Bovine viral diarrhea virus CTL epitope polypeptide and application thereof
By screening and identifying BVDV CTL epitope peptides specific to the bovine MHC-I allele, the problem of existing vaccines failing to provide cross-protection has been solved, enabling the preparation of a vaccine with high safety and specificity, and effectively controlling bovine viral diarrhea.
Patent Information
- Application Number
- CN202511661793.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-02-24
AI Technical Summary
Existing bovine viral diarrhea virus (BVDV) vaccines are insufficient to provide broad cross-protection, and vaccination of persistently infected cattle (PI cattle) with live vaccines may lead to abortion or biocontamination. BVDV is prone to gene mutation and recombination, and existing CTL epitope information is insufficient, resulting in low predictive accuracy.
Two bovine MHC-I (BoLA-I) allele-specific BVDV CTL epitope peptides (SEQ ID No. 1 and SEQ ID No. 2) were screened and identified, and were further identified using a combination of PRLD-MS and MAE assay. These peptides were then synthesized or biologically expressed for use in the preparation of vaccines or drugs, forming complexes with BoLA-I molecules.
It provides a highly safe and specific BVDV-specific antigenic epitope vaccine that can stimulate the body to produce a CTL immune response, effectively kill virus-infected cells, and control bovine viral diarrhea.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of polypeptide vaccine preparation technology, specifically relating to bovine viral diarrhea virus CTL epitope polypeptides and their applications. Background Technology
[0002] Bovine viral diarrhea virus (BVDV) is one of the pathogens causing huge economic losses to the livestock industry. It can cause digestive system diseases such as anorexia, gastrointestinal erosion, and diarrhea; respiratory system diseases such as serous discharge from the nasal cavity and eyes; reproductive system diseases such as abortion, stillbirth, and birth defects; and immunosuppression. The global antigen positivity rate and antibody positivity rate are both very high, and it causes serious contamination of biological products. BVDV contamination has been detected in various fetal bovine serum, cell lines, vaccines, and semen.
[0003] Persistently Infected (PI) cattle often exhibit mild or no symptoms, do not produce antibodies, and shed the virus for life, leading to widespread BVDV transmission and making prevention and eradication difficult. PI cattle are primarily caused by non-cytopathic (NCP) BVDV infection in fetuses aged 25–120 days of gestation. One-third of the virus enters the fetal liver via the umbilical vein, infecting Kupffer cells, while two-thirds cross the placental barrier through direct cell-to-cell transmission, causing the fetus to recognize BVDV as its own antigen. Currently, only some live attenuated vaccines can induce strong cellular immunity sufficient to kill the virus and protect the fetus. However, vaccination of pregnant animals with live BVDV vaccines may cause fetal damage, miscarriage, or persistent infection, and carries risks of virus shedding and biocontamination. Furthermore, vaccination of PI cattle with live cytopathic (CP) BVDV vaccines may cause mucosal diseases and only provides cross-protection against some other genotypes. Because BVDV is prone to gene mutation and recombination, besides BVDV-3 (which has not yet been included in the Virus Taxonomy Committee) discovered in recent years, there are two other genotypes: BVDV-1 and BVDV-2. BVDV-1 is divided into 22 subtypes (1a–1v), and BVDV-2 is divided into four subtypes (2a–2d). Most subtypes are distributed in China. These subtypes have significant antigenic differences, making vaccines made from a single strain unlikely to provide protection. Therefore, to ensure that vaccines provide cross-protection against different BVDV strains, it is necessary to identify conserved cytotoxic T lymphocyte (CTL) epitopes among different BVDV strains.
[0004] BVDV's CTL epitope peptide is presented to CD8 via MHC-I. +Only after T cells are activated can they effectively kill virus-infected target cells. The MHC-I immunopeptidome is a collection of peptides presented by MHC-I. Peptide data obtained through MHC-I binding affinity and mass spectrometry identification have been used in MHC-I immunopeptidome and CTL epitope prediction. However, data on bovine MHC-I genes and their MHC-I immunopeptidome are scarce, resulting in extremely low prediction accuracy and limited practical significance. Therefore, obtaining accurate BVDV CTL epitope information has significant theoretical and applied value. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide bovine viral diarrhea virus CTL epitope polypeptides.
[0006] The bovine viral diarrhea virus CTL epitope polypeptide provided by this invention is as follows: A1), A2), or A3). A1) The amino acid sequence of the polypeptide is SEQ ID No. 1 or SEQ ID No. 2; A2) A polypeptide having more than 80% identity with and the same function as A1) by substitution and / or deletion and / or addition of one or two amino acid residues of the sequence of SEQ ID No. 1 or SEQ ID No. 2; A3) is a fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).
[0007] In the polypeptides described in A2) above, having more than 80% identity means having 80%, 85%, 90%, or 95% or more identity. Identity refers to the identity of the amino acid sequence. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0008] The polypeptides in A2 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0009] The tag described in A3) can be a polypeptide or protein fused with the target polypeptide using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target polypeptide. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.
[0010] The present invention also provides biomaterials related to the said polypeptide, said biomaterials being any one of B1) to B4) below: B1) A nucleic acid molecule encoding the polypeptide; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
[0011] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0012] Those skilled in the art can readily mutate the nucleotide sequence encoding the polypeptide of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the polypeptide isolated in the present invention, as long as they encode the polypeptide and have the function of the polypeptide, are derived from and equivalent to the nucleotide sequence of the present invention.
[0013] B2) The expression cassette (peptide gene expression cassette) containing a nucleic acid molecule encoding the polypeptide refers to DNA capable of expressing the polypeptide in a host cell. This DNA may include not only a promoter to initiate transcription of the polypeptide gene but also a terminator to terminate transcription of the polypeptide gene. Furthermore, the expression cassette may also include an enhancer sequence.
[0014] Recombinant vectors containing the polypeptide gene expression cassette can be constructed using existing expression vectors.
[0015] The vector may be a plasmid, granule, bacteriophage, or viral vector.
[0016] The microorganisms may be yeast, bacteria, algae, or fungi.
[0017] The present invention also provides a product containing (or having its active ingredient as) the polypeptide or the biomaterial.
[0018] Specifically, the product in question is a vaccine or a drug.
[0019] The application of the polypeptide or the biomaterial in the preparation of products for the treatment and / or prevention of bovine viral diarrhea virus infection is also within the scope of protection of this invention.
[0020] Specifically, the product in question is a vaccine or a drug.
[0021] The application of the polypeptide or the biomaterial in enhancing the production of CD8+ T cells in the body, or in the preparation of CD8+ T cells, is also within the scope of protection of this invention.
[0022] The application of the polypeptide or the biomaterial in the preparation of bovine viral diarrhea virus antibodies is also within the scope of protection of this invention.
[0023] The application of the polypeptide or the biomaterial in the preparation of bovine viral diarrhea virus antiserum is also within the scope of protection of this invention.
[0024] The application of the polypeptide or the biomaterial in the preparation of reagents or kits for detecting bovine viral diarrhea virus is also within the scope of protection of this invention.
[0025] The complex formed by the polypeptide and the BoLA-I molecule is also within the scope of protection of this invention.
[0026] This invention employs a combination of PRLD-MS and MAE methods to screen and identify 16 BVDV CTL epitope peptides. The obtained peptides possess the ability to initiate CD8. + T cells generate an immune response and stimulate the body to specifically produce CTLs. Specifically, BVDV CTL epitope polypeptide 1, shown in SEQ ID No. 1, strongly binds to BoLA-2*048:01; BVDV CTL epitope polypeptide 2, shown in SEQ ID No. 2, binds to BoLA-2*099:01. The two BVDV CTL epitope polypeptides of this invention can be used to prepare bovine viral diarrhea-specific antigenic epitope vaccines or polypeptide vaccines, exhibiting high safety and specificity, laying the foundation for the prevention and control of bovine viral diarrhea.
[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description
[0028] Figure 1 Crystallization of pBoLA-I with BoLA-2*048:01 and epitope peptide 1 under different growth conditions. A represents crystallization of the pBoLA-I complex at a concentration of 2 mg / mL, grown for 52 days at 4°C in a solution of 0.24 M Sodium acetate trihydrate + 22% Polyethylene glycol 4000 + 0.1 M TRIS hydrochloride at pH 8.5; B represents crystallization of the pBoLA-I complex at a concentration of 3.76 mg / mL, grown for 52 days at 4°C in a solution of 0.2 M Sodium chloride + 25% w / v Polyethylene glycol 3350 + 0.1 M Tris at pH 8.5; C represents crystallization of the pBoLA-I complex at a concentration of 3.76 mg / mL, grown for 52 days at 4°C in a solution of 0.2 M Trimethylamine N-oxide dihydrate + 20% w / v Polyethylene glycol monomethyl ether 2000 + 0.1 M Tris at pH 8.5.
[0029] Figure 2 The killing ability of BVDV CTL epitope polypeptide 1 to specific T cells.
[0030] Figure 3 The killing ability of BVDV CTL epitope polypeptide 2 to specific T cells. Detailed Implementation
[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.
[0032] In the quantitative experiments described below, at least three replicates were performed. Statistical software was used to process the data in these embodiments, and the replicate data are expressed as mean ± standard deviation.
[0033] Example 1: Obtaining BVDV CTL epitope peptide In the MHC-I immunopeptide isolation method, the Mild acid elution (MAE) method utilizes the characteristic that a buffer solution with pH=3.0 or pH=3.3 can elute only MHC-I ligands without eluting MHC-II ligands to elute peptides bound to pMHC-I on the cell surface. The collected peptides are then identified by LC-MS. However, the peptides eluted by the MAE method still contain some non-specific impurity peptides. The applicant used a scheme combining random peptide library-mass spectrometry de novo sequencing (PRLD-MS) with the MAE method to screen and identify two BVDV CTL epitope peptides (denoted as BVDV CTL epitope peptide 1 and BVDV CTL epitope peptide 2, respectively), and their sequences are shown in SEQ ID No. 1 and 2.
[0034] I. Identification of peptide-binding motifs and peptide length preferences of bovine MHC-I (BoLA-I) alleles using PRLD-MS method The following method was used to identify the peptide binding motif and peptide binding length preference of the bovine MHC-I (BoLA-I) allele using PRLD-MS: The codons of the extracellular regions of the heavy chain α1–α3 of the BoLA-I alleles BoLA-2*048:01 and BoLA-2*099:01 were optimized to sequences suitable for expression in *E. coli* (as shown in SEQ ID No. 4 and 5, respectively). These genes were then synthesized to construct the recombinant prokaryotic expression plasmids pET-30a-BoLA-2*048:01 and pET-28a-BoLA-2*099:01. Furthermore, the codons of the extracellular region of the BoLA-I light chain were optimized to sequences suitable for expression in *E. coli* (as shown in SEQ ID No. 6). This gene was then synthesized, and the pET-30a recombinant expression plasmid pET-30a-BoLA-I-β2m was constructed.
[0035] pET-30a-BoLA-2*048:01: This recombinant plasmid is obtained by inserting the DNA fragment shown in SEQ ID No. 4 between the multiple cloning sites of pET-30a(+). The recombinant plasmid is able to express the extracellular regions of α1 to α3 of the BoLA-I heavy chain.
[0036] pET-28a-BoLA-2*099:01: This recombinant plasmid is obtained by inserting the DNA fragment shown in SEQ ID No. 5 between the multiple cloning sites of pET-28a(+). The recombinant plasmid is able to express the extracellular regions of α1 to α3 of the BoLA-I heavy chain.
[0037] pET-30a-BoLA-I-β2m: This recombinant plasmid is obtained by inserting the DNA fragment shown in SEQ ID No. 6 between multiple cloning sites of pET-30a(+). The plasmid is able to express the extracellular region of the BoLA-I light chain.
[0038] Extracellular regions of heavy chain α1-α3 in BoLA-2*048:01: atgGGTTCTCACAGCCTGCGTTACTTCTACACCGCAGTGAGCCGTCCAGGTCTGGGTGAACCGCGTTTCATCTCCGTTGGTTACGTTGACGACACTCAGTTCGTGCGTTTCGACTCTGATTCCGCAAATCCGCGTGAAGAACCACGTGCACCGTGGATGGAACAAGAAGGTCCGGAATACTGGGACGAACAGACTCGTATCGTTAAAGATACCGCACAGAGCTTCCGTGTAGGTCTGAACACTCTGCGTGGCTACTATAACCAGTCCGAAGCGGGTTCTCATACCTTGCAGCTGATGTACGGTTGCGATGTAGGTCCAGATGGTCGCTTTCTGCGTGGTTTCATGCAAGACGCTTACGATGGTCGTGATTACATCGCTCTGAACGAAGACCTGCGTTCTTGGACCGCTGCTGACACTGCTGCTCAGATCACCAAACGTAAACGTGAAGCTGCTGGTGCTGCTGAACGTCAGCGTAACTACCTGGAAGGTCGTTGTGTTGAAGGTCTGCGTCGTTACCTGGAAAACGGTAAAGACGCTCTTCTGCGTGCAGATCCACCGAAAGCTCACGTGACTCACCATCCAATCTCTGAACGTGAAGTTACTCTGCGCTGTTGGGCTCTGGGTTTCTACCCGGAAGAAATCTCTCTGACCTGGCAGCGTGAAGGTGAAGATCAGACTCAAGACATGGAACTGGTTGAAACTCGTCCGTCTGGTGACGGCACCTTCCAGAAATGGGCTGCTCTGGTTGTACCGTCCGGTGAAGAACAGCGTTACACCTGCCGTGTTCAGCACGAAGGTCTGCAAGAACCGCTGACTCTGCGTTGGGAACCACCGCAGACCAGCTTCTAA(SEQ ID No.4)。
[0039] The extracellular regions α1-α3 of the heavy chain of BoLA-2*099:01: atgGGCTCTCACAGCCTTCGTTACTTCTACACCGGCGTTTCTCGTCCAGGTCTGGGTGAACCACGTTTCATCGCGGTTGGTTACGTTGACGACACTCAGTTCGTTCGTTTCGACTCTGATGCTCCAGATCCGCGTACCGAACCACGTGTTCGTTGGGTTGAACAAGAAGGTCCGGAATACTGGGACCGTGAAACCCGTAACCTGAAAGACGCAGCTCAGACCTTCCGTGTTAACCTGAACACCGCACTGGGTTACTACAACCAGTCTGAAGCAGGTTCTCACACCATCCAGGCTATGTACGGTTGCGATGTTGGTCCAGACGGTCGTCTGCTGGGTGGTTTCATGCAAGACGCTTACGACGGTCGTGACTACATCGCTCTGAACGAAGACCTGCGTAGCTGGACCGCAGCTGATACCGCAGCGCAGATCACCAAACGTAAATGGGAAGCGGAAGGTTACGCGGAAGTTCAGCGTAACTACCTGGAAGGTGAATGCGTTGAATGGCTTCGTCGTTACCTGGAAACTGGTAAAGACACCTTGCTGCGTGCTGATCCACCGAAAGCGCACGTTACTCACCATCCGATCTCTGAACGCGAAGTTACTCTGCGTTGCTGGGCACTGGGTTTCTATCCAGAAGAAATCAGCCTGACCTGGCAGCGTGAAGGTGAAGATCAGACTCAGGACATGGAACTGGTTGAAACTCGTCCATCCGGTGATGGTACTTTCCAGAAATGGGCGGCACTGGTTGTTCCGTCTGGTGAAGAACAGCGTTACATGTGCCGTGTACAGCACGAAGGTCCGCAAGAACCGCTGACTTTGCGTTGGGAACCACCGCAGACCAGCTTCTAA(SEQ ID No.5)。
[0040] Extracellular region of BoLA-I light chain: atgATCCAGCGTCCGCCGAAGATCCAGGTGTACTCTCGTCATCCGCCAGAAGATGGTAAACCGAACTACCTGAACTGCTACGTTTACGGTTTCCATCCGCCACAGATCGAAATCGACCTGCTGAAGAACGGTGAGAAGATCAAATCCGAACA GTCTGACCTGTCTTTCTCTAAAGATTGGTCTTTCTACCTGCTGTCTCACGCAGAGTTCACTCCGAACTCTAAAGACCAGTACTCTTGCCGTGTTAAACACGTTACTCTGGAACAGCCACGTATCGTGAAATGGGACCGTGACCTGTAA (SEQ ID No. 6).
[0041] The heavy chain expression recombinant plasmid (pET-30a-BoLA-2*048:01 or pET-28a-BoLA-2*099:01) and the light chain expression recombinant plasmid pET-30a-BoLA-I-β2m were introduced into E. coli, respectively. The expression of the target protein was induced by IPTG, and the inclusion body proteins were extracted by sonication and inclusion body extraction buffer to obtain the heavy chain and light chain proteins of BoLA-I.
[0042] BoLA-I light chain protein and randomly synthesized peptides (8-11 amino acids in length, excluding cysteine) were sequentially diluted and refolded with BoLA-I heavy chain protein in equimolar amounts. The peptide-MHC-I complex was then purified by molecular sieve and ion exchange. The peptide was eluted with pure acetic acid at 65°C for 30 min using 0.02 N mass spectrometry. The eluent was desalted using an OASIS HLB 1CC 30MG 100BX desalting column, filtered through a 0.5 mL 3 kD ultrafiltration tube, and the filtrate was evaporated to dryness using a vacuum concentrator. The sample was reconstituted in 15 μL volume for LC-MS and DeNovo analysis. Peptides with ALC ≥ 30% and lengths of 8 to 11 amino acids were selected for analysis of the length distribution of each BoLA-I-bound peptide. A peptide binding map was constructed using Seq2Logo-2.0 to analyze the peptide binding motifs and length preferences for each BoLA-I-bound peptide. The results showed that BoLA-2*048:01 binds to peptides with a length preference of 9 amino acids, followed by peptides with a length of 10 amino acids, then peptides with a length of 11 amino acids, and finally peptides with a length of 8 amino acids. The binding peptide preference was consistently that the second P2 motif preferred to bind H / N / G, and the last Pc motif preferred to bind W / Y / F. BoLA-2*099:01 binds to peptides with a length preference of 8 or 9 amino acids, followed by peptides with a length of 10 amino acids, and then peptides with a length of 11 amino acids. After molecular sieve purification, no obvious binding preference was observed. After molecular sieve and ion exchange purification, the binding peptide preference showed that the last Pc motif preferred to bind W / Y / T.
[0043] II. Identification of MHC-I Immunopeptides Using the MAE Method The method for identifying MHC-I immunopeptides using the MAE method is as follows: Peripheral blood of 30 mL was collected from three randomly selected dairy cows (numbered 200295, 200297, and 200300, of which 200300 was identified as infected with BVDV genotype 1, while 200297 and 200300 were not infected with BVDV). Peripheral blood lymphocytes (PBMCs) were isolated using Leucosep™ separation tubes with separation solution and treated with 4 mL of MAE buffer (composed of 131 mM citrate, 66 mM Na2HPO4, 150 mM NaCl, Halt™ protease and phosphatase inhibitor single-use mixture without EDTA (100X) and 25 mM iodoacetamide, adjusted to pH=3.0 with NaOH) for 1 min. All liquids were collected and centrifuged at 300 g for 5 min, 350 g for 10 min, 3400 g for 15 min, and 20000 g for 1 h. The supernatants were collected sequentially and then filtered through a 0.5 mL 3 kD ultrafiltration tube and desalted using an OASIS HLB 1CC 30MG 100BX desalting column. After vacuum concentrating to dryness, the samples were reconstituted in 12 μL and analyzed by LC-MS. The BVDV, Bos taurus, and Equus caballus proteins in the UniProt database were used for database search. The mixed BVDV CTL epitope polypeptides naturally presented by BVDV genotype 1 infected cows (number 200300) were identified, while cows without BVDV infection (numbers 200295 and 200297) only presented bovine antigens, as shown in Tables 1 and 2.
[0044] Table 1. Isolation results of MHC-I immunopeptides from three dairy cows
[0045] In Table 1, the numbers represent the number of single peptides matched when searching the LC-MS database, and the numbers in parentheses represent the total number of matches.
[0046] Table 2. Results of CTL epitope polypeptide isolation from BVDV genotype 1 infected cattle (No. 200300)
[0047] In Table 2, the numbers represent the number of times the CTL epitope peptide of BVDV was matched during the LC-MS database search.
[0048] III. Identification of BVDV CTL epitope peptides The method for identifying the binding affinity of BVDV CTL epitope peptides is as follows: Based on the peptide binding motif and binding peptide length preference of BoLA-I obtained in step one, peptides conforming to the BoLA-1 allele motif were screened from the naturally presented mixed BVDV peptides obtained in step two for artificial synthesis. Three peptides were synthesized (denoted as candidate BVDV CTL epitope peptide 1 to candidate BVDV CTL epitope peptide 3, with sequences shown in SEQ ID No. 1 to 3, respectively). These peptides were in vitro renatured with the corresponding heavy and light chains of BoLA-I. Those capable of forming stable epitope peptide-BoLA-I complexes were screened and collected by molecular sieve and ion exchange as BVDV CTL epitope peptides, resulting in two BVDV CTL epitope peptides (denoted as BVDV CTL epitope peptide 1 and BVDV CTL epitope peptide 2, respectively), with sequences shown in SEQ ID No. 1 and 2, respectively.
[0049] SEQ ID No. 1: SHKPVPTRW.
[0050] SEQ ID No. 2: SLKKPVLGW.
[0051] SEQ ID No. 3: SEKDSVTKPP.
[0052] The binding affinity of epitope peptides to BoLA-1 was further evaluated using a 250 mL refolding system based on their tolerance to molecular sieves and ion exchange, as well as the content of the complex: peptides with a molecular sieve complex peak above 60 mAU and tolerance to ion exchange were considered strongly bound; those with a molecular sieve complex peak below 60 mAU and tolerance to ion exchange were considered moderately bound; those bound to molecular sieves but not tolerant to ion exchange were considered weakly bound; and those intolerant to both molecular sieves and ion exchange were considered non-bound. The steps are as follows: Prepare a 250 mL refolding solution containing 50 mM Tris pH 8.0, 200 mM L-arginine, 1 mM EDTA, 0.3827 g of reduced glutathione, and 0.0766 g of glutathione. In 250 mL of refolding solution, 1.5 mL of β2m inclusion body solution (i.e., the extracellular region of BoLA-I light chain obtained in step one) was added dropwise to the refolding solution. After refolding for 12 h, 1 mg of BVDV CTL epitope peptide dissolved in DMSO was added. After thorough mixing, 4.5 mL of BoLA-I α chain inclusion body solution (i.e., the extracellular region of BoLA-I heavy chain α1-α3 obtained in step one) was added dropwise for refolding. The molar ratio of heavy chain, light chain and BVDV CTL epitope peptide was 1:1:5. After refolding for 24 h, the solution was concentrated to below 20 mL. The solution was then replaced with molecular sieve (20 mM Tris-HCl pH 8.0, 50 mM NaCl) and highly concentrated to below 10 mL. The pBoLA-I complex was initially purified by molecular sieve gel column chromatography (HiLoad® 16 / 600 Superdex® 200 pg), and samples were taken for SDS-PAGE purity identification.
[0053] For complexes with good molecular sieve gel chromatography results, further purification was performed by ion exchange chromatography (Resource Q, GE), and samples were taken for SDS-PAGE purity identification to detect the stability of the binding of BVDV CTL epitope peptide to BoLA-I molecules.
[0054] Using BoLA-2-2 and BoLA-3-1 as controls, the DNA sequences of BoLA-2-2 and BoLA-3-1 are SEQ ID No. 7 and SEQ ID No. 8, respectively.
[0055] The DNA sequence of BoLA-2-2: atgGGTTCTCACTCTCTGCGTTACTTCTACACTGCGGTTTCTCGTCCAGGTCTGGGTGAACCGCGTTTCATCGCGGTTGGTTACGTTGACGACACTCAGTTCACTCGTTTCGATTCCGATGCGCCAAATCCGCGTGACGAACCACGTGTGCCGTGGATGGAACAAGAAGGTCCGGAATACTGGGACCGTAACACTCGTATCTACAAAGACACTGCGCAGATCTTCCGTGCTAACCTGAACACTGCGCTGGGTTACTATAACCAGTCTGAAGCAGGTAGCCACACTTTCCAAGAAATGTACGGCTGCTATGTAGGTCCGGATGGTCGTCTGCTGCTGGGCTTCATGCAGTTCGCTTACGATGGCCGTGATTACATCGCGCTGAACGAAGACCTCCGTAGCTGGACCGCGGCTGACACCGCTGCTCAGATCACCAAACGTAAATGGGAAGCTGCAGGTGAAGCAGAACGTCAGCGTAACTACCTGGAAGGTCGTTGCGTTGAAGGCCTGCGTCGTTACCTGGAGAACGGTAAAGACACTCTGCTGCGTGCAGATCCACCGAAAGCGCATGTGACTCACCATCCGATCTCTGATCGTGAAGTTACCTTGCGTTGCTGGGCGCTGGGTTTCTATCCGGAAGAAATCAGCCTCACCTGGCAGCACGAAGGTGAAGATCAGACTCAAGACATGGAACTGGTTGAAACTCGTCCGTCCGGTGACGGTACTTTCCAGAAATGGGCTGCGCTGGTTGTACCGTCTGGTGAAGAACAGCGTTACACCTGCCGTGTTCAGCACGAAGGCCTGCAAGAACCGCTGACTCTGCGTTGGGAACCGCCTCAGACCAGCTTCTAA (SEQ ID No.7).
[0056] DNA sequence of BoLA-3-1: atgGGTTCTCACTCTATGCGTTACTTCTACACTGCTGTTAGCCGTCCGGGTCTGGGTGAACCGCGTTACCTGGAAGTTGGCTACGTTGACGACACTCAGTTCGTTCGTTTCGACAGCGATGCGCCGAATCCACGTATGGAACCGCGTGCACGTTGGGTTGAACAAGAAGGTCCGGAATACTGGGATCAAGAAACTCGTAAAGCGAAAGGTACTGCACAGACCTTCCGTGCTAACCTGAACATCGCTCTGGGTTACTACAACCAGTCTGAAGCTGGCTCTCACACCTTCCAGTGGATGTACGGTTGTGATGTTGGTCCAGACGGTCGTCTGCGTCGTGGTTTCATGCAGTACGGCTACGATGGTCGTGACTACATCGCTCTGAACGAAGACCTGCGTAGCTGGACTGCTGCTGATACCGCTGCACAGATCACCAAACGCAAATGGGAAGCTGCTGGCGAAGCAGAACGTCAGCGTAACTACCTGGAGGGTACTTGCGTTGAATGGCTGCGTCGTTACCTGGAAACCGGCAAAGACACTCTGCTGCGTGCAGATCCGCCAAAGGCGCACGTTACTCACCACTCCATCAGCGGTCACGAAGTTACCTTGCGTTGTTGGGCACTGGGCTTCTATCCGGAAGATATCTCTCTGACCTGGCAGCGTAACGGCGAAGACCAGACGCAAGATATGGAACTGGTAGAAACTCGTCCGTCTGGCGATGGCAACTTCCAGAAATGGGCCGCTCTGGTAGTGCCGTCTGGTGAAGAACAGAAATACACCTGCCGTGTGCAGCACGAAGGTCTGCAAGAACCACTGACCTTGAAATGGGAACCGCCACAGCCGTCTTTCTAA(SEQ ID No.8)。
[0057] The results showed that BoLA-2*048:01 and BoLA-2-2 strongly bound to BVDV CTL epitope polypeptide 1; BoLA-2*099:01 moderately bound to BVDV CTL epitope polypeptide 2; BoLA-2*048:01 weakly bound to BVDV CTL epitope polypeptide 2; and BoLA-3-1 did not bind to BVDV CTL epitope polypeptide 3.
[0058] IV. Obtaining pMHC-I crystals of BVDV CTL epitope peptides and annealing temperature (1) Point crystal Crystallization experiments were performed using 486 reagents from 9 different crystallization kits (Hampton Research's PEG / LON SCREEN (HR2-126), PEG / LON2 SCREEN (HR2-098), Crystal Screen (HR2-110), Crystal Screen 2 (HR2-112), Natrix (HR2-116), and Index (HR2-144); Molecular Dimensions' The Structure Screen Combination (MD1-03), 3D Structure Screen (MD1-13), and JCSG-plus™ (MD1-37)). To minimize reagent evaporation during addition, the experiments were conducted at 18°C. Different crystallization reagents were added sequentially to each well of the protein crystallization plate, 160 μL per well. The plates were then sealed with crystallization tape and stored at 4°C for later use.
[0059] The purified epitope peptide-pMHC-I complex was transferred to a 15 mL 10 kD ultrafiltration tube and concentrated to below 200 μL by continuous centrifugation at 4800×g at 4°C. After replacing with a suitable molecular sieve buffer for crystallization, the concentration was further concentrated to below 200 μL. Protein concentration was determined using the BCA method, and then diluted to 4 and 8 mg / mL with molecular sieve buffer for the initial spotting of the crystallization kit. The ambient temperature during spotting should be maintained at 18°C. Two small wells are provided above each pooling solution for spotting. 1 μL of protein solution is evenly spotted into each well. Then, 1 μL of the corresponding pooling solution is spotted onto the sample. The plate is then sealed with crystallization tape and incubated at 4°C. Crystallization is observed once a week, using the pooling solution as a positive control to distinguish between reagent crystallization and protein crystallization.
[0060] (2) Optimization of crystallization conditions When the resulting crystals are not all single crystals, the spotting concentration, crystallization temperature, and crystallization reagent need to be optimized. Spotting concentrations were approximately 2, 4, 8, and 16 mg / mL; crystallization temperatures were 4℃ and 18℃; and checkerboard optimization design for reagent salt ion concentration and precipitant concentration was performed using software (https: / / hamptonresearch.com / make-tray.php). The obtained crystals are as follows... Figure 1 As shown, BoLA-2*048:01 and BVDV CTL epitope polypeptide 1 formed pBoLA-I crystals with different morphologies under three different concentrations and growth conditions, indicating that the complex binding is stable and the purity meets the standard.
[0061] (3) Circular dichroism spectroscopy for annealing temperature 300 μL of 0.2 mg / mL epitope peptide-pMHC-I complex was obtained by diluting with molecular sieve buffer. The concentration can be slightly lower, but not higher. Circular dichroism spectroscopy was pre-purged with nitrogen for 30 min to ensure the detection pathway was not oxidized. Air was then used with default parameters before loading the molecular sieve buffer onto the instrument, and the circular dichroism values at wavelengths of 200–260 nm were measured. The sample was then pre-loaded at 25°C and scanned at 200–600 nm. The sample was officially loaded onto the instrument when the photomultiplier tube voltage (HV) was less than 600 V, with the temperature range set to 5°C–104°C and the step value set to 0.2. After detection, the sample in the quartz dish was discarded, and the sample was treated with detergent at 50°C for 5 min, followed by rinsing with pure water. Molecular sieve spectroscopy was performed again; if no obvious downward peak was observed near 218 nm, the sample was considered clean and ready for reloading. After completion, the APLData Converter software was opened, the file was dragged into the TXT file generation process, and then the software was closed. The left and right buttons were then closed, and the nitrogen valve was shut off. After subtracting the background values from the data, Origin Pro was used for fitting to obtain the annealing temperature curve. The results showed that the annealing temperature of the complex of BoLA-2*048:01 and BVDV CTL epitope peptide 1 was 60.9 ℃, and the annealing temperature of the complex of BoLA-2*099:01 and BVDV CTL epitope peptide 2 was 33.4 ℃, with the former complex being more stable.
[0062] Example 2: Detection of the cytotoxic ability of BVDV CTL epitope peptides to specific T cells I. Detection of the killing ability of BVDV CTL epitope peptide 1 specific T cells Peripheral blood was collected from cattle No. 24 and No. 69, which expressed BoLA-2-2 (DNA sequence shown in SEQ ID No. 7) after being challenged with BVDV NADL strain. PBMCs were isolated and resuspended in 10 mL of 1640 medium (containing 10% FBS). Then, BVDV CTL epitope peptide 1 was added to the medium to a final concentration of 2 μM, and the cells were stimulated for 24 h. After centrifugation, the same steps were repeated for one more round of stimulation. PBMCs were then resuspended in 1640 medium to obtain BVDV CTL epitope peptide 1-specific T cells, which were counted and used as effector cells for the next step of cytotoxicity experiments.
[0063] Detection of BVDV CTL epitope peptide 1 presented by MDBK: RNA was extracted from MDBK, genomic DNA was removed and reverse transcribed, and third-generation sequencing confirmed the presence of BoLA-2*048:01 mRNA. The binding of BoLA-2*048:01 to BVDV CTL epitope peptide 1 was verified in the third step of Example 1.
[0064] Add a final concentration of 2 μM of BVDV CTL epitope peptide 1 to the culture system of MDBK in a 96-well plate that has been verified to present BVDV CTL epitope peptide 1, and stimulate for 12 h before using them as target cells for the next step of cytotoxicity experiments.
[0065] Cytotoxicity assay: Effector cells were added to target cells at different effector-to-target ratios (E:T) and co-cultured at 37 ℃ and 5% CO2 for 12 h. The absorbance was measured, cytotoxicity was calculated, and a killing curve was plotted with the E:T ratio as the x-axis and cytotoxicity as the y-axis.
[0066] Sample group absorbance = A 450 (Experimental Group) - A 450 (Negative control group); Spontaneous release absorbance = A 450 (Spontaneous Release Group) - A 450 (Negative control group); Maximum release absorbance = A 450 (Maximum Release Group) - A 450 (Negative control group); .
[0067] The test included: negative control (culture medium only); spontaneous release group (target cells + culture medium); and maximum release group (target cells + LDH release reagent + culture medium). The LDH release reagent is from the lactate dehydrogenase (LDH) cytotoxicity assay kit (Beyotime Biotechnology).
[0068] The results are as follows Figure 2As shown, BVDV CTL epitope peptide 1-specific T cells possess sufficient cytotoxicity to kill target cells presenting BVDV CTL epitope peptide 1, and the cytotoxicity increases with the effector-to-target ratio. BVDV CTL epitope peptide 1-specific T cells can be used to kill cells infected with BVDV.
[0069] II. Detection of the killing ability of BVDV CTL epitope polypeptide 2 specific T cells Peripheral blood was collected from 73 cattle expressing BoLA-2*099:01 (DNA sequence as shown in SEQ ID No. 8) after challenge with BVDV NADL strain. PBMCs were isolated and resuspended in 10 mL of 1640 medium (containing 10% FBS). Then, BVDV CTL epitope polypeptide 2 was added to the medium to a final concentration of 2 μM, and the cells were stimulated for 24 h. After centrifugation, the same steps were repeated for one round of stimulation. PBMCs were then resuspended in 1640 medium to obtain BVDV CTL epitope polypeptide 2-specific T cells, which were counted and used as effector cells for the next step of cytotoxicity experiments.
[0070] Detection of BVDV CTL epitope peptide 2 presented by MDBK: RNA was extracted from MDBK, genomic DNA was removed and reverse transcribed, and third-generation sequencing confirmed the presence of BoLA-2*099:01 mRNA, and the binding of BoLA-2*099:01 to BVDV CTL epitope peptide 2 was verified in the third step of Example 1.
[0071] Add a final concentration of 2 μM of BVDV CTL epitope peptide 2 to the culture system of MDBK in a 96-well plate that has been verified to present BVDV CTL epitope peptide 2, and stimulate for 12 h before using them as target cells for the next step of cytotoxicity experiments.
[0072] Cytotoxicity assay: Effector cells were added to target cells at different effector-to-target ratios (E:T) and co-cultured at 37 ℃ and 5% CO2 for 12 h. The absorbance was measured, cytotoxicity was calculated, and a killing curve was plotted with the E:T ratio as the x-axis and cytotoxicity as the y-axis.
[0073] Sample group absorbance = A 450 (Experimental Group) - A 450 (Negative control group); Spontaneous release absorbance = A 450 (Spontaneous Release Group) - A 450 (Negative control group); Maximum release absorbance = A 450 (Maximum Release Group) - A 450 (Negative control group); .
[0074] The test included: negative control (culture medium only); spontaneous release group (target cells + culture medium); and maximum release group (target cells + LDH release reagent + culture medium). The LDH release reagent is from the lactate dehydrogenase (LDH) cytotoxicity assay kit (Beyotime Biotechnology).
[0075] The results are as follows Figure 3 As shown, BVDV CTL epitope peptide 2-specific T cells possess sufficient cytotoxicity to kill target cells presenting BVDV CTL epitope peptide 1, and the cytotoxicity increases with the effector-to-target ratio. BVDV CTL epitope peptide 2-specific T cells can be used to kill cells infected with BVDV.
[0076] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Polypeptide, as shown in A1), A2), or A3): A1) The amino acid sequence of the polypeptide is SEQ ID No. 1 or SEQ ID No. 2; A2) A polypeptide having more than 80% identity with and the same function as A1) by substitution and / or deletion and / or addition of one or two amino acid residues of the sequence of SEQ ID No. 1 or SEQ ID No. 2; A3) is a fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).
2. The biomaterial related to the polypeptide of claim 1 is any one of B1) to B4) below: B1) A nucleic acid molecule encoding the polypeptide of claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
3. A product comprising the polypeptide of claim 1 or the biomaterial of claim 2.
4. The product according to claim 3, characterized in that: The product in question is a vaccine or a drug.
5. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of products for the treatment and / or prevention of bovine viral diarrhea virus infection.
6. The application according to claim 3, characterized in that: The product in question is a vaccine or a drug.
7. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in enhancing the production of CD8+ T cells in an organism, or in the preparation of CD8+ T cells.
8. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of bovine viral diarrhea virus antibodies or antiserum.
9. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of reagents or kits for detecting bovine viral diarrhea virus.
10. A complex formed by the polypeptide of claim 1 and the BoLA-I molecule.