Primer probe combination for specifically detecting pneumocystis yarrowii, kit and application
By designing specific primer-probe combinations and optimizing the fluorescent PCR reaction system, the problems of low sensitivity and complex operation in the detection of Pneumocystis jirovecii have been solved, achieving high sensitivity, high specificity, and rapid detection of Pneumocystis jirovecii, which is suitable for large-scale clinical sample screening.
Patent Information
- Application Number
- CN202610060974.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-02-17
AI Technical Summary
Existing technologies for detecting Pneumocystis jirovecii have low sensitivity, are complex to operate, and have subjective results interpretation, making it difficult to meet the needs of rapid clinical diagnosis.
We designed a specific primer-probe combination targeting the mitochondrial large subunit ribosomal RNA gene of Pneumocystis jirovecii, combined with an internal standard system and UDG enzyme, and optimized the fluorescent PCR reaction system to achieve fully automated detection.
It achieves highly sensitive, specific, rapid, and reliable detection of Pneumocystis jirovecii, reduces false negative results, and is suitable for large-scale clinical sample screening.
Smart Images

Figure CN121538346A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection, specifically a primer-probe combination for the specific detection of Pneumocystis jirovecii, a detection kit containing the combination, and its application and detection method. Background Technology
[0002] Pneumocystis jirovecii (Pj) belongs to the genus Pneumocystis in the family Pneumocystisaceae. It is an opportunistic pathogenic fungus that causes pneumocystis pneumonia (PCP) in humans. It was first discovered in 1909 and named Pneumocystis carinii in 1912. In 1988, due to its many characteristics as a fungus, it was classified as a fungus. In 1999, it was officially named Pneumocystis jirovecii in honor of Otto Jirovec, the Czech scientist who first studied human Pneumocystis.
[0003] Pneumocystis jirovecii is an atypical fungus that exists in three forms: trophic, sporocystic, and mature cystocystic. As an opportunistic pathogen of the respiratory system, the current mode of transmission of Pneumocystis jirovecii is not yet clear, but some studies have shown that it may be transmitted through aerosols. Pneumocystis jirovecii can remain latent in the trachea, bronchi, or alveolar cavities for a long time, forming a latent infection without symptoms. When latent or newly infected Pneumocystis jirovecii proliferates in large numbers when the host's immunity is low, it invades the lungs and forms Pneumocystis jirovecii pneumonia, which often manifests as diffuse interstitial changes in the lungs. Pneumocystis jirovecii pneumonia is more common in people with weakened immunity due to co-infection with HIV, malignant tumors, post-organ transplantation, long-term use of high doses of immunosuppressants, or severe malnutrition.
[0004] Currently, the diagnosis of Pneumocystis jirovecii infection in China mainly relies on etiological examination. Traditional diagnosis depends on microscopic staining (GMS, toluidine blue) or tissue biopsy, the sensitivity of which is limited by the quality of the specimen and the level of technology, and it is time-consuming, making it difficult to meet the needs of rapid clinical decision-making. Real-time fluorescence PCR can complete qualitative or semi-quantitative detection within 1-2 hours, with high sensitivity and strong specificity. Compared with culture or microscopy, nucleic acid detection has less stringent requirements for specimens (sputum, bronchoalveolar lavage fluid), and is suitable for capturing early low-burden infections.
[0005] The present invention aims to provide a highly sensitive, highly specific, and fully automated fluorescent PCR detection system to solve the problems of low detection rate, complex operation, and subjective interpretation of results in the prior art. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a primer and probe combination, kit and method for detecting Pneumocystis jirovecii using fluorescent PCR with high sensitivity, strong specificity, effective monitoring of the experimental process and good reproducibility.
[0007] To achieve the above objectives, the present invention provides the following technical solution: A primer-probe combo for the specific detection of Pneumocystis jirovecii, designed to target a conserved region of the large mitochondrial subunit ribosomal RNA gene (GenBank: MH010446.1 22145-22289) in Pneumocystis jirovecii, comprising: The nucleotide sequence is as shown in the upstream primer of SEQ ID NO:1; The nucleotide sequence of the downstream primer is as shown in SEQ ID NO:2; and The nucleotide sequence is shown in SEQ ID NO:3, and the probe is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end.
[0008] Preferably, the 5' end fluorescent reporter group of the probe is FAM, and the 3' end fluorescent quencher group is BHQ-1.
[0009] The present invention also provides a kit for detecting Pneumocystis jirovecii, comprising the above-described primer-probe combination.
[0010] Preferably, the kit for detecting Pneumocystis jirovecii further includes an internal standard system, which comprises an internal standard template and upstream primers, downstream primers, and probes for specifically amplifying the internal standard; The internal standard probe is labeled with a fluorescent reporter group of a different color than the primer probes used for the specific detection of Pneumocystis jirovecii.
[0011] Preferably, the internal standard template is a conserved region fragment of the papaya genome; the nucleotide sequence of the upstream primer of the internal standard is shown in SEQ ID NO:4; The nucleotide sequence of the internal standard downstream primer is shown in SEQ ID NO:5; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:6.
[0012] Preferably, the kit for detecting Pneumocystis jirovecii further includes a PCR reaction solution comprising: hot-start Taq DNA polymerase, dNTPs, Mg2+, reaction buffer, uracil DNA glycosylase, and a stabilizer; wherein the dNTPs include dUTPs.
[0013] The present invention also provides a non-diagnostic method for detecting Pneumocystis jirovecii nucleic acid, which uses the primer and probe combination as described above or the kit as described above, and performs real-time fluorescent PCR amplification with the nucleic acid of the sample to be tested as a template. The presence of Pneumocystis jirovecii nucleic acid in the sample is determined by detecting the specific fluorescent signal.
[0014] Preferably, the real-time fluorescence PCR reaction system is 25 μL, comprising: 0.2-0.8 μM each of the primers shown in SEQ ID NO:1 and SEQ ID NO:2, 0.1-0.4 μM of the probe shown in SEQ ID NO:3, 0.2-0.8 μM each of the primers shown in SEQ ID NO:4 and SEQ ID NO:5, 0.1-0.4 μM of the probe shown in SEQ ID NO:6, 1-5 U of hot-start Taq DNA polymerase, and 0.1-1 U of UDG enzyme.
[0015] Preferably, the reaction procedure for the real-time fluorescence PCR is as follows: incubation at 50°C for 2-5 minutes; pre-denaturation at 95°C for 2-10 minutes; followed by 40-50 cycles of amplification, each cycle including denaturation at 94-95°C for 10-30 seconds, annealing / extension at 58-62°C for 30-60 seconds, and acquiring fluorescence signals during the annealing / extension phase.
[0016] The present invention also provides the use of the primer-probe combination as described above or the kit as described above in the preparation of products for detecting Pneumocystis jirovecii.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. High specificity: Specific primers and probes were designed for the conserved region of the large subunit ribosomal RNA gene of Pneumocystis jirovecii. After comparison with NCBI Blast and interference tests by common clinical pathogens, no cross-reactivity was found, ensuring the specificity of the detection. 2. High sensitivity: By optimizing primer and probe concentrations, reaction systems, and amplification procedures, the lowest detection limit can reach 5.00E+02 copies / ml, which can effectively capture early low-burden infections; 3. Excellent anti-contamination effect: The reaction system contains UDG enzyme and dUTP, which can effectively degrade previous amplification products, prevent aerosol contamination, and ensure the cleanliness of the laboratory environment and the accuracy of the results.
[0018] 4. Reliable results: The kit includes an internal standard system, which can monitor all stages from nucleic acid extraction to PCR amplification, effectively avoiding false negative results caused by sample inhibition or operational errors, and improving the reliability of test results.
[0019] 5. Good repeatability: In the repeatability test, the coefficient of variation (CV%) of the Ct value of this detection system was less than 5%, indicating that it has excellent stability and repeatability. 6. Simple and fast operation: The detection process can be completed by a fully automated real-time PCR instrument without complicated manual operation. Results can be obtained in 1.5-2 hours, meeting the needs of rapid clinical diagnosis.
[0020] 7. High throughput and low cost: The system is compatible with conventional fluorescence PCR instruments, can detect multiple samples simultaneously, simplifies the operation process, reduces detection costs, and is suitable for large-scale clinical sample screening. Attached Figure Description
[0021] Figure 1 This is the amplification curve obtained when optimizing primer and probe concentrations in Example 2 of the present invention.
[0022] Figure 2 This is an amplification curve for sensitivity detection in Example 3 of the present invention.
[0023] Figure 3 This is an amplification curve for specific detection in Example 4 of the present invention.
[0024] Figure 4 This is a distribution diagram of Ct values for repeatability testing in Embodiment 5 of the present invention.
[0025] Figure 5 This is a graph showing the test results of UDG anti-pollution verification in Embodiment 6 of the present invention.
[0026] Figure 6 This is a graph showing the detection results of some clinical samples in Example 7 of the present invention. Detailed Implementation
[0027] The following embodiments will describe the present invention in detail with reference to the accompanying drawings. In the drawings or description, similar or identical parts are referred to by the same reference numerals, and in practical applications, the shape, thickness, or height of each component may be enlarged or reduced. The embodiments listed in this invention are merely illustrative and not intended to limit the scope of the invention. Any obvious modifications or changes made to this invention do not depart from the spirit and scope of the invention.
[0028] Example 1: Primer and probe design and synthesis Based on the sequence of *Pneumocystis jirovecii*, conserved regions of the genome were analyzed using BioEdit software. Following primer and probe design principles, specific primer and probe sequences targeting the large mitochondrial subunit ribosomal RNA gene of *Pneumocystis jirovecii* were designed using PrimerPrimer 5 software within these conserved regions. Additionally, to monitor the nucleic acid extraction and PCR amplification processes, internal standard primers and probes were designed from conserved regions of the *Carica papaya* genome. During the design of these primers and probes, hairpin structures, internal primer dimers, inter-primer dimers, and mismatches were avoided as much as possible. Furthermore, the designed *Pneumocystis jirovecii*-specific primer and probe sequences were compared and analyzed against the NCBI Blast online database to prevent non-specific binding to other pathogens or human genes. Through multiple rounds of screening and optimization, a set of primer and probe sequences with optimal sensitivity and specificity was finally determined, as shown below: PJ-F1(SEQ ID NO:1):AAATAATCAGACTATGTGCGAT PJ-R1(SEQ ID NO:2):GATGGCTGTTTCCAAGCC PJ-P1(SEQ ID NO:3):CTGGGCTGTTTCCCTTTCGACTATCT CPPA-F1(SEQ ID NO:4):GTCGATTGGAGAAAAAAAGG CPPA-R1(SEQ ID NO:5):CGAGAATGCCCAACAACTAC CPPA-P1(SEQ ID NO:6):CTGTCACTCCCGTAAAACATCAGG Among them, the 5' end fluorescent group of PJ-P1 is FAM and the 3' end quenching group is BHQ1; the 5' end fluorescent group of CPPA-P1 is VIC and the 3' end quenching group is BHQ1.
[0029] Example 2: Optimization of Real-Time Fluorescent PCR Reaction System The reaction system using 25 μL is as follows: 20 μL of PJ reaction mixture 1 μL of PJ enzyme mixture 4 μL of nucleic acid from the sample to be tested The PJ reaction mixture consists of dNTPs (containing dUTP, 150-200 μM), 10×PCR buffer, MgCl2 (1.5-2 mM), BSA (0.15-0.2 mg / mL), and primers and probes of different concentrations. The PJ enzyme mixture mainly consists of hot-start Taq enzyme and UDG enzyme, with each person using 5 U of hot-start Taq enzyme and 0.5 U of UDG enzyme.
[0030] By testing different annealing temperatures, the reaction program on the ABI 7500 fluorescence PCR instrument was finally determined to be: 50℃ for 2 minutes, 1 cycle; 95℃ for 5 minutes, 1 cycle; 94℃ for 15 seconds → 60℃ for 35 seconds (collect fluorescence), 40 cycles.
[0031] The optimal concentration was determined by comparing amplification efficiency, fluorescence signal intensity, and Ct value under different concentration ratios. Results showed that when the PJ-F1 / R1 primer concentration was 0.4 μM (10 pmol / 25 μL), the PJ-P1 probe concentration was 0.2 μM (5 pmol / 25 μL), the internal standard primer concentration was 0.32 μM (8 pmol / 25 μL), and the internal standard probe concentration was 0.12 μM (3 pmol / 25 μL), the amplification curve showed a clear inflection point and strong fluorescence signal, which is the preferred concentration for this invention (e.g., ...). Figure 1 (As shown) Example 3: Sensitivity Detection The artificially synthesized PJ gene amplification fragment was ligated into the PUC118 vector, transformed into the Escherichia coli host colony DH5a, positive clones were selected for sequencing verification, and then cultured in a large scale. M13KO7 phage particles were added to the culture product for infection, producing DNA phages wrapped with single-stranded DNA and released into the culture medium. The phages were purified from the culture medium by PEG precipitation to obtain the PJ pseudovirus. After determining the PJ pseudovirus concentration using the standard curve method, it was diluted with TE buffer to a concentration of 5.00E+09 copies / ml and stored. The stored PJ pseudovirus was then serially diluted 10-fold with TE buffer to obtain test samples with concentrations of 5.00E+06, 5.00E+05, 5.00E+04, 5.00E+03, and 5.00E+02 copies / ml. After nucleic acid extraction, 4 μL of each concentration was used as a template for detection using the optimal system determined in Example 2. The results showed that the method of this invention could still stably detect samples with a concentration of 5.00E+02 copies / mL (detection rate ≥95%), indicating that it has high sensitivity (e.g., ...). Figure 2 (As shown).
[0032] Example 4: Specificity Detection Nucleic acid samples from common respiratory or lung infection pathogens were selected as specific interference samples for testing, including Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pneumoniae, Haemophilus influenzae, Legionella pneumophila, Mycobacterium tuberculosis, Acinetobacter baumannii, Serratia marcescens, Corynebacterium striatum, Klebsiella pneumoniae, Stenotrophomonas maltophilia, Chlamydia psittaci, human herpesvirus type 1, Epstein-Barr virus, cytomegalovirus, Aspergillus fumigatus, and Aspergillus flavus. The concentration of these viruses was approximately 10. 5 copies / mL, bacterial and fungal concentration of 10 6 copies / mL. Results showed that the FAM channel of the aforementioned specific interfering samples exhibited no amplification curve, while the VIC channel amplification curve was normal, with no overlap with the aforementioned specific samples. This method demonstrates high specificity (e.g., copies / mL). Figure 3 (As shown).
[0033] Example 5: Repeatability Detection Pseudoviruses at concentrations of 1.00E+05 copies / ml and 1.00E+03 copies / ml were selected for testing, with each sample repeated 10 times; the test results are as follows. Figure 4 As shown, the coefficients of variation of Ct values for the two different concentrations of pseudoviruses detected 10 times were both less than 5%, indicating good repeatability. Example 6: UDG Anti-pollution Verification Take the order of magnitude 10 3 The amplification product at copies / mL was used as the source of contamination for detection. The test was repeated 10 times, and the results were as follows: Figure 5 As shown, neither the FAM nor VIC channels showed an amplification curve, and the test results were all negative, indicating that the invention can prevent contamination by previous PCR amplification products.
[0034] Example 7: Clinical Sample Testing Nucleic acid extraction from test samples: (1) Nucleic acid extraction from clinical test samples Thirty samples were collected from clinically diagnosed cases of Pneumocystis jirovecii (including 15 sputum samples and 15 bronchoalveolar lavage fluid samples, of which 17 were positive and 13 were negative). Nucleic acid samples were extracted from these samples to obtain nucleic acid samples (positive control (prepared from PJ pseudovirus) and negative control (prepared from physiological saline) were extracted simultaneously). 4 μL of nucleic acid sample was used to prepare a PCR reaction system, and amplification was performed in a real-time fluorescence PCR instrument. The fluorescence channels were selected sequentially as FAM and VIC. The PCR amplification program is as follows. 50℃, 2 min, 95℃, 5 min; 1 cycle 94℃, 15 sec, 60℃, 35 sec (collect fluorescence); 40 cycles.
[0035] After PCR, the negative or positive result of the corresponding pathogen nucleic acid is determined by the different fluorescence channel curves and Ct values. (If the FAM detection channel of the tested sample has no amplification curve, but the VIC channel has an amplification curve and the Ct value is ≤35, the sample can be judged as PJ negative; if the FAM detection channel of the tested sample has an amplification curve and the Ct value is ≤38, and the VIC detection channel has or does not have an amplification curve, the sample can be judged as PJ positive.) Of the 30 clinical samples tested, 17 positive samples all tested positive, and 13 negative samples all tested negative. Typical test results are as follows: Figure 6 As shown.
[0036] The test results were consistent with the clinical diagnosis results, indicating that the detection accuracy of the detection system of the present invention reached 100%, further proving the clinical detection accuracy of the detection system of the present invention.
[0037] It should be noted that, for the sake of simplicity, the foregoing embodiments are all described as a series of actions. However, those skilled in the art should understand that the present invention is not limited to the described order of actions, as some steps may be performed in other orders or simultaneously according to the present invention. Furthermore, those skilled in the art should also understand that the embodiments described in the specification are preferred embodiments, and the actions and modules involved are not necessarily essential to the present invention.
[0038] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on these embodiments, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art can still combine, add, delete, or otherwise adjust the features of the various embodiments of the present invention according to the circumstances without conflict or creative effort, thereby obtaining different technical solutions that do not fundamentally depart from the concept of the present invention. These technical solutions also fall within the scope of protection of the present invention.
Claims
1. A primer probe combination for specifically detecting Pneumocystis jirovecii, characterized by, The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO: 1; The downstream primer comprises a nucleotide sequence as shown in SEQ ID NO: 2; and The probe comprises a nucleotide sequence as shown in SEQ ID NO: 3, and is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. The 5' end fluorescent reporter group of the probe is FAM, and the 3' end fluorescent quencher group is BHQ-1.
2. The primer probe combination for specifically detecting Pneumocystis jirovecii according to claim 1, wherein The primer-probe combination of claim 1.
3. A kit for detecting Pneumocystis jirovecii, characterized in that, The kit further comprises an internal standard system comprising an internal standard template, and an upstream primer, a downstream primer and a probe specific for amplifying the internal standard; 4. The kit for detecting Pneumocystis jirovecii according to claim 3, characterized in that, The internal standard template is a fragment of a conserved region of the Carica papaya genome; The internal standard probe is labeled with a fluorescent reporter group of a different color from the probe of claim 1. The nucleotide sequence of the internal standard upstream primer is shown in SEQ ID NO: 4; 5. The kit for detecting Pneumocystis jirovecii according to claim 1, characterized in that, The nucleotide sequence of the internal standard downstream primer is shown in SEQ ID NO: 5; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:
6. The kit further comprises a PCR reaction solution comprising a hot-start Taq DNA polymerase, dNTPs, Mg2+, a reaction buffer, uracil DNA glycosylase and a stabilizer; the dNTPs comprise dUTP.
6. The kit for detecting Pneumocystis jirovecii according to claim 1, characterized in that, The primer-probe combination of any one of claims 1-2 or the kit of any one of claims 3-6 is used to perform real-time fluorescent PCR amplification using the nucleic acid of the sample to be tested as a template, and the presence or absence of P. jirovecii nucleic acid in the sample is determined by detecting specific fluorescent signals.
7. A method for detecting Pneumocystis jirovecii nucleic acid for a non-diagnostic purpose, characterized by, In the reaction system of the real-time fluorescent PCR, the final concentrations of the primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 are each 0.2-0.8 μM, the final concentration of the probe shown in SEQ ID NO: 3 is 0.1-0.4 μM, the final concentrations of the primers shown in SEQ ID NO: 4 and SEQ ID NO: 5 are each 0.2-0.8 μM, and the final concentration of the probe shown in SEQ ID NO: 6 is 0.1-0.4 μM.
8. The method for detecting Pneumocystis jirovecii nucleic acid for non-diagnostic purposes according to claim 7, characterized by, The reaction procedure of the real-time fluorescent PCR comprises first incubation at 50℃, then pre-denaturation at 95℃, followed by 40-50 cycles of amplification, each cycle comprising a denaturation step at 94-95℃ and an annealing / extension step at 58-62℃, and the fluorescent signal is collected during the annealing / extension step.
9. The method for detecting Pneumocystis jirovecii nucleic acid for non-diagnostic purposes according to claim 7, characterized by, 10. Use of the primer-probe combination of any one of claims 1-2 or the kit of any one of claims 3-6 in the preparation of a product for detecting P. jirovecii.