Haemophilus parasuis subunit vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, relates to a haemophilus parasuis subunit vaccine as well as a preparation method and application thereof, and provides a haemophilus parasuis antigen combination which comprises a recombinant P3 protein and a recombinant P5 protein, the recombinant P3 protein is coded by a sequence shown in SEQ ID No.1, the recombinant P5 protein is coded by a sequence shown in SEQ ID No.2, and the recombinant P3 protein is coded by a sequence shown in SEQ ID No.2. The vaccine immunization can induce effective respiratory mucosa immune response, meanwhile, humoral immune and cellular immune response are remarkably induced, the safety is high, live pathogens are not involved in the vaccine preparation process, no adverse reaction is generated after immunization, and mucosa immunity can be activated when the vaccine immunizes a body; the required antigen content is obviously lower than that of the existing vaccine, the mucosal immunity is enhanced and the immune duration is prolonged by screening adjuvants, and a good immune protection effect can be provided.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a subunit vaccine for Haemophilus parasuis, its preparation method, and its application. Background Technology

[0002] Haemophilus parasuis infection, also known as Glasser's disease, is a swine infectious disease characterized by severe respiratory infection, polyserositis, meningitis, and arthritis caused by Haemophilus parasuis. It is one of the most important bacterial infectious diseases affecting piglets and nursery pigs worldwide. Haemophilus parasuis infection primarily infects piglets and finishing pigs, causing significant economic losses to the global pig industry. Antibiotic treatment is an important means of control, but with the increasing number of drug-resistant strains of Haemophilus parasuis, the problem of drug resistance is becoming increasingly serious, and the treatment effect of antibiotics is not significant. Vaccination has become the most economical and effective measure to control Haemophilus parasuis infection. Existing Haemophilus parasuis vaccines include inactivated vaccines and live attenuated vaccines. Live attenuated vaccines use live strains, which pose risks such as safety and shedding of the virus, and are rarely used clinically. Inactivated vaccines are prepared with a limited number of serotype antigens, but there are many serotypes of Haemophilus parasuis, and the cross-protective immunity between different serotypes is poor, affecting their application effectiveness.

[0003] Haemophilus parasuis primarily infects the body via the respiratory mucosa. Mucosal immunity can induce adaptive immunity in the local mucosa, making it an ideal immunization route. Currently, Haemophilus parasuis vaccines are mainly administered via injection (intramuscular injection), primarily stimulating humoral and cellular immunity, but rarely inducing an effective mucosal immune response. Mucosal immunization mainly utilizes outer membrane vesicle vaccines; however, these vaccines may have strong adverse reactions, autoimmune risks, complex components, and biased immune responses. Subunit vaccines prepared from recombinant antigens, on the other hand, exhibit extremely high safety, fewer side effects, precise targeting, and controllable immune responses, showing great promise for application.

[0004] In the field of Haemophilus parasuis infection control, due to issues such as the physical and biochemical barriers of the mucosa itself, the function of the mucosa, and the delivery of mucosal vaccines, no researchers have currently prepared recombinant antigens into mucosal immunotherapies. Furthermore, the applicant's team's research has found that some antigenic components involved in existing subunit vaccines have limited protective effects and often fail to induce an effective mucosal immune response, severely impacting the protective efficacy of subunit vaccines against virulent strains of Haemophilus parasuis.

[0005] Based on the above problems, the applicant provides a mucosal immune subunit vaccine for Haemophilus parasuis infection, which can be administered intranasally and activate mucosal immunity, inducing significant mucosal immune protection. It has a good protective effect against challenge with virulent strains of Haemophilus parasuis and is of great significance for the prevention and control of Haemophilus parasuis infection. Summary of the Invention

[0006] To address the aforementioned technical issues, this application employs whole-genome sequence analysis, evolutionary analysis, and analysis of the *Haemophilus parasuis* core and pan genes to screen for conserved antigen genes in different serotypes. The subcellular localization, transmembrane region, signal peptide, secretory protein status, antigen index, and hydrophilicity of the screened proteins are analyzed to identify conserved antigens in different serotypes of *HPS*. Experimental screening has revealed a two-component mucosal immune subunit vaccine against *Haemophilus parasuis*. This vaccine is safe, poses no biosafety risks, can induce a good immune response, and provides ideal immunoprotective effects against *Haemophilus parasuis* challenge. Specifically, it includes the following: In a first aspect, the present invention provides a Haemophilus parasuis antigen combination, comprising one or more recombinant P3 protein and recombinant P5 protein, wherein the recombinant P3 protein is encoded by the sequence shown in SEQ ID No. 1, and the recombinant P5 protein is encoded by the sequence shown in SEQ ID No. 2.

[0007] In a second aspect, the present invention provides a vaccine composition containing the aforementioned Haemophilus parasuis antigen combination, wherein the vaccine composition contains an immunizing amount of recombinant P3 protein and recombinant P5 protein.

[0008] Thirdly, the present invention provides the use of the said antigen combination or the said vaccine composition in the preparation of drugs for the prevention and / or treatment of Haemophilus parasuis infection.

[0009] Fourthly, the present invention provides a mucosal immunization vaccine against Haemophilus parasuis infection, wherein the mucosal immunization vaccine comprises the Haemophilus parasuis antigen combination or the vaccine composition.

[0010] Preferably, the mucosal immune vaccine further includes an adjuvant.

[0011] Preferably, the adjuvant is GEL02 and CPG.

[0012] Preferably, the mucosal immune vaccine is administered via nasal immunization.

[0013] Fifthly, the present invention provides a method for preparing the mucosal immunogenic vaccine, comprising aseptically mixing recombinant P3 protein and recombinant P5 protein in a 1:1 mass ratio, adding adjuvant GEL02 at a volume ratio of 9:1, simultaneously adding CPG, emulsifying, and mixing to obtain a mucosal immunogenic vaccine against Haemophilus parasuis. The beneficial effects of this invention are as follows: This invention provides a Haemophilus parasuis antigen combination, including one or more recombinant P3 and recombinant P5 proteins. The recombinant P3 protein is encoded by the sequence shown in SEQ ID No. 1, and the recombinant P5 protein is encoded by the sequence shown in SEQ ID No. 2. Compared with the prior art, this invention avoids problems such as swelling at the injection site, vaccine residue, and a certain degree of impact on pork quality and stress on pigs caused by injection immunization. The vaccine of this invention can induce an effective respiratory mucosal immune response, while significantly inducing humoral and cellular immune responses. It has high safety, as the vaccine preparation process does not involve live pathogens, and there are no adverse reactions after immunization. Immunization with the vaccine of this invention can activate mucosal immunity; the required antigen content is significantly lower than that of existing vaccines, and the selection of adjuvants enhances mucosal immunity and the duration of immunity, providing good immunoprotective effects. Attached Figure Description

[0014] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings: Figure 1 SDS-PAGE electrophoresis image of purified recombinant P3 protein Lane M: Protein molecular weight standard; Lane 1: Before purification; Lane 2: Flow-through buffer; Lane 3: 20 mM imidazole collection buffer; Lane 4: 20 mM imidazole collection buffer; Lane 5: 60 mM imidazole elution buffer; Lane 6: 60 mM imidazole elution buffer; Lane 7: 80 mM imidazole elution buffer; Lane 8: 80 mM imidazole elution buffer; Lane 9: 100 mM imidazole elution buffer. Figure 2 SDS-PAGE electrophoresis image of purified recombinant P5 protein Lane M: Protein molecular weight standard; Lane 1: Before purification; Lane 2: Flow-through buffer; Lane 3: 20 mM imidazole collection buffer; Lane 4: 20 mM imidazole collection buffer; Lane 5: 60 mM imidazole elution buffer; Lane 6: 60 mM imidazole elution buffer; Lane 7: 80 mM imidazole elution buffer; Lane 8: 80 mM imidazole elution buffer; Lane 9: 100 mM imidazole elution buffer. Figure 3 Western blot reaction of purified recombinant P3 protein with HPS-positive sera of different serotypes Wherein, 4: Western blot reaction of serum type 4 HPS positive serum; 5: Western blot reaction of serum type 5 HPS positive serum; 12: Western blot reaction of serum type 12 HPS positive serum; - represents Western blot reaction of HPS negative serum. Figure 4 Western blot reaction of purified recombinant P5 protein with HPS-positive sera of different serotypes 4: Western blot reaction of serum type 4 HPS positive serum; 5: Western blot reaction of serum type 5 HPS positive serum; 12: Western blot reaction of serum type 12 HPS positive serum; Figure 5 Immunization with the Haemophilus parasuis mucosal vaccine significantly reduced lung and liver lesions. Detailed Implementation

[0015] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0016] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples are commercially available.

[0018] Example 1

[0019] P3 protein: Conserved antigen genes in *H. parasuis* were screened, and the *P3* gene was obtained through sequence protection analysis and optimization. Based on the gene sequence characteristics and bioinformatics analysis of its encoded protein, codon optimization mutations were performed according to the codon preference of *E. coli*. The *P3* gene was cloned into the prokaryotic expression vector pET30a(+) restriction enzyme site. BamH I and XhoI. Recombinant plasmids, pET-30a-P3, were obtained. These plasmids were transformed into *E. coli* competent cells BL21(DE3) to obtain recombinant bacteria. The recombinant bacteria were inoculated into LB liquid medium (containing 100 μg / mL kanamycin) and cultured at 37°C and 200 rpm until the OD600 reached approximately 0.6. IPTG was added to a final concentration of 0.05 mM, and the culture was incubated on a shaker at 16°C and 120 rpm for 16 h. The bacterial pellet was then collected by centrifugation. The induced bacterial culture was centrifuged at 9000 rpm for 10 min, washed twice with pre-cooled PBS, and the bacterial cells were collected. The cells were then disrupted using a pressure cell disruptor until the culture was clear. The supernatant was collected by centrifugation at 4°C and 9000–10000 rpm for 30 min. The recombinant protein was purified using nickel affinity chromatography. First, 4 ml of Ni-NTA His Bind Resin was loaded into an empty chromatography column. After allowing the liquid to drip out naturally under gravity, the column was washed with 5-10 times the volume of NTA equilibration buffer. Then, the sample was added to the column and the column was shaken at 4°C for 1-2 h to bind. Impurities were washed with 10 column volumes of washing buffer, followed by elution with 40-300 mM elution buffer. The eluent was collected and purified by SDS-PAGE gel electrophoresis. The results showed that soluble recombinant P3 protein (…) was obtained after induced expression and purification. Figure 1 ).

[0020] The sequence of the P3 gene, SEQ ID No. 1, is: GGATCCTGCAGCAGCAGCAACGATAACGCGAGCGCGAACGCGTCTGCGAACGCGGCCAGACCTTCGGCGGCATGTCTGTTCAGGATCTGCAGACCCGTTACAACACCGTTTACTTCGATTTCGATAGCTACACCCTGAAAGCGGAAGATCAGCAGCTGCTGGATGCGCACGCGCAGTACCTGGTTGCGTCTAAAGGCAAAGTTACCG TTGCGGGCCACGCGGATGAACGTGGCACCCCGGAATACAACATCGCGCTGGGCCAGCGTCGTGCGGATGCGGTTAAAGATTTCCTGGCGACCAAAGGCGCGAGCAACGTTGCGACCGTTAGCTACGGCGAAGAAAAACCGGCGGTTCTGGGCCACAGCGAAGCGGATTACAGCAAAAACCGTCGTGCGGTTCTGGAATACTAACTCGAG P5 protein: Conserved antigen genes in *H. parasuis* were screened, and the *P5* gene was obtained through sequence protection analysis and optimization. Based on the gene sequence characteristics and bioinformatics analysis of its encoded protein, codon optimization mutations were performed according to the codon preference of *E. coli*. The *P5* gene was cloned into the prokaryotic expression vector pET30a(+) restriction enzyme site. BamH I and Xho I. Recombinant plasmids, pET-30a-P5, were obtained. These plasmids were transformed into *E. coli* competent cells BL21(DE3) to obtain recombinant bacteria. The recombinant bacteria were inoculated into LB liquid medium (containing 100 μg / mL kanamycin) and cultured at 37°C and 200 rpm until the OD600 reached approximately 0.6. A final concentration of 0.05 mMIPTG was added, and the culture was incubated for 16 h at 16°C and 120 rpm on a shaker. The bacterial pellet was then collected by centrifugation. The induced bacterial culture was centrifuged at 9000 rpm for 10 min, washed twice with pre-cooled PBS, and the bacterial cells were collected. The cells were disrupted using a pressure cell disruptor until the culture was clear. The culture was centrifuged at 4°C and 9000-10000 rpm for 30 min, and the supernatant was collected. The recombinant protein was purified using nickel affinity chromatography. First, 4 ml of Ni-NTA His Bind Resin was loaded into an empty chromatography column. After allowing the liquid to drip out naturally under gravity, the column was washed with 5-10 times the volume of NTA equilibration buffer. Then, the sample was added to the column and the column was shaken at 4°C for 1-2 h to bind. Impurities were washed with 10 column volumes of washing buffer, followed by elution with imidazole elution buffers of different concentrations. The eluent was collected and purified by SDS-PAGE gel electrophoresis. The results showed that soluble recombinant P5 protein (…) was obtained after induced expression and purification. Figure 2 ).

[0021] The sequence of the P5 gene, SEQ ID No. 2, is as follows: GGATCCTGCGGCAGCGGCGGCGGCGGTGGCGGCAGCAGCGCGTCTAACCCGCCGAGCCAGGTTCCGACCAAAACCGAACCGCAGCTGCCGACCACCCCGCCGACCTCCCAGGTTGAATCTGAATGGAAAGCGAAAATCCGTGAAGCGAAACTGATCCGTATCGATCACGAAACCCTGCGTCTGAGCG ATGATGTTGCGTTCCCGAGCCAGATCTTCAACATGGCGGATGAAAAACTGGGCAAACTGGAACAGGAACTGGGCCGTAACTGGGTTCTGAAAGCATACAACCTGCCGTACAGCGCTGTTGGCTACGTTTCTGCCGGCGGATGTTTCTACCGATGAATACGGTCGTGTTATCGATAGCCGTGCGAACAAC TACATGGCGGAAGTTGTTGGCGCGTACCGAAATCCTGCCGAAAGGCAGCGCGTACTACGAAGGTGTTAGCTTCGGCGCGAACAGCGAAGGTAAACTGAAACTGAGCATCAACTTCTCTGACAAAACCATCAGCGGTAGCGTGACCGATCGTAAACTGCTGTCTACCAAAGAAGCGCTGGCTGATA TCTCTCTGAAAGAAGCGAACATCAGCGCGGTTGGCGAACACCACTTCTCTGGCGTTGCGGAATCCAGGGTATCCAGGGTAGCTACTACGGTAGCTTCTTCGGCCCGAACGCGGAAGAAGTTGGTGGTATCATCCGTGATGATGCGGGCAACAAATACGAAGGTTTCAGCGGTACCAAATAACTCGAG

[0022] Example 2 After SDS-PAGE electrophoresis, the purified recombinant P3 protein and recombinant P5 protein were transferred to a membrane and analyzed by Western blot reaction with HPS positive sera of types 4, 5 and 12 (preserved by Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences).

[0023] The results are as follows Figure 3 and Figure 4As shown, the recombinant protein showed a positive reaction with HPS-positive sera of different prevalent serotypes, and the antigen used was conserved in different HPS serotypes and showed good reactivity with HPS-positive sera of different serotypes.

[0024] Example 3

[0025] The vaccine preparation method described in this embodiment has undergone multiple screening experiments regarding the adjuvant used and its dosage. The optimal preparation process obtained is as follows: The prepared recombinant P3 protein and recombinant P5 protein were aseptically mixed at a mass ratio of 1:1, and then the French Seppic adjuvant GEL 02 was added at a volume ratio of 9:1. At the same time, the immunoadjuvant oligodeoxynucleotide CPG ODN 2395 with a final concentration of 100 ug / ml was added. The mixture was emulsified in an emulsifier at 5000 rpm for 5-8 min to obtain a mucosal immunogenic subunit vaccine for Haemophilus parasuis. The vaccine is water-soluble, and each milliliter of the vaccine contains 200 ug to 1000 ug of each protein.

[0026] Example 4

[0027] Healthy guinea pigs aged 6-8 weeks (purchased from the Experimental Animal Center of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences) were immunized with the vaccine via intranasal administration, 100 μL / pig. They were divided into a vaccine group and an adjuvant control group, with 5 pigs in each group. Haemophilus parasuis H0014LV5 strain (serotype 5, deposited at the China Center for Type Culture Collection, accession number CCTCC M 20252517, deposit date November 10, 2025) was concentrated after culturing in TSB medium. Before inactivation, each dose of vaccine contained approximately 10 mg of antigen. 10 CFU was inactivated with 0.4% formaldehyde for 24 h, emulsified with ISA 206 adjuvant, and used as a control for the inactivated vaccine. Guinea pigs immunized with this Haemophilus parasuis subunit vaccine showed good mental condition, normal appetite, and respiration, indicating vaccine safety. ELISA was used to detect vaccine antibody levels. Recombinant protein P3 was coated onto ELISA plates (200 ng / well, 100 μL per well) and incubated at 37°C for 2 h; washed three times with PBST for 3 min each time; blocked with 5% skim milk powder at 37°C for 2 h; serum was diluted 1:100 and incubated at 37°C for 1 h; washed three times with PBST for 3 min each time; goat anti-guinea pig IgG-HRP was diluted 1:5000 and incubated at 37°C for 1 h; TMB was added for color development (100 μL per well), incubated at 37°C for 10 min, and the ELISA was terminated with stop solution. OD values ​​were measured at 450 nm.

[0028] As shown in Table 1, the prepared Haemophilus parasuis subunit vaccine produced high levels of antibodies 21 days after immunization, and the antibody levels were significantly higher than those of the inactivated vaccine (P<0.01).

[0029] Table 1. ELISA detection of serum Haemophilus parasuis specific antibodies

[0030] Twenty-one days after the second immunization, patients were challenged with a highly virulent strain of Haemophilus parasuis H0014LV5 (serotype 5, deposited at the China Center for Type Culture Collection, accession number CCTCC M 20252517, deposit date November 10, 2025) via intraperitoneal injection (1.55 × 10⁻⁶). 9 CFU (1 ml / animal), and observe continuously for 7 days after challenge.

[0031] Table 2 shows that the protection rate of this vaccine in the immunized group reached 80% (4 / 5), the same as the 80% protection rate of the inactivated vaccine; while all patients in the adjuvant control group died. Immunization with the vaccine applied for can significantly reduce mortality and morbidity. The vaccine group had no obvious clinical symptoms, while the control group showed symptoms such as depression, ruffled hair, and closed eyes. The lesions in the lungs and liver of the immunized group were significantly reduced, while the control group showed lung consolidation and hemorrhage, and obvious congestion and hemorrhage in the liver, which are typical lesions of Haemophilus parasuis infection. Figure 5 This indicates that the prepared vaccine has a good mucosal immune protection effect.

[0032] Table 2. Immunoprotective efficacy of Haemophilus parasuis subunit vaccine

[0033] In summary, this invention provides a Haemophilus parasuis antigen combination, comprising one or more recombinant P3 and recombinant P5 proteins. The recombinant P3 protein is encoded by the sequence shown in SEQ ID No. 1, and the recombinant P5 protein is encoded by the sequence shown in SEQ ID No. 2. Compared with existing technologies, this invention avoids problems such as swelling at the injection site, vaccine residue, and a certain degree of impact on pork quality, as well as significant stress on pigs caused by injection immunization. The vaccine of this invention can induce an effective respiratory mucosal immune response, while significantly inducing humoral and cellular immune responses. It has high safety, as the vaccine preparation process does not involve live pathogens, and there are no adverse reactions after immunization. Immunization with the vaccine of this invention can activate mucosal immunity; the required antigen content is significantly lower than that of existing vaccines, and the selection of adjuvants enhances mucosal immunity and the duration of immunity, providing good immunoprotective effects.

Claims

1. A Haemophilus parasuis antigen combination, characterized in that, It includes one or more of recombinant P3 protein and recombinant P5 protein, wherein the recombinant P3 protein is encoded by the sequence shown in SEQ ID No. 1, and the recombinant P5 protein is encoded by the sequence shown in SEQ ID No.

2.

2. A vaccine composition containing the Haemophilus parasuis antigen combination of claim 1, characterized in that, The vaccine composition contains an immunizing amount of recombinant P3 protein and recombinant P5 protein.

3. The use of the antigen combination as described in claim 1 or the vaccine composition as described in claim 2 in the preparation of drugs for the prevention and / or treatment of Haemophilus parasuis infection.

4. A mucosal immunoglobulin for Haemophilus parasuis infection, characterized in that, The mucosal immune vaccine comprises the Haemophilus parasuis antigen combination of claim 1, or the vaccine composition of claim 2.

5. The mucosal immunotherapy vaccine as described in claim 4, characterized in that, The mucosal immune vaccine also includes an adjuvant.

6. The mucosal immunotherapy vaccine as described in claim 5, characterized in that, The adjuvants are GEL02 and CPG.

7. The mucosal immunotherapy vaccine as described in claim 4, characterized in that, The mucosal immune vaccine is administered via nasal immunization.

8. The method for preparing the mucosal immune vaccine according to any one of claims 4-7, characterized in that, Recombinant P3 protein and recombinant P5 protein were aseptically mixed in a 1:1 ratio, and adjuvant GEL02 was added at a volume ratio of 9:

1. CPG was added at the same time, the mixture was emulsified and mixed to obtain a mucosal immunoglobulin for Haemophilus parasuis infection.

Images