[0235] nAb refers to the aforementioned single-domain antibodies targeting SA, heavy-chain antibodies targeting SA, or multispecific antibodies.
[0236] LU stands for connector / connector;
[0237] D is the coupling part;
[0238] And the subscript p is a value selected from 1 to 10.
[0239] Multimeric protein complexes based on intermatched nucleic acid backbones
[0240] The single-domain antibody of the present invention can also be linked to drug molecules via an intermatched nucleic acid backbone, thereby improving the overall molecular stability and multispecificity. Therefore, the present invention also provides a multimeric protein complex based on an intermatched nucleic acid backbone. The multimeric protein complex of the present invention comprises at least one targeting module, at least one pharmacological module, and optionally a backbone monomer. The targeting module comprises a targeting molecule and a single-chain nucleic acid linked thereto. For example, the targeting module of the present invention comprises the anti-BCMA single-domain antibody of the present invention and a single-chain nucleic acid linked thereto, or comprises a single-domain antibody containing the anti-BCMA single-domain antibody of the present invention and a single-chain nucleic acid linked thereto. The pharmacological module comprises a pharmacological molecule (e.g., a protein drug, toxin, oligonucleotide) and a single-chain nucleic acid linked thereto.
[0241] The nucleic acid chains in the multimeric protein complexes of this invention are biodegradable and do not elicit a strong innate immune response. Typically, the single-chain nucleic acids include, but are not limited to, L-type nucleic acids, peptide nucleic acids, locked nucleic acids, morpholine phosphate nucleic acids, L-morpholine phosphate nucleic acids, thio-modified nucleic acids, 2'-fluoro-modified nucleic acids, and 5-hydroxymethylcytosine nucleic acids.
[0242] Pharmacodynamic molecules can be any drug that has cytotoxic, cell growth-inhibiting, or immunosuppressive properties. Examples include small molecule toxins, protein drugs, and oligonucleotide drugs.
[0243] The targeting molecule can be any targeting antibody, ligand, or small molecule that specifically binds to the target. The targeting antibody can be a monoclonal antibody or its antigen-binding fragment. In one embodiment, the targeting antibody can be a single-domain antibody targeting BCMA, for example, having the sequence shown in any of SEQ ID NO: 8, 15, 21, 24, or 26. The ligand can be a natural ligand or its targeting variant.
[0244] In this invention, a dual-linker molecule (such as SMCC) can be used to bridge nucleic acid single-strands and proteins in a multimeric protein complex. The nucleic acid single strand may contain active groups modified at the 5' or 3' end to facilitate subsequent linker coupling. The linker generally possesses a bifunctional group, i.e., one end can couple to the active group of the nucleic acid, and the other end can connect to a specific site (such as NH2, SH) on the protein. In one embodiment, all nucleic acid single strands constituting the interpaired nucleic acid backbone have an NH2 modification added to their 5' end. Anti-BCMA single-domain antibodies and / or protein drugs may introduce amino acid mutations to facilitate coupling with the linker. In one embodiment, anti-BCMA single-domain antibodies and / or protein drugs may introduce cysteine mutations at the N-terminus or C-terminus.
[0245] In a preferred embodiment of the present invention, the multimeric protein complex comprises four morpholine phosphate oligonucleotides with different sequences, which can precisely self-assemble into a stable tetrameric nucleic acid backbone.
[0246] Pharmaceutical Composition
[0247] The present invention also provides a composition. Preferably, the composition is a pharmaceutical composition containing the aforementioned antibody or its active fragment or fusion protein, and a pharmaceutically acceptable carrier. Typically, these substances are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH may vary depending on the nature of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered via conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or local administration.
[0248] The pharmaceutical compositions of the present invention may contain any antitumor drug (such as an antitumor antibody) linked to the anti-BCMA single-domain antibody of the present invention, and thus may be used to treat tumors. Furthermore, other therapeutic agents may be used simultaneously.
[0249] The pharmaceutical compositions of the present invention contain a safe and effective amount (e.g., 0.001-99 wt%, preferably 0.01-90 wt%, more preferably 0.1-80 wt%) of the above-described single-domain antibody (or conjugate thereof) of the present invention, and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical formulation should be matched to the route of administration. The pharmaceutical compositions of the present invention can be formulated into injectable forms, for example, prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other excipients. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 micrograms / kg body weight to about 50 milligrams / kg body weight per day. Furthermore, the peptides of the present invention can also be used with other therapeutic agents.
[0250] When using a pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to mammals. This safe and effective amount is typically at least about 10 micrograms per kilogram of body weight, and in most cases does not exceed about 50 milligrams per kilogram of body weight. Preferably, the dose is between about 10 micrograms per kilogram of body weight and about 10 milligrams per kilogram of body weight. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of a skilled physician's expertise.
[0251] Labeled single-domain antibodies
[0252] In a preferred embodiment of the invention, the single-domain antibody carries a detectable marker. More preferably, the marker is selected from the group consisting of isotopes, colloidal gold markers, colored markers, or fluorescent markers.
[0253] Colloidal gold labeling can be performed using methods known to those skilled in the art. In a preferred embodiment of the invention, a single-domain antibody against BCMA is labeled with colloidal gold to obtain a colloidal gold-labeled single-domain antibody.
[0254] Detection methods
[0255] The present invention also relates to a method for detecting BCMA protein. The method comprises the following steps: obtaining cell and / or tissue samples; dissolving the samples in a medium; and detecting the level of BCMA protein in the dissolved samples.
[0256] In the detection method of the present invention, there are no particular limitations on the samples used; a representative example is a cell-containing sample present in a cell preservation solution.
[0257] Reagent test kit
[0258] The present invention also provides a kit containing the antibody (or fragment thereof) of the present invention or a detection plate. In a preferred embodiment of the present invention, the kit further includes a container, instructions for use, buffer, etc.
[0259] This invention also provides a detection kit for detecting BCMA levels, comprising an antibody that recognizes the BCMA protein, a lysis medium for dissolving samples, and universal reagents and buffers required for detection, such as various buffers, detection labels, and detection substrates. This detection kit can be used as an in vitro diagnostic device.
[0260] application
[0261] As described above, the single-domain antibody of the present invention or the multispecific fusion antibody containing the single-domain antibody of the present invention has broad biological and clinical application value, and its applications involve multiple fields such as the diagnosis and treatment of BCMA-related diseases, basic medical research, and biological research. A preferred application is for the clinical diagnosis and targeted therapy of BCMA.
[0262] The main advantages of this invention include:
[0263] (a) The antibody of the present invention has a strong binding affinity for BCMA and specifically binds to human and mouse BCMA.
[0264] (b) The single-domain antibody of the present invention can specifically bind to human BCMA protein, but does not bind to TACI and BAFF-R, which are members of the same BCMA family.
[0265] (c) The single-domain antibody of the present invention can effectively block the binding of ligands BAFF and APRIL to BCMA.
[0266] (d) The single-domain antibody of the present invention has receptor-dependent endocytic activity.
[0267] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.
[0268] Example 1: Production of anti-BCMA single-domain antibodies induced by immunization of alpacas and detection of serum titer
[0269] For the initial immunization, 0.5 mg of human BCMA antigen (ACRO, Cat#BC7-H5254) was mixed with an equal volume of complete Freund's adjuvant (CFA) and subcutaneously injected into two healthy alpacas to stimulate their immune systems to produce corresponding anti-BCMA antibodies. For the second booster immunization, 0.25 mg of human BCMA antigen was mixed with an equal volume of incomplete Freund's adjuvant (IFA) and subcutaneously injected into alpacas 20 days after the first immunization. Subsequent booster immunizations were administered 20 days later, with the same antigen dosage and adjuvant as the second immunization. Serum titers of the target antibodies were measured before immunization, and one week after the second, third, and fourth immunizations.
[0270] Serum titers were determined by coating and immobilizing human BCMA antigen protein (ACRO, Cat#BCA-H522y) onto an ELISA plate, and then detecting the titers of the corresponding antibodies using HRP-labeled goat anti-alpaca secondary antibody. The results of the four-immune serum antibody titers are shown in Table 1.
[0271] Table 1 - Serum titer tests from four immunizations
[0272]
[0273] Serum titer assays showed that after four rounds of immunization with human BCMA antigen, alpaca blood produced high-titer anti-human BCMA antibodies. The alpaca serum antibody titers met expectations, and the peripheral blood from the four immunizations can be used for antibody library construction.
[0274] Example 2: Construction and screening of anti-BCMA single-domain antibody phage library
[0275] Peripheral blood mononuclear cells (PBMCs) were isolated from 50 ml of alpaca peripheral blood after four immunizations, and total RNA was extracted using RNAiso Plus reagent. PrimeScript was used to extract the RNA. TMII. The 1st Strand cDNA Synthesis Kit (Takara, Cat#6210A) was used to reverse transcribe 5 μg of total RNA into cDNA, following the kit instructions. Using the cDNA as a template, 5 μl of a 5-fold diluted cDNA was used for the first round of nested PCR. A 750 bp fragment of the PCR product was gel-returned as the template for the second round of nested PCR. After two rounds of nested PCR amplification, a single-domain antibody fragment was obtained. The PCR product was purified using the Cycle-Puer Kit and used to construct a phage display library. Based on the number of transformants, insertion rate, and diversity sequencing analysis, the size of the anti-BCMA single-domain antibody phage library constructed from peripheral blood of two alpacas was determined to be 1.92 x 10⁻⁶. 9 .
[0276] Using a direct coating method with BCMA antigen, 480 monoclonal antibodies were selected after three rounds of affinity panning to verify BCMA antigen binding, resulting in 404 positive clones. Sequencing analysis of these positive clones revealed five unique sequences based on different CDR sequences (Table 2), involving three CDR1 sequences, three CDR2 sequences, and three CDR3 sequences (Table 3).
[0277] Table 2
[0278]
[0279]
[0280] Table 3. Human BCMA antigen-binding positive CDR sequences
[0281]
[0282] Example 3 Construction of yeast strain expressing anti-BCMA single-domain antibody and protein preparation
[0283] A 6*his tag was added to the N-terminus of the anti-BCMA single-domain antibody, and a "GSC" tripeptide was added to the C-terminus. The codons of the above gene sequence were optimized and constructed into the pPICZ alpha A plasmid, which was then linearized using PemI enzyme. 5 μL of the linearized plasmid was added to 100 μL of competent cells, and the plasmid carrying the target gene was transformed into X33 Pichia pastoris cells using an electroporator (Biorad, MicroPulser) with the following parameters: 1.5 kV, 4 ms. After electroporation, the Pichia pastoris cells were revitalized using a mixed medium (YPD:Sorbitol = 1:1). Then, 50 μL of Pichia pastoris cells were plated on YPD solid medium containing 200, 400, 600, and 800 μg / mL zeocin (Invitrogen, Cat#R25001), respectively. High-copy strains of the target gene were obtained through zeocin concentration gradient selection.
[0284] Single-clone screening was performed by culturing single-clone strains in BMGY medium (Sangon, Cat#B540130) at 30℃ and 250 rpm. After obtaining sufficient bacterial cells, the target single-domain antibody was induced to be secreted and expressed in BMMY medium (Sangon, Cat#B540131) at 20℃ and 250 rpm. After 24 hours, 20 μL of supernatant was collected, and the expression level of each colony was analyzed by gel electrophoresis. The strain with the highest expression level was selected for preservation and protein expression production.
[0285] The protein expression and purification methods are as follows: 400 μL of bacterial culture was inoculated into 200 mL of BMGY medium and cultured at 30°C and 250 rpm for 3 days for enrichment. Then, 80 mL of BMMY medium was used to induce expression, with 1% methanol added every 24 hours. The target single-domain antibody was induced to secrete for 3 days at 20°C and 250 rpm. After induction, the supernatant was collected by centrifugation at 12000 rpm for 15 min using a high-speed refrigerated centrifuge. The protein was then purified using nickel affinity chromatography (Cytiva, Cat#17092108). Before use, the nickel affinity chromatography column was equilibrated with binding buffer. The supernatant containing the target protein was then passed through the column, allowing the histagged protein to bind to nickel ions and remain on the column. Non-specifically bound proteins were then washed away with buffer containing 20 mM imidazole. Finally, the target protein was eluted with elution buffer containing 250 mM imidazole.
[0286] SDS-PAGE gel images showed that the purity of single-domain antibodies in the protein expression supernatant was greater than 95%. Figure 1 ).
[0287] Example 4: Analysis of the binding activity of anti-BCMA single-domain antibody with human, mouse, and rat BCMA recombinant protein. Human BCMA-His (ACRO, Cat#BCA-H522y) antigen solution, mouse BCMA-His (KACTUS, Cat#BCM-MM417) antigen solution, and rat BCMA-His (ACRO, Cat#BCA-R52H3) antigen solution were prepared with PBS to a final concentration of 1 μg / mL. 100 μl / well was added to a 96-well ELISA plate and coated overnight at 4°C.
[0288] Wash three times with PBST (PBS + 0.05% Tween 20), add 200 μL / well of blocking buffer (PBST + 3% BSA), and incubate at room temperature for 1 hour. Wash once with PBST, add 100 μL / well of serially diluted single-domain antibody solution, and incubate at room temperature for 1 hour. Wash three times with PBST, add 100 μL / well of 1:5000 diluted horseradish peroxidase-labeled rabbit anti-camel VHH antibody (Genscript, Cat#A02016) solution, and incubate at room temperature for 1 hour. Wash three times with PBST, blot dry, add 100 μL / well of chromogenic substrate TMB solution (Beyotime, Cat#P0209), and incubate at room temperature for 5 to 30 minutes. Then add 100 μL / well of chromogenic stop solution (Beyotime, Cat#P0215).
[0289] The absorbance at 450 nm in each well was measured using a Molecular Devices (SpectraMax i3x) microplate reader. The binding EC50 values were calculated by fitting an S-curve with a 4-parameter equation using GraphPad Prism 10 software (Table 4).
[0290] Table 4. Binding of recombinant BCMA protein to EC in humans, mice, and rats. 50 Summary
[0291]
[0292] Experimental results showed that all five candidate antibodies possessed strong human BCMA binding activity, and BCMA-100 and BCMA-152 exhibited cross-species binding activity in mice and rats. Figure 2-4 ).
[0293] Example 5: The anti-BCMA single-domain antibody does not bind to TACI and BAFF-R, members of the BCMA family of proteins.
[0294] Prepare human BCMA-His (ACRO, Cat#BCA-H522y) antigen solution, human BAFF-R (ACRO, Cat#BAR-H52H3) antigen solution, and human TACI (ACRO, Cat#TAI-H52H3) antigen solution with PBS to a final concentration of 1 μg / mL. Add 100 μL / well to each well of a 96-well microplate and incubate overnight at 4°C.
[0295] Wash three times with PBST (PBS + 0.05% Tween 20), add 200 μL / well of blocking buffer (PBST + 3% BSA), and incubate at room temperature for 1 hour. Wash once with PBST, add 100 μL / well of 300 nM single-domain antibody solution, and incubate at room temperature for 1 hour. Wash three times with PBST, add 100 μL / well of 1:5000 diluted horseradish peroxidase-labeled rabbit anti-camel VHH antibody (Genscript, Cat#A02016) solution, and incubate at room temperature for 1 hour. Wash three times with PBST, blot dry, add 100 μL / well of chromogenic substrate TMB solution (Beyotime, Cat#P0209), and incubate at room temperature for 5 to 30 minutes, then add 100 μL / well of chromogenic stop solution (Beyotime, Cat#P0215).
[0296] The absorbance at 450 nm in each well was measured using a Molecular Devices (SpectraMax i3x) microplate reader. A bar chart was plotted using GraphPad Prism 10 software. Figure 5 ).
[0297] Experimental results show that the candidate antibody specifically binds to human BCMA protein, but does not bind to its family members TACI and BAFF-R.
[0298] Example 6: Anti-BCMA single-domain antibody blocks the binding of ligands BAFF and APRIL to BCMA.
[0299] Prepare human BCMA-His (ACRO, Cat#BCA-H522y) antigen solutions with PBS to a final concentration of 1 μg / mL. Add 100 μL / well to each well of a 96-well microplate and incubate overnight at 4°C.
[0300] Wash three times with PBST (PBS + 0.05% Tween 20), add 200 μL / well of blocking buffer (PBST + 3% BSA), and incubate at room temperature for 1 hour. Wash once with PBST, add 50 μL / well of serially diluted single-domain antibody solution, and incubate at room temperature for 0.5 hours. Then add 50 μL / well of flag-tagged trimeric human BAFF solution (1.6 μg / mL) or 50 μL / well of flag-tagged trimeric human APRIL solution (1.0 μg / mL). Wash three times with PBST, add 100 μL / well of 1:5000 diluted horseradish peroxidase-labeled mouse anti-flag tag antibody (Genscript, Cat#A01428) solution, and incubate at room temperature for 1 hour. Wash three times with PBST, blot dry, add 100 μL / well of TMB substrate solution (Beyotime, Cat#P0209), and incubate at room temperature for 5 to 30 minutes. Then add 100 μL / well of stop solution (Beyotime, Cat#P0215).
[0301] The absorbance at 450 nm in each well was measured using a Molecular Devices (SpectraMax i3x) microplate reader. The binding of EC was calculated using a 4-parameter equation fitted to an S-curve in GraphPad Prism 10 software. 50 value( Figure 6-7 ).
[0302] The formula for calculating ligand blocking activity is: % Inhibition rate = 100 * (1 - (450 absorbance value of test well - 450 absorbance value of secondary antibody control) / (450 absorbance value of well without test antibody - 450 absorbance value of secondary antibody control)).
[0303] Experimental results showed that all candidate antibodies possessed blocking activity against ligands BAFF and APRI.
[0304] Example 7: Binding activity analysis of anti-BCMA single-domain antibody with human BCMA-overexpressing cells
[0305] hBCMACHO-K1 cells were obtained by stable transfection of CHO-K1 cells with the pIRES-Neo3 vector expressing the human BCMA gene (NM_001192.3). Cells in the logarithmic growth phase were collected, washed with flow cytometry buffer (PBS + 2% FBS), and the cell density was adjusted to 1 × 10⁻⁶ cells / year. 6Add 180 μL / well of cell suspension to a 96-well U-shaped plate. Dilute the test sample stock solution with flow cytometry buffer to prepare serially diluted 10* concentration antibody solutions. Add 20 μL of the above solution to the cell suspension in the 96-well plate, vortex to mix, and incubate the 96-well plate at 4°C for 30 minutes. Centrifuge at 1000 rpm for 5 minutes at 4°C, discard the supernatant, wash the cells twice with flow cytometry buffer, add 200 μL / well of 1:1000 diluted iFluor647-labeled rabbit anti-camel VHH antibody (Genscript, Cat#A02019) solution, vortex to mix, and incubate the 96-well plate at 4°C for 30 minutes. Centrifuge at 1000 rpm for 5 minutes at 4°C, discard the supernatant, wash the cells twice with flow cytometry buffer, and resuspend the cells in 200 μL / well of flow cytometry buffer.
[0306] The mean fluorescence intensity of each sample was determined using flow cytometry (BD, FACSCelesta). The binding of EC was calculated using sigmoid curves and 4-parameter equations fitted with GraphPad Prism 10 software. 50 value( Figure 8 ).
[0307] Experimental results showed that all candidate antibodies could bind to hBCMA expressed on the cell surface.
[0308] Example 8: Nucleic acid-mediated self-assembly of anti-BCMA single-domain antibody and MMAF
[0309] The purified C-terminal "GSC" tripeptides BCMA-114 and BCMA-152 from Example 3 were reduced, exposing the thiol group of the C-terminal cysteine of the reduced anti-BCMA single-domain antibody. Subsequently, it was coupled with maleimide-modified L-DNA3 and purified to obtain BCMA-114-L-DNA3 / BCMA-152-L-DNA3.
[0310] "vc-PAB-MMAF" was modified at the 5' and 3' ends of L-DNA1 and L-DNA2 respectively, and then purified to obtain MMAF-L-DNA1-MMAF / MMAF-L-DNA2-MMAF.
[0311] Finally, the nucleic acid assembly modules of the conjugated single-domain antibody and the conjugated toxin were mixed in a molar ratio of 1:1:1:1, and self-assembled to obtain the anti-BCMA single-domain antibody-MMAF toxin conjugate. A schematic diagram of the conjugate and SDS-PAGE electrophoresis gel images are shown below. Figure 9 .
[0312] The L-DNA nucleic acid sequence is as follows:
[0313] L-DNA1: 5'AGGCGATCACAATCCAAATGAGCGTGTTACGG 3' (SEQ ID NO: 27);
[0314] L-DNA2: 5'ACCGTAACACGCTCAAAACCGAAGTGCCAATT 3' (SEQ ID NO: 28);
[0315] L-DNA3: 5'AAATTGGCACTTCGGAAAACTATGCGGCTGCT 3' (SEQ ID NO: 29);
[0316] L-DNA4: 5'AAGCAGCCGCATAGTAAAGGATTGTGATCGCC 3' (SEQ ID NO: 30).
[0317] Example 9: In vitro tumor cell killing experiment of anti-BCMA single-domain antibody MMAF toxin conjugate
[0318] BCMA-overexpressing NCI-H929 cells were seeded into 96-well plates at a density of 10,000 cells / 90 μl / well, with triplet wells, and incubated at 37°C. Test sample stock solutions were diluted with complete culture medium to prepare serially diluted 10-fold concentrations of test sample solutions. 10 μl / well of the above solution was added to each well of the cell plate, and the plates were incubated at 37°C. After 72 hours, cells were treated with the CellCounting-Lite 2.0 Luminescent Cell Viability Assay kit (Vazyme, D1101), and the chemiluminescence intensity of each well was measured using a microplate reader. The cell-killing effect of the drug was calculated.
[0319] Experimental results showed that both MADC-BCMA-114(3)-MMAF and MADC-BCMA-152(3)-MMAF could be internalized into NCI-H929 cells to mediate effective tumor cell killing. Figure 10 ).
[0320] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A single-domain antibody against BCMA, characterized in that, The single-domain antibody has three complementarity-determining regions (CDRs) derived from the VHH chain shown in any of the following amino acid sequences: SEQ ID NO:8, SEQ ID NO:15, SEQ ID NO:21, SEQ ID NO:24, or SEQ ID NO:26; The CDRs are CDR1, CDR2, and CDR3 determined by any one of the IMGT rule, Kabat rule, Chothia rule, AbM rule, or Contact rule.
2. The single-domain antibody as described in claim 1, characterized in that, CDR1, CDR2 and CDR3 are selected from the following group: (1) CDR1 with amino acid sequence as shown in SEQ ID NO:2, CDR2 with amino acid sequence as shown in SEQ ID NO:4 and CDR3 with amino acid sequence as shown in SEQ ID NO:6; (2) CDR1 with amino acid sequence as shown in SEQ ID NO:10, CDR2 with amino acid sequence as shown in SEQ ID NO:12 and CDR3 with amino acid sequence as shown in SEQ ID NO:14; (3) CDR1 with amino acid sequence as shown in SEQ ID NO:10, CDR2 with amino acid sequence as shown in SEQ ID NO:18 and CDR3 with amino acid sequence as shown in SEQ ID NO:20; (4) CDR1 with amino acid sequence as shown in SEQ ID NO:25, CDR2 with amino acid sequence as shown in SEQ ID NO:12 and CDR3 with amino acid sequence as shown in SEQ ID NO:
14.
3. A polynucleotide, characterized in that, The polynucleotide encodes the anti-BCMA single-domain antibody as described in claim 1.
4. An expression carrier, characterized in that, The expression vector contains the polynucleotide as described in claim 3.
5. A host cell, characterized in that, The host cell contains the expression vector of claim 4, or the genome is integrated with the polynucleotide of claim 3.
6. A method for generating a single-domain antibody against BCMA, characterized in that, Including the following steps: (a) The host cells of claim 5 are cultured under conditions suitable for the production of single-domain antibodies to obtain a culture containing the single-domain antibody against BCMA. as well as (b) Isolate or recover the anti-BCMA single-domain antibody from the culture.
7. An immunoconjugate, characterized in that, The immunoconjugate contains: (a) The anti-BCMA single-domain antibody as described in claim 1; and (b) The coupling part selected from the following group: detectable marker, drug, or combination thereof.
8. A multimeric protein complex based on a mutually compatible nucleic acid backbone, characterized in that, The complex is a polymer formed by n monomers having mutually compatible nucleic acid backbones, wherein the n monomers are composed of the following: (i) At least one targeting module containing a single-domain antibody against BCMA, comprising the single-domain antibody against BCMA as described in claim 1 and a single strand of nucleic acid linked thereto; (ii) Optional no or one or more other targeting modules, which consist of a targeting molecule and a single strand of nucleic acid linked thereto; (iii) Optional no or one or more pharmacological modules, which consist of a pharmacological molecule and a single strand of nucleic acid linked thereto; (iv) Optional monomers with one or more backbones, which are composed of single strands of nucleic acids; Where n is a positive integer from 2 to 8, each single strand of nucleic acid from a monomer forms a double strand with the single strands of nucleic acid from 1, 2 or 3 other monomers through base complementarity, thereby forming a complementary nucleic acid backbone structure.
9. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains: (i) the anti-BCMA single-domain antibody as claimed in claim 1, or the immunoconjugate as claimed in claim 7, or the multimeric protein complex as claimed in claim 8, or a combination thereof; and (ii) Pharmaceutically acceptable carriers.
10. The use of an active ingredient, characterized in that, The active ingredient is selected from the group consisting of: the anti-BCMA single-domain antibody as described in claim 1, or the immunoconjugate as described in claim 7, or the multimeric protein complex as described in claim 8, or the pharmaceutical composition as described in claim 9, or a combination thereof, wherein the active ingredient is used for: (a) Preparation of detection reagents, detection plates or kits; and / or (b) To prepare medicines for the prevention and / or treatment of diseases.