Application of Zm00001d033798 gene in regulation and control of corn plant height

Abstract

The invention discloses application of a Zm00001d033798 gene in regulation and control of the height of a corn plant, and belongs to the technical field of regulation and control of the height of the corn plant. The corn plant height key regulation gene Zm00001d033798 is cloned and functionally verified for the first time, the nucleotide sequence of the corn plant height key regulation gene Zm00001d033798 is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO: 2. By inhibiting or knocking out the function of the gene, the plant height of the corn can be stably reduced by about 20-40 cm, the dwarfing effect is derived from uniform shortening between stem sections, and key yield characters such as spike length are not influenced. The invention provides application of a DNA molecule containing the gene, a recombinant vector, an expression cassette and a related gene editing tool (such as specific sgRNA) to reduction of corn plant height and cultivation of dwarf close planting resistant varieties. The gene provides a fully verified efficient target for corn plant type improvement and molecular breeding, and has important application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of corn plant height regulation, and particularly relates to application of Zm00001d033798 gene in regulating corn plant height. BACKGROUND

[0002] Corn (Zea mays L.) is one of the three major crops in the world, and is also an important industrial raw material and livestock feed source.

[0003] In corn genetic breeding, biological yield, grain yield and quality are core target traits. As an important yield-related trait, plant height not only directly affects grain yield and biomass, but also is closely related to plant biomass through plant type regulation, and thus becomes a key indicator in breeding research. In-depth analysis of the genetic mechanism of plant height has important guiding significance for breeding new corn varieties with high yield and stress resistance.

[0004] At present, the cloned corn plant height regulation functional genes in the prior art are mainly concentrated in the hormone regulation pathway, and plant height is regulated by regulating the metabolism or signal transduction process of biological hormones such as auxin, gibberellin and brassinosteroid. Typical representatives include homologous genes of Br2. However, when such genes regulate plant height, they can only achieve the phenotype of corn dwarfing, and in most cases are accompanied by undesirable phenotypes such as shortened ear, which negatively affects corn yield traits, and it is difficult to meet the core needs of "optimizing plant height and improving yield" in breeding practice.

[0005] The growth and development of corn plant height is a complex multi-gene regulation process. Therefore, identifying more mutants related to plant height and isolating and cloning new plant height regulation genes are key ways to reveal the genetic mechanism of plant height and enrich the genetic regulation network. In the aspect of plant height-related gene mining technology, the traditional method relies on QTL positioning based on linkage analysis. After obtaining the initial positioning interval, a genetic mapping population needs to be constructed, recombinant materials are screened by molecular markers, and multi-year and multi-point fine positioning and phenotype verification are carried out, which has the significant defects of complicated operation steps, long time consumption and high cost. Although the rapid development of high-throughput sequencing technology provides convenience for obtaining multi-omics data, it makes it possible to analyze the genetic regulation mechanism of agronomic traits from the omics level, and a large number of QTL sites related to corn plant height have been identified in the prior art, but the QTL sites successfully cloned to the target functional genes are still few.

[0006] In summary, the existing corn plant height control genes have the problems of single function and easy to be accompanied by undesirable phenotypes, and the candidate gene mining efficiency of plant height related QTL sites is low, and the functional gene resources that have been cloned are scarce, which leads to the fact that the genetic regulation network of corn plant height has not been perfected, and it is difficult to meet the demand of molecular marker assisted selection breeding for new gene resources and theoretical support. Therefore, it is urgent to develop new corn plant height control genes, enrich the genetic regulation network of plant height development, and provide new technical approaches and gene resources for corn plant type improvement and high yield breeding. SUMMARY

[0007] Therefore, the purpose of the present application is to provide a new gene for corn plant height control and its application, specifically relates to the application of Zm00001d033798 gene or the protein coded by it in regulating corn plant height. The application includes but is not limited to directional change of corn plant height traits by regulating the expression level of the gene. The present application overcomes the limitations of the prior art that plant height control genes are mostly dependent on hormone pathways, have single function and are easy to be accompanied by undesirable phenotypes, and provides new and effective molecular targets and gene resources for corn plant type improvement and yield breeding.

[0008] To achieve the above purpose, the present application provides the following technical solutions:

[0009] In a first aspect, the present application provides the application of any one of the following (1)~(3) in regulating corn plant height:

[0010] (1) Protein Zm00001d033798;

[0011] (2) DNA molecule coding protein Zm00001d033798;

[0012] (3) Recombinant vector, expression cassette, transgenic cell or recombinant bacteria containing DNA molecule coding protein Zm00001d033798;

[0013] The protein Zm00001d033798 is as follows (a) or (b);

[0014] (a) Protein consisting of the amino acid sequence shown as SEQ ID NO: 2;

[0015] (b) Protein derived from (a) by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown as SEQ ID NO: 2 and having the same function.

[0016] In some embodiments, the DNA molecule coding protein Zm00001d033798 is a DNA molecule of any one of the following (1)~(3):

[0017] (1) a DNA molecule as shown in SEQ ID NO: 1;

[0018] (2) a DNA molecule hybridizing with the DNA sequence defined in (1) and encoding a protein having the same function;

[0019] (3) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with SEQ ID NO: 1 and encoding a protein having the same function.

[0020] In a second aspect, the present application provides an application of a substance inhibiting the activity of Zm00001d033798 protein or a substance inhibiting the expression of a gene encoding Zm00001d033798 protein in any one of (1)-(3) below:

[0021] (1) reducing the plant height of corn;

[0022] (2) breeding corn with low plant height;

[0023] (3) breeding corn with low stalk;

[0024] The protein Zm00001d033798 is as follows (a) or (b):

[0025] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2;

[0026] (b) a protein derived from (a) by substitution and / or deletion and / or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 and having the same function.

[0027] In some embodiments, the substance inhibiting the activity of Zm00001d033798 protein or the substance inhibiting the expression of a gene encoding Zm00001d033798 protein is as follows (a) or (b):

[0028] (a) sgRNA for knocking out the gene Zm00001d033798;

[0029] (b) a vector or a recombinant bacteria or a recombinant virus expressing the sgRNA of (a).

[0030] In a second aspect, the present application provides an application of a substance inhibiting the activity of Zm00001d033798 protein or a substance inhibiting the expression of a gene encoding Zm00001d033798 protein in any one of (1)-(3) below:

[0031] (1) reducing the plant height of corn;

[0032] (2) Cultivating low-plant-height maize;

[0033] (3) Cultivating low-stalk corn;

[0034] The protein Zm00001d033798 is either (a) or (b) as follows:

[0035] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2;

[0036] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:2.

[0037] Fourthly, this application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the expression level and / or activity of the DNA molecule encoding protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize.

[0038] Fifthly, this application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the content and / or activity of protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize;

[0039] The protein Zm00001d033798 is either (a) or (b) as follows:

[0040] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2;

[0041] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:2.

[0042] The above-mentioned methods for cultivating transgenic maize with reduced plant height include: reducing the expression level of the Zm00001d033798 protein in the maize through gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of the maize.

[0043] Compared with the prior art, the technical solution of this application has at least the following beneficial effects:

[0044] 1. Providing a novel regulatory target and enriching the genetic network: This application reveals for the first time the key role of the Zm00001d033798 gene in the regulation of maize plant height, providing a novel molecular target independent of the traditional hormone pathway, filling the gap in the single regulatory gene functional pathway in the existing technology, and significantly enriching the genetic regulatory network of maize plant height development.

[0045] 2. Achieving precise and effective regulation to optimize breeding traits: By regulating the expression or activity of this gene, maize plant height can be changed in a targeted and effective manner, providing a direct technical means for breeding new maize germplasm that is low-stalked, tolerant of dense planting, and resistant to lodging. Compared with existing methods where some gene mutations are easily accompanied by undesirable agronomic traits, this method is more conducive to optimizing plant type while maintaining other yield traits. Attached Figure Description

[0046] Figure 1 The principle and operation flowchart of the QTG-Miner method provided in Embodiment 1 of this application.

[0047] Figure 2 This diagram illustrates the application of the QTG-Miner method provided in Example 1 of this application in predicting candidate genes for the QTL locus qPH1-4 in maize plant height. In this diagram, A is a multi-omics data interaction network diagram used for candidate gene prediction, B is the distribution of positive and negative plant height regulating genes in the machine learning model training set, C is the ratio of the prediction performance (AUC value) of the five machine learning models, D is the genetic location information of the plant height QTL locus qPH1-4, E is the ranking of gene functional influence scores in the qPH1-4 interval based on the shortest distance method, and F is the ranking of the probability of gene regulation of plant height in the qPH1-4 interval based on the shortest distance method.

[0048] Figure 3 This is a schematic diagram of the structure and mutation of the Zm00001d033798 gene provided in Example 2 of this application.

[0049] Figure 4 The image shows the phenotypic image of the EMS mutant of the Zm00001d033798 gene provided in Example 3 of this application, where the left is the wild type and the right is the mutant.

[0050] Figure 5 The significance test results of the EMS mutant provided in Example 3 of this application at three locations.

[0051] Figure 6 This is a comparison of the ear length of mutant and wild-type maize under different planting densities, as provided in Example 3 of this application.

[0052] Figure 7 This describes the editing process of two CRISPR editing events provided in Embodiment 4 of this application.

[0053] Figure 8 The bar chart shows the plant height of the two CRISPR materials provided in Example 4 of this application compared with the plant height of wild-type KN5585 in Jilin in the 24th and 25th seasons. The mutation type 33798-1 is a 1 bp insertion, and the mutation type 33798-2 is an 8 bp deletion.

[0054] Figure 9 The image shows a comparison of the Zm00001d033798 gene mutant provided in Example 4 of this application with the wild type in Jilin in the spring of 2018. From left to right, they are the segregating wild type WT, 33798-1, and 33798-2.

[0055] Figure 10 This is a field comparison of the Zm00001d033798 gene CRISPR knockout line and the wild type provided in Example 4 of this application. The left side is the wild type WT, and the right side is 33798-1. Detailed Implementation

[0056] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0057] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before a detailed description of this application, the following definitions are provided to better understand it.

[0059] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0060] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0061] Example 1: Discovery and screening of the Zm00001d033798 gene

[0062] This embodiment details the process of screening and identifying the key candidate gene Zm00001d033798 from maize plant height QTL loci qPH1-4 using multi-omics integrated analysis and machine learning methods. This method is implemented based on the QTG-Miner software package developed in our laboratory, and its core principles and operating procedures are as follows: Figure 1 As shown.

[0063] 1. Genetic population construction and preliminary QTL mapping

[0064] A recombinant inbred line (RIL) population was constructed using maize inbred line B73 and another inbred line with plant height differences as parents. This population was planted under uniform environmental conditions, and individual plant height phenotypic data were precisely measured. Genotypic analysis was performed using high-density molecular markers covering the entire genome. Through linkage analysis, a major-effect QTL locus for plant height was located on maize chromosome 1, named qPH1-4. The LOD value of this locus showed a significant association effect with plant height. Figure 2 D).

[0065] 2. Segregation Population Construction and Transcriptome Sequencing: From the aforementioned RIL population, individuals carrying high-value and low-value alleles at qPH1-4 loci were selected to construct "high-value" and "low-value" DNA pools. Samples were taken from the same tissues at key growth stages (e.g., jointing stage) of representative plants from both pools, and total RNA was extracted for strand-specific library construction. High-throughput transcriptome sequencing (RNA-Seq) was performed using the Illumina NovaSeq platform.

[0066] 3. Construction of multi-omics databases and model training

[0067] First, we integrated the genome annotation information of the maize reference genome version B73 RefGen_v4, as well as transcriptome, translatome, proteome, three-dimensional genome, and high-throughput yeast two-hybrid data accumulated in our laboratory during the entire growth period of the B73 inbred line, to construct the first-generation maize multi-omics interaction map. Figure 2 A). This atlas provides a multidimensional data reference for describing the function of individual genes, laying a data foundation for building machine learning models. To train a machine learning model for candidate gene prediction, functionally validated maize plant height-related genes were collected from public databases and literature, including 39 genes with positive regulation (promoting plant height) and 39 genes with negative regulation (inhibiting plant height), to construct a training set ( Figure 2 B). Using the built-in modules of the QTG-Miner software package, multidimensional features of these genes were extracted based on multi-omics interaction maps. Five classic machine learning models, including Support Vector Machine (SVM), Random Forest, Gradient Boosting Decision Tree (GBDT), were then trained and cross-validated. Evaluation on the test set showed that the XGBoost model exhibited the best fit. Figure 2 C), and therefore it was determined to be the optimal model for subsequent predictions.

[0068] 4. Candidate gene prediction and screening

[0069] All annotated genes within the initially located qPH1-4 physical region (approximately 2.1 Mb) were used as the prediction set. First, the "shortest distance method" in QTG-Miner was used for preliminary screening. This method, based on the principle of genomic proximity, collinearity analysis, and multi-omics association characteristics, assigns a score to the probability that all genes within the region regulate plant height, and ranks them according to their scores. Figure 2 E, F). Subsequently, the multi-omics features of the genes to be predicted were input into the pre-trained XGBoost optimal model, and the predicted probability value of each gene as a plant height-related functional gene was calculated. The results of the two methods were cross-validated. Gene Zm00001d033798 ranked among the top in the shortest distance method scoring ranking ( Figure 2 (E, F), while the predicted probability value in the XGBoost model is significantly higher than the confidence threshold. The consistent predictions of the two independent methods strongly support that Zm00001d033798 is the most likely candidate functional gene for the qPH1-4 loci.

[0070] 5. Results Through the systematic screening process described above, the core candidate gene Zm00001d033798 was successfully identified from the complex QTL interval qPH1-4. This gene Zm00001d033798 is located on the reverse strand of chromosome 1 of the maize reference genome B73RefGen_v5 (or Zm-B73-REFERENCE-NAM-5.0), with genomic coordinates ranging from 275,831,149 bp to 275,839,114 bp. Its nucleotide sequence is shown in SEQ ID NO:1. This method combines rapid screening based on genetic location and multi-omics associations (shortest distance method) with intelligent prediction based on machine learning, effectively overcoming the blindness and inefficiency of traditional methods in searching for target genes within a wide interval. It achieves rapid and accurate identification of candidate genes, clarifying the target for subsequent functional validation.

[0071] Example 2: Screening, molecular identification, and mutation effect analysis of EMS mutants of the Zm00001d033798 gene.

[0072] This embodiment describes in detail the entire process of accurately screening target mutants from public mutant resources and using molecular biology techniques to clarify the nature of their genetic variations.

[0073] 1. Source of mutants

[0074] The mutant materials used in this application embodiment are derived from the EMS mutant library of maize B73 inbred lines constructed and published by Professor Lu Xiaofeng's research group at Qilu Normal University. This mutant library uses the superior inbred line B73 with consistent genetic background as starting material. Through treatment with the chemical mutagen ethyl methanesulfonate (EMS), a population rich in random single-base mutations (mainly G / C→A / T transitions) was created, serving as a standardized resource for reverse genetics research on gene function.

[0075] 2. Mutant Screening and Identification Strategies

[0076] To efficiently and accurately screen for loss-of-function mutants of the Zm00001d033798 gene from this library, the following molecular screening protocol was designed and executed:

[0077] (1) Primer design and synthesis

[0078] Based on the annotation information of the Zm00001d033798 gene in the maize B73 V4 reference genome, specific primers were designed for PCR amplification to ensure the accuracy of the identification results. The specific primer pairs include:

[0079] EMS 33798-F: TGGGCCCTCAGAAGTACCTA (SEQ ID NO:3);

[0080] EMS 33798-R: TTGGTCATATTGTTTGGCTCCAG (SEQ ID NO: 4).

[0081] (2) Genomic DNA extraction:

[0082] High-quality genomic DNA was extracted from young leaves of candidate plants from the EMS mutant library and wild-type B73 control using a modified CTAB method. The concentration and purity (A260 / A280 = 1.8-2.0) were determined by agarose gel electrophoresis and Nanodrop spectrophotometry, and the DNA was uniformly diluted to 50 ng / μL for later use.

[0083] (3) PCR amplification and sequencing screening:

[0084] The PCR reaction system (50 μL) is shown in Table 1 below:

[0085] Table 1 PCR reaction system

[0086]

[0087] The PCR reaction procedure is shown in Table 2 below:

[0088] Table 2

[0089]

[0090] (4) Product detection and purification:

[0091] After the PCR products were verified by 1.2% agarose gel electrophoresis, the target band was purified by gel excision.

[0092] (5) Sanger sequencing and sequence alignment

[0093] Use SnapGene or BioEdit software to align the sequencing peaks with the B73 reference sequence.

[0094] The technical solution of this application and the technical effects achieved will be described in detail below through more specific embodiments.

[0095] 3. Mutation site identification and functional prediction

[0096] Through the sequencing and comparative analysis described above, a single plant carrying a homozygous pathogenic mutation was successfully identified. Key information is as follows:

[0097] (1) Genomic coordinates: The mutation is located at 274,059,443 bp on maize chromosome 1 (Chr1) (B73_RefGen_v4).

[0098] (2) Mutation type: STOP_GAINED (stop codon acquisition).

[0099] (3) Molecular changes: The wild type (B73) has the codon TGG (encoding tryptophan, Trp) at this site, while the mutant sequence is TAG (stop codon), which means that a G→A base substitution has occurred.

[0100] (4) Biological consequences: This mutation causes the translation of the gene protein to be prematurely terminated at the mutation site, resulting in an abnormal protein that is truncated at the C-terminus and loses its function. Figure 3 This shows the location of the mutation in the gene structure.

[0101] 4. Genotypic stability and verification of mutant offspring

[0102] The Zm00001d033798 gene mutant was self-crossed to obtain M3 generation seeds. PCR amplification was performed on the M3 generation population. Because this mutation introduces an altered restriction enzyme site that could be used to develop dCAPS markers, the genotype of the M3 generation plants could be rapidly identified by restriction endonuclease digestion analysis or direct sequencing. Genetically stable homozygous mutant lines were then screened for subsequent phenotypic analysis.

[0103] Example 3: Multi-environment field phenotypic identification of the Zm00001d033798 EMS mutant

[0104] This embodiment aims to rigorously evaluate the physiological effects of loss of function of the Zm00001d033798 gene on maize, especially the plant height trait.

[0105] 1. Multi-environment field trial design

[0106] (1) Test site and season:

[0107] Location 1: Hainan, winter growing season (2020 winter Hainan, 20DHN; 212 winter Hainan, 21DHN).

[0108] Location 2: Shandong, spring growing season (Spring 2021, Shandong, 21CSD).

[0109] (2) Experimental materials: Zm00001d033798 homozygous mutant and its wild-type parent B73, which were verified in Example 2.

[0110] (3) Experimental design: A randomized block design with 3 replicates was adopted. Each plot was planted in double rows with a row spacing of 60 cm and a plant spacing of 25 cm. Water and fertilizer management and pest and disease control were carried out uniformly throughout the growth period.

[0111] 2. Systematic investigation of phenotypic traits

[0112] The following measurements were taken during the critical periods of vegetative and reproductive growth:

[0113] Main trait (plant height): One week after silking, measure the vertical height (cm) from the ground to the tip of the tassel on each plant. Measure at least 15 representative plants from each plot.

[0114] Analysis of traits (internodes): After maturity, five standard plants were taken, and the length of each internode was measured and recorded.

[0115] Relevant agronomic traits: record the tasseling period, pollen shedding period, silking period, ear height, ear length, ear diameter, and length of barren tips.

[0116] 3. Data Analysis and Conclusions

[0117] Significant dwarfing effect: In all three test environments, the Zm00001d033798 gene mutant exhibited a visually visibly consistent dwarfing phenotype. Figure 4 ).

[0118] Plant height data statistics: Statistical analysis was performed on the plant height data (using one-way ANOVA and Duncan's multiple comparisons, significance level α=0.01). The results are summarized as follows ( Figure 5 ):

[0119] Loss of function of the Zm00001d033798 gene resulted in a stable reduction of maize plant height of approximately 20–40 cm under different ecological conditions, with a significant and reproducible reduction. This provides solid and reliable multi-environmental phenotypic data support for this gene as a key gene resource for maize plant architecture improvement and lodging resistance breeding.

[0120] 4. This embodiment also evaluates the effect of loss of function of the Zm00001d033798 gene on spike length, a key yield component, while reducing plant height, and examines the changes in this effect under different planting densities to simulate the conditions of dense planting in actual production. The specific steps are as follows:

[0121] The homozygous EMS mutant Zm00001d03379 and its wild-type parent B73, validated in the previous examples, were used. Four planting density gradients were set: low density: 67,000 plants / ha; low-medium density: 81,000 plants / ha; medium-high density: 95,000 plants / ha; and high density: 108,000 plants / ha. A randomized block design was used, with both the mutant and wild-type materials planted at each density. At maize maturity, representative ears were randomly collected from each plot, and their ear length (cm) was measured as the core yield trait indicator.

[0122] Figure 6 The figure shows a comparison of ear length between the mutant and wild-type maize at different planting densities. As can be seen from the figure, at all four planting densities from low to high, the average ear length of the Zm00001d03379 mutant was comparable to that of the wild-type B73, and it did not show any negative effects such as ear shortening caused by a significant reduction in plant height.

[0123] 5. Phenotypic mechanism and specificity analysis:

[0124] (1) Causes of dwarfing: Internode analysis showed that the reduction in plant height was due to the uniform shortening of all internodes, rather than a reduction in the number of nodes, suggesting that the Zm00001d033798 gene mainly regulates the longitudinal elongation of cells. This gene is not only an effective target for dwarfing, but its mechanism of action of "regulating uniform elongation of internodes" rather than "reducing the number of nodes" is theoretically more conducive to maintaining the normal development process and organ integrity of the plant while reducing plant height, and avoiding the chain of negative effects such as developmental delay or deterioration of ear traits that may be caused by a reduction in the number of nodes.

[0125] (2) Trait specificity: Most importantly, the Zm00001d033798 gene mutant showed no significant decrease or slight increase in tasseling and pollen shedding period and major yield traits of the ear (ear length, number of ear rows) compared to the wild type. This indicates that the reduction in plant height achieved by regulating the Zm00001d033798 gene was not accompanied by significant growth and development delay or loss of yield components, and even has the potential to further increase yield. The technology in this application solves the technical problem of "loss of all benefits from dwarfing" in many existing dwarfing gene applications, highlighting its unique application value in maize high-density lodging-resistant breeding.

[0126] Example 4: Creation and Phenotypic Identification of CRISPR / Cas9 Knockout Mutants of the Zm00001d033798 Gene

[0127] This embodiment aims to create a loss-of-function mutant of the Zm00001d033798 gene using gene editing technology, and to verify its phenotypic effect under multiple environments, so as to confirm the function of the gene and evaluate its direct application value in molecular breeding.

[0128] 1. Creation and molecular identification of gene-edited mutants

[0129] (1) Target design and vector construction: Specific sgRNAs were designed and synthesized targeting specific exon regions of the Zm00001d033798 gene. The sgRNA expression cassette was cloned into a CRISPR / Cas9 plant expression vector to construct a recombinant knockout vector.

[0130] (2) Genetic transformation and plant acquisition: Using the immature embryo of the superior maize inbred line B73 as the recipient, genetic transformation was carried out by Agrobacterium-mediated transformation. After resistance screening and regeneration, T0 generation transformed plants were obtained.

[0131] (3) Mutant molecular identification: Genomic DNA was extracted from leaves of T0 generation plants and PCR amplification was performed using target-specific detection primers.

[0132] Detection primer sequence:

[0133] 33798CR-F:GGAGAACATTGATCTGGTGCT (SEQ ID NO:5);

[0134] 33798CR-R:TCTTCCCATCCGAACCATTC (SEQ ID NO:6);

[0135] Sanger sequencing was performed on the PCR products to analyze the edit type. Two independent homozygous mutant lines were successfully screened and named 33798-1 and 33798-2, respectively.

[0136] PCR reaction system (20 μL): 10 μL of 2×Taq PCR Master Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), 1 μL of template DNA (50 ng / μL), and ddH2O to a final volume of 20 μL.

[0137] PCR reaction program: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; final extension at 72 °C for 5 min.

[0138] The PCR products were analyzed by 1% agarose gel electrophoresis, and products with the correct band size were subjected to Sanger sequencing to analyze the editing type. Two independent homozygous mutant lines were successfully screened and named 33798-1 and 33798-2, respectively.

[0139] (4) Edit sequence analysis: such as Figure 7 As shown, the sequencing results compared with the wild-type reference sequence indicate that:

[0140] Strain 33798-1: An insertion of 1 base (T) occurs at the target site (insertion 1 bp).

[0141] Strain 33798-2: An 8-base deletion (CCTCGCCT) occurred at the target site.

[0142] Both editing events resulted in a frameshift downstream of the target site, expected to produce a truncated, non-functional protein, thus achieving functional gene knockout. T1 and subsequent generations of sequencing confirmed the stable inheritance of the editing.

[0143] 2. Multi-environment field phenotypic identification

[0144] (1) Experimental design:

[0145] Location and season: Two summer field trials were conducted in Jilin (Spring 2024, Jilin, 24JL; Spring 2025, Jilin, 25JL).

[0146] Materials: The two CRISPR homozygous knockout lines (33798-1, 33798-2) were used as controls, along with wild-type B73 and an unedited transgenic negative isolate (MUS355).

[0147] Scheme: A randomized block design with 3 replicates was used. Routine field management was employed.

[0148] (2) Trait survey:

[0149] After silking stage, the plant height (from ground to tip of tassel) of at least 15 representative plants in each plot was measured. Data analysis was performed using one-way ANOVA and LSD multiple comparisons (α=0.05).

[0150] (3) Results:

[0151] ① Molecular identification results: Two homozygous knockout lines carrying different frameshift mutation types were successfully obtained, confirming that the Zm00001d033798 gene was effectively edited and inactivated.

[0152] ②Results of plant height phenotype: Figure 8 The bar chart shows the plant height of the two CRISPR materials compared with that of the wild-type KN5585 in Jilin Province in 2014 and 2015. The mutation type of 33798-1 is a 1 bp insertion, and the mutation type of 33798-2 is an 8 bp deletion. In both test years, the plant height of the two CRISPR knockout lines (33798-1 and 33798-2) was significantly lower than that of the wild-type B73 and the negative control KN5585. Figure 9The image shows a comparison of the gene in Jilin in Spring 2025 with the wild type. From left to right, they are WT, 33798-1, and 33798-2. As can be seen from the image, the mutants caused by the two independent editing events have similar degrees of dwarfing and are consistent with the dwarfing trend of the aforementioned EMS mutant. This genetically excludes the background mutation interference that may exist in EMS mutagenesis and strongly proves that the observed dwarfing phenotype is indeed directly caused by the loss of function of the Zm00001d033798 gene. Figure 10 This is a field comparison of the CRISPR knockout line of the Zm00001d033798 gene and the wild type. The left side represents the segregating wild-type WT, and the right side represents 33798-1. The plant height on the right side is significantly lower than that on the left.

[0153] ③ Under normal planting density, the haplotype of this CRISPR gene can bring about an increase in yield of approximately 11.13% to 24.96%.

[0154] This embodiment successfully created two independent loss-of-function mutants of the Zm00001d033798 gene using CRISPR / Cas9 gene editing technology. Phenotypic identification under multiple environments repeatedly confirmed that knockout of this gene leads to a highly significant and stable reduction in maize plant height. Combining the consistent phenotypes of the EMS mutant and the CRISPR knockout mutant, Zm00001d03379 was ultimately confirmed as a key gene regulating maize plant height. This embodiment provides a complete technical example and effective editing targets for directly, rapidly, and precisely improving maize plant height using gene editing technology. By designing corresponding sgRNAs, breeders can efficiently introduce beneficial mutations at this site in different genetic backgrounds, thereby accelerating the breeding process of dwarf, lodging-resistant new maize varieties.

[0155] Based on the above-mentioned regulatory mechanism of the Zm00001d033798 gene on maize, this application also discovered the following applications, specifically reflected in:

[0156] The embodiments of this application provide the application of a substance that inhibits the activity of Zm00001d033798 protein or a substance that inhibits the expression of the gene encoding Zm00001d033798 protein in any one of the following (1) to (3);

[0157] (1) Reduce corn plant height;

[0158] (2) Cultivating low-plant-height maize;

[0159] (3) Cultivating low-stalk corn;

[0160] The protein Zm00001d033798 is either (a) or (b) as follows:

[0161] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2;

[0162] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:2.

[0163] In some embodiments, the substance that inhibits the activity of the Zm00001d033798 protein or the substance that inhibits the expression of the gene encoding the Zm00001d033798 protein is as follows (a) or (b):

[0164] (a) sgRNA used to knock out gene Zm00001d033798;

[0165] (b) A vector or recombinant bacterium or recombinant virus expressing the sgRNA described in (a).

[0166] This application provides an application of inhibiting the activity of Zm00001d033798 protein or inhibiting the expression of the gene encoding Zm00001d033798 protein in any of the following (1) to (3);

[0167] (1) Reduce corn plant height;

[0168] (2) Cultivating low-plant-height maize;

[0169] (3) Cultivating low-stalk corn;

[0170] The protein Zm00001d033798 is either (a) or (b) as follows:

[0171] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2;

[0172] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:2.

[0173] This application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the expression level and / or activity of the DNA molecule encoding protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize.

[0174] This application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the content and / or activity of protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize;

[0175] The protein Zm00001d033798 is either (a) or (b) as follows:

[0176] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2;

[0177] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:2.

[0178] In some embodiments, methods for cultivating transgenic maize with reduced plant height include: reducing the expression level of the Zm00001d033798 protein in the maize by means of gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of the maize.

[0179] In summary, this application is the first to clone and validate the key regulatory gene Zm00001d033798 for maize plant height. By knocking out or inhibiting the function of this gene, maize plant height can be stably reduced by about 20-40 cm without affecting ear yield, providing a novel molecular target and reliable solution for breeding short-stalked, lodging-resistant, high-yielding maize that is tolerant of dense planting.

[0180] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. The application of any one of the following substances (1) to (3) in regulating the growth rate of maize plants: (1) Protein Zm00001d033798; (2) The DNA molecule encoding protein Zm00001d033798; (3) Recombinant vectors, expression cassettes, transgenic cells or recombinant bacteria containing DNA molecules encoding protein Zm00001d033798; The protein Zm00001d033798 is either (a) or (b) below; (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:

2.

2. The application according to claim 1, wherein the DNA molecule encoding protein Zm00001d033798 is any one of the following (1) to (3): (1) A DNA molecule as shown in SEQ ID NO:1; (2) A DNA molecule that hybridizes with the DNA sequence defined in (1) and encodes a protein with the same function; (3) A DNA molecule that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with SEQ ID NO:1 and encodes a protein with the same function.

3. The application of any one of the following (1) to (3) of the substance that inhibits the activity of Zm00001d033798 protein or the substance that inhibits the expression of the gene encoding Zm00001d033798 protein; (1) Reduce corn plant height; (2) Cultivating low-plant-height maize; (3) Cultivating low-stalk corn; The protein Zm00001d033798 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:

2.

4. The application according to claim 3, wherein the substance that inhibits the activity of Zm00001d033798 protein or the substance that inhibits the expression of the gene encoding Zm00001d033798 protein is as follows (a) or (b): (a) sgRNA used to knock out gene Zm00001d033798; (b) A vector or recombinant bacterium or recombinant virus expressing the sgRNA described in (a).

5. Inhibit the activity of Zm00001d033798 protein or inhibit the expression of the gene encoding Zm00001d033798 protein in any of the following (1) to (3); (1) Reduce corn plant height; (2) Cultivating low-plant-height maize; (3) Cultivating low-stalk corn; The protein Zm00001d033798 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:

2.

6. A method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the expression level and / or activity of DNA molecules encoding protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize.

7. A method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the content and / or activity of protein Zm00001d033798 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize; The protein Zm00001d033798 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:

2.

8. The method of claim 7, comprising: The expression level of the Zm00001d033798 protein in maize was reduced by means of gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of maize.

Images