Telomerase activity indicating recombinant herpes simplex virus as well as preparation method and application thereof

Abstract

The invention provides a recombinant herpes simplex virus and a herpes simplex virus modification method. The herpes simplex virus modification method comprises the step of replacing an ICP4 protein coding gene in a herpes simplex virus genome containing an infected cell protein 4 (ICP4) gene with an hTERTp-fluorescent protein expression cassette. The expression cassette comprises an hTERTp promoter and a fluorescent protein coding sequence controlled by the hTERTp promoter, and the transcription direction is opposite to that of an ICP4 promoter in a genome. The hTERTp-fluorescent protein expression cassette in the recombinant virus obtained by the method disclosed by the invention can be normally expressed in response to telomerase activity. Therefore, the recombinant virus is capable of expressing a fluorescent protein, such as mBaoJin, in a cell having human telomerase activity. Cells infected by the virus can be identified through fluorescence signals, and the higher the telomerase activity is, the stronger the fluorescence intensity is. The virus has wide application value in research of tumor action mechanisms and stem cell action mechanisms, health assessment, screening of tumor drugs, research and development of diagnostic reagents and establishment of animal models.

Description

Technical Field

[0001] This disclosure relates to a recombinant herpes simplex virus and its preparation method, as well as a technique for using the recombinant herpes simplex virus to indicate telomerase activity in cells, and a kit containing the virus. The recombinant herpes simplex virus has the ability to indicate telomerase-active cells, and this disclosure relates to its application in detecting telomerase-active cells such as tumor cells, stem cells, immune cells, and drug detection. Background Technology

[0002] Telomeres are special structures at the ends of eukaryotic chromosomes. Their function is to maintain chromosome structural stability, including preventing chromosome ends from fusing, protecting chromosome structural genes, and preventing the loss of genetic information during replication.

[0003] Telomerase is a reverse transcriptase composed of small RNA and protein molecules. It uses its own RNA as a template to synthesize telomeric DNA, compensating for the gradual shortening of telomeres during cell mitosis. It has three main components: human telomerase RNA (hTR), telomerase-associated protein (TP1 / TLP1), and human telomerase reverse transcriptase (hTERT). Telomerase RNA is expressed in most cells, while human telomerase reverse transcriptase is the rate-limiting component of telomerase, expressed only in telomerase-positive cells, and is associated with telomerase activity.

[0004] Telomerase is inactive in most normal human cells, but it is highly active in stem cells, germ cells, and tumor cells. The TERT (telomerase reverse transcriptase) gene knockout mouse model has confirmed the role of telomeres in aging. Telomere dysfunction accelerates signs and symptoms of aging, such as shortened life expectancy, physical aging, and reduced tissue stem cell reserves.

[0005] Telomerase activity can be detected in most tumor cells, such as those of lung cancer, colon cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, and leukemia. Therefore, based on this characteristic of telomerase, its activity is often detected clinically for the diagnosis of neoplastic diseases.

[0006] There are many methods for detecting telomerase activity. Isotope methods are highly sensitive, but they suffer from radioactive contamination and require a long time. Staining methods are simple to operate and quick, but they can only detect relative telomerase activity and still have many limitations: they cannot detect telomerase activity at the single-cell level; they cannot detect telomerase activity in real time in live cells; they cannot use telomerase as a marker to sort single cells with flow cytometry for subsequent multi-omics studies; and they cannot capture or sort rare cells with high telomerase activity.

[0007] Currently, there are HSV1 viruses that insert hTERTp-ICP4 at the ICP4 site and CMV-GFP at the ICP34.5 site. In these viruses, GFP expression is not directly controlled by hTERTp. Summary of the Invention

[0008] TERT is strictly regulated in normal somatic cells, and no TERT is expressed in mature cell lines. However, most tumor cells maintain telomere length by abnormally upregulating TERT expression. In cells with stem cell activity, the TERT promoter also has high activity.

[0009] Herpes simplex virus (HSV) possesses good replication ability and safety, making it suitable for gene therapy or delivery, and it has received widespread attention in cancer treatment. Type I herpes simplex virus (HSV-1) is a double-stranded DNA virus approximately 152 kb long, belonging to the alphaherpesvirus subfamily. HSV-1 can enter cells via HVEM (herpesvirus entry medium, also known as TNFRSF14) and replicate in the nucleus of infected host cells. It is a broad-spectrum virus and a commonly used oncolytic virus. Type II herpes simplex virus (HSV-2) has a genome length of approximately 154 kb and belongs to the alphaherpesvirus subfamily of the herpesviridae family, also a broad-spectrum virus.

[0010] The inventors discovered that by deleting the coding region of the ICP4 gene from type I human herpes simplex virus and inserting a fluorescent protein coding gene controlled by the hTERTp promoter between the deletion site, such as the ICP4FLR1 region and the ICP4FLR2 region, the obtained type I recombinant herpes simplex virus can fluorescently label cells with TERT activity, and the location and number of cells with TERT activity can be indicated by fluorescence.

[0011] The recombinant virus obtained by the method disclosed herein does not express ICP4 and cannot replicate normally after infecting cells, but the hTERTp-fluorescent protein expression cassette can be expressed normally in response to TERT activity.

[0012] The present invention aims to provide a recombinant herpes simplex virus that selectively expresses a fluorescent protein in cells with high expression of human TERT reverse transcriptase, while not replicating in normal cells. Another objective of this disclosure is to provide a recombinant herpes simplex virus that indicates TERT-active cells, such as tumor cells, stem cells, and immune cells, by expressing a fluorescent protein in cells with high expression of human TERT reverse transcriptase.

[0013] The first objective of this invention is to provide a method for modifying recombinant herpes simplex virus.

[0014] The second objective of this invention is to provide a pharmaceutical composition comprising the recombinant herpes simplex virus of this invention.

[0015] The third objective of this invention is to provide a stem cell activity detection kit, a tumor diagnostic kit, and an immune assessment kit.

[0016] The fourth objective of this invention is to provide a live-cell biological fluorescence imaging technology, including a safe and efficient gene delivery system for delivering imaging-capable genes into cells, and an imaging element that is highly responsive to TERT activity, wherein the imaging element comprises an hTERT promoter and a fluorescent protein expression cassette controlled by it.

[0017] The purpose of the invention and the solution to its technical problems can be achieved by the following technical measures.

[0018] In the recombinant herpes simplex virus, the viral modification was performed in the ICP4 region of the viral genome. The hTERT-fluorescent protein expression cassette comprises: an hTERTp promoter element, a fluorescent protein (e.g., green fluorescent protein mBaoJin or other fluorescent protein) coding sequence located downstream of the hTERTp promoter element, and optionally a terminator element located downstream of the fluorescent protein coding sequence.

[0019] The recombinant herpes simplex virus is selected from type I herpes simplex virus.

[0020] The recombinant herpes simplex virus has the microbial preservation number CCTCC NO: V202575.

[0021] The purpose of this disclosure and the technical problem it solves can be achieved by the following technical solution. A method for preparing recombinant herpes simplex virus according to this disclosure includes the following steps: Homologous recombination technology was used to delete the ICP4 coding region from the ICP4 gene of the recombinant herpes simplex virus genome. An hTERTp-fluorescent protein expression cassette was then inserted between the ICP4FLR1 and ICP4FLR2 regions. This expression cassette includes a promoter element, a fluorescent protein coding sequence, and a terminator element connected downstream of the hTERTp promoter. The transcription direction of the aforementioned hTERTp promoter and fluorescent protein coding sequence is opposite to the transcription direction of the ICP4 promoter in the genome. The steps include: (1) Constructing homologous recombinant plasmids for inserting expression cassettes a. Using pcDNA3.4 plasmid as a vector, a plasmid was constructed that deleted the ICP4 coding region of recombinant herpes simplex virus and inserted an expression cassette between the ICP4 FLR1 and ICP4 FLR2 regions, resulting in the homologous recombinant plasmid pHSV1-d4-hTERT-mBaoJin. The plasmid contains two homologous arms: a 5' homologous arm and a 3' homologous arm, and the expression cassette hTERT-mBaoJin between the two homologous arms. The expression cassette hTERT-mBaoJin contains, in sequence, the hTERTp promoter, the coding sequence for the fluorescent protein mBaoJin, and BGHpA. The 5' homologous arm is a 1000-3000 bp DNA sequence upstream from the 5' end of the deletion site, and the 3' homologous arm is a 1000-3000 bp DNA sequence downstream from the 3' end of the deletion site; preferably, the 5' homologous arm is a 1524 bp DNA sequence at position 125254-126777 of the viral genome, and the 3' homologous arm is a 1666 bp DNA sequence at position 131735-133400 of the viral genome. (2) The homologous recombination plasmid obtained in (1) and the virus to be recombined were transfected into cells used for homologous recombination. After homologous recombination, the original sequence of the ICP4 gene of the recombinant herpes simplex virus located between the ICP4 FLR1 and ICP4 FLR2 regions was deleted, and an hTERTp-fluorescent protein expression cassette containing an hTERTp promoter element and a fluorescent protein coding sequence and a terminator element connected downstream of the hTERTp promoter element was inserted, causing the recombinant virus to emit fluorescence. After several rounds of plaque purification, fluorescent plaques were selected for purification to obtain the recombinant virus HSV1-hTERT-mBaoJin.

[0022] The purpose of this disclosure and the technical problems it addresses are further achieved through the following technical measures.

[0023] In the above-described method for preparing recombinant herpes simplex virus, the fluorescent protein can be selected from fluorescent proteins of various colors, such as green fluorescent protein, blue fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc., and the green fluorescent protein can be selected from, for example, mBaoJin, EGFP, Emerald, sfGFP, mClover3, and mNeonGreen.

[0024] The above-mentioned method for preparing recombinant herpes simplex virus further includes a step of sequencing or PCR identification of all involved plasmids to confirm that the construction is correct and that no mutations have occurred.

[0025] The objectives of this disclosure and the solutions to its technical problems are also achieved by the following technical solutions. A pharmaceutical composition according to this disclosure comprises the aforementioned recombinant herpes simplex virus and a pharmaceutically acceptable carrier or excipient.

[0026] Another objective of this disclosure is to provide the application of the above-mentioned recombinant herpes simplex virus in the preparation of drugs for the diagnosis and treatment of cancer, the study of tumor mechanisms of action, stem cell mechanisms of action, immune assessment, health assessment, screening of tumor drugs, development of diagnostic reagents, and establishment of animal models.

[0027] Another object of this disclosure is to provide a stem cell, immune cell, and / or tumor cell imaging, indicator, and / or detection kit comprising the above-described recombinant herpes simplex virus or the recombinant herpes simplex virus prepared by the above-described method.

[0028] The samples for testing can be selected from the subject's whole blood, fresh tissues and body fluids, or for in vivo imaging, but are not limited to these.

[0029] application This disclosure has significant advantages and beneficial effects compared with the prior art, and has practical industrial value, with at least the following advantages.

[0030] 1. The recombinant virus disclosed herein can recognize, enrich, and sort TERT-highly active cells at the single-cell level; 2. The recombinant virus disclosed herein can be used to capture live cells for subsequent multi-omics research and analysis; 3. The recombinant virus disclosed herein can accurately count live cells with high proliferative potential, and therefore can be used for tumor screening, early diagnosis, immune assessment, biological age assessment, stem cell quality control, and in vivo tracking.

[0031] This disclosure relates to recombinant viruses and their applications. (1) Compared with existing herpesviruses, the recombinant herpes simplex virus disclosed herein can effectively express fluorescent protein in cells with high human TERT activity, such as stem cells, tumor cells, and immune cells, without replicating in these cells and normal cells, and its biosafety is also higher; the recombinant virus has strong cell selectivity and will not cause normal cells to be visible in the detection, thus it is suitable for identifying, enriching and sorting cells with high human TERT activity at the single-cell level. (2) The fluorescent protein of the recombinant herpes simplex virus disclosed herein has high luminescence sensitivity, and can be used to observe the size, volume and drug location of tumors through imaging, and to assess and indicate the content and activity of stem cells, tumor cells and immune cells, etc.; it can be used to achieve early diagnosis of tumors and diagnosis of tumor metastasis quickly, accurately, sensitively and broadly.

[0032] (3) The recombinant herpes simplex virus obtained in this disclosure is classified as human herpes simplex virus oHSV1-hTERT-mBaoJin, with the Latin scientific name Human alpha herpesvirus 1 and the accession number CCTCC NO: V202575.

[0033] (4) The application of this disclosure can be based on type I or type II herpes simplex virus, and can be an oncolytic virus or not. The application of this disclosure does not depend on whether the virus is an oncolytic virus, and can be applied flexibly and widely.

[0034] (5) Other advantages The recombinant virus disclosed herein can detect TERT activity at the single-cell level; can detect TERT activity in real time in live cells; can use TERT as a marker to sort single cells by flow cytometry for subsequent multi-omics studies; and can be used to capture or sort rare cells with high TERT activity.

[0035] The above description is merely an overview of this disclosure. To further understand this disclosure, preferred embodiments will be described below. These descriptions are merely illustrative of the features and advantages of the technical solutions of this disclosure and are not intended to limit the scope of protection of this disclosure. Furthermore, the technical features involved in the different embodiments of this disclosure described below can be combined with each other as long as they do not conflict with each other. Attached Figure Description

[0036] To more clearly describe the technical solutions of this disclosure, a brief introduction will be given below in conjunction with the accompanying drawings. Obviously, these drawings are merely some specific embodiments described in this disclosure. This disclosure includes, but is not limited to, these drawings.

[0037] Figure 1 Electrophoresis image of recombinant herpes simplex virus identified by PCR.

[0038] Figure 2 Fluorescence micrograph of recombinant herpes simplex virus-infected mesenchymal stem cells.

[0039] Figure 3 A schematic diagram illustrating the method for constructing the virus disclosed herein.

[0040] Figure 4 This is a schematic diagram of the hTERT-mBaoJin representation box. Detailed Implementation

[0041] The present disclosure will be further described in detail below with reference to the accompanying drawings and embodiments. Through these descriptions, the features and advantages of the present disclosure will become clearer and more apparent.

[0042] The term “exemplary” as used herein means “serving as an example, embodiment, or illustration.” Any embodiment illustrated herein as “exemplary” is not necessarily to be construed as superior to or better than other embodiments. Although various aspects of embodiments are shown in the accompanying drawings, the drawings are not necessarily drawn to scale unless specifically indicated otherwise.

[0043] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent applications, and publications cited in this document are incorporated herein in their entirety. When trade names appear herein, they are intended to refer to the corresponding product or its active ingredient.

[0044] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention herein. In this disclosure, it must be noted that, unless clearly stated otherwise, the singular form used in this specification and claims includes the plural form of the referred to. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0045] Various methods can be used to perform the reaction and purification techniques using kits with instructions provided by the manufacturer, or according to methods known in the art, or according to the methods described in this disclosure. Generally, the foregoing techniques and steps can be performed by conventional methods well known in the art and described in various general or more specific documents, which are cited and discussed in this disclosure.

[0046] The term "subject" as used in this instruction manual refers to mammals including humans, primates such as chimpanzees, pet animals such as dogs and cats, livestock such as cattle, horses, sheep, and goats, and rodents such as mice and rats.

[0047] In this article, "sensitivity" refers to the value of (number of true positives) / (number of true positives + number of false negatives).

[0048] In this article, "specificity" refers to (number of true negatives) / (number of true negatives + number of false positives).

[0049] In this article, recombinant herpes simplex virus refers to herpes simplex virus in which the coding sequence of the ICP4 gene in the herpes simplex virus containing the ICP4 gene is replaced with an expression cassette for expressing a fluorescent protein controlled by the hTERTp promoter.

[0050] In this study, the expression cassette for fluorescent proteins controlled by the hTERTp promoter can be selected from the hTERTp-mbaojin expression cassette, and the fluorescent protein in the expression cassette can be replaced with other types of fluorescent proteins.

[0051] This article does not have any particular restrictions on cells with TERT activity, cells with high TERT activity, or cells with high proliferative capacity. Examples include cancer cells (tumor cells), stem cells, immune cells, and germ cells.

[0052] In this article, stem cells refer to a class of cells with self-renewal capacity and multipotent differentiation potential. Based on their origin and differentiation potential, stem cells can be divided into several types, mainly including: embryonic stem cells (ESCs), adult stem cells (such as hematopoietic stem cells, neural stem cells, mesenchymal stem cells, etc.), and induced pluripotent stem cells (iPSCs).

[0053] Immune cells can induce high levels of TERT activity during the activation / proliferation phase. In this study, detectable immune cells can include those in the aforementioned phase, such as activated T cells and B cells: when these cells receive specific antigen stimulation and are activated through their antigen receptors (TCR or BCR), TERT activity is rapidly upregulated.

[0054] Regarding the location of genes and elements involved in this article, the example is HSV-1 strain 17, Accession number JN555585 (DDBJ (DNA Data Bank of Japan) database, human herpesvirus type 1 strain 17, complete genome).

[0055] In this study, the insertion location of the transcription cassette can be the region between the ICP4 FLR1 and ICP4 FLR2 regions in the genome. For example, the region between the ICP4 FLR1 and ICP4 FLR2 regions is selected from the viral genome coordinates between 126777 and 131735.

[0056] In this paper, deletion sites mainly refer to the start and end points of the ICP4 coding sequence, preferably the sequence between the ICP4 FLR1 and ICP4 FLR2 regions, and more preferably the sequence selected from viral genome coordinates 126778-131734. Inserting the expression cassette between the FLR1 and FLR2 regions can increase the construction efficiency of recombinant viruses.

[0057] In this document, the ICP4 coding sequence can be represented as the sequence between the ICP4 FLR1 and ICP4 FLR2 regions (excluding the ICP4 FLR1 and ICP4 FLR2 regions themselves). In one embodiment, the promoter of the ICP4 gene is retained in the recombinant virus.

[0058] bGH polyA (bovine growth hormone polyadenylation signal) is a transcription termination and tailing signal sequence derived from the bovine growth hormone gene, and it is widely used in eukaryotic expression vectors.

[0059] This disclosure provides a recombinant herpes simplex virus, wherein the ICP4 coding sequence between the ICP4 FLR1 region and the ICP4 FLR2 region in the human herpes simplex virus genome is deleted, and a fluorescent protein expression cassette controlled by the hTERT promoter is inserted between the ICP4 FLR1 region and the ICP4 FLR2 region.

[0060] In one embodiment, the herpes simplex virus containing the ICP4 gene used as the recombinant virus can be a wild-type herpes simplex virus, or a virus from which any gene segment (except the ICP4 gene and the ICP4 gene promoter) has been removed from the wild-type herpes simplex virus genome, but is not limited thereto. It can be any herpes simplex virus containing the ICP4 gene obtained by those skilled in the art through conventional techniques, and can be optionally a type I or type II herpes simplex virus, preferably a type I virus.

[0061] In one embodiment, the recombinant herpes simplex virus has the biological accession number CCTCC NO: V202575.

[0062] This disclosure provides a method for preparing recombinant herpes simplex virus, which includes the following steps: The ICP4 coding sequence of recombinant herpes simplex virus containing the ICP4 gene was deleted using homologous recombination technology, and an hTERTp-fluorescent protein expression cassette was inserted between the ICP4 FLR1 and ICP4 FLR2 regions. The hTERTp-fluorescent protein expression cassette includes an hTERTp promoter element, and downstream of the hTERTp promoter element, a fluorescent protein mBaoJin coding sequence and a BGHpA terminator element. The transcription direction of the expression cassettes of the aforementioned hTERTp promoter element and the fluorescent protein mBaoJin coding sequence is opposite to that of the original wild-type ICP4 promoter.

[0063] In one embodiment, the method of inserting the expression cassette can use methods commonly used in the field of gene editing, which, in addition to homologous recombination, can be selected from CRISPR-Cas system, CRISPR-HDR Prime Editing, non-CRISPR site-specific recombinase system, etc.

[0064] In one embodiment, the fluorescent protein may be selected from green fluorescent protein, cyan fluorescent protein, red fluorescent protein expression cassette, yellow fluorescent protein, and other indicator proteins, preferably a fluorescent protein suitable for live cell labeling. Fluorescent proteins suitable for live cell labeling, for example, possess monomericity (to avoid interfering with target protein function); rapid maturation: ≤1 hour (suitable for dynamic process tracking); high photostability: resistant to laser bleaching (especially for long-term imaging); low pH sensitivity: maintaining fluorescence in acidic organelle environments (e.g., lysosomes, Golgi apparatus); and efficient folding at 37°C (for mammalian cell expression).

[0065] As a green fluorescent protein, mBaoJin, EGFP, Emerald, sfGFP, mClover3, and mNeonGreen can be selected, with mBaoJin being the preferred choice.

[0066] In this paper, mBaoJin is a monomeric variant of StayGold. Information regarding its crystal structure and other details can be found in the paper Hanbin Zhang et al., Bright and stable monomeric greenfluorescent protein derived from StayGold. Nat Methods. 2024 April; 21(4):657–665. doi:10.1038 / s41592-024-02203-y. . mBaoJin is a bright, photostable fluorescent protein with high intracellular brightness, rapid maturation, and photostability, especially high pH / chemical stability, and can be excited at low to medium intensities (<200 mW / mm). 2 Long-term super-resolution imaging of live cells was performed under SIM imaging conditions with variable light intensity. Under these conditions, mBaoJin demonstrated superior photostability compared to mNeonGreen and EGFP.

[0067] The recombinant virus containing mBaoJin disclosed herein can be used for various protein labeling and subcellular labeling applications, particularly for subcellular dynamics of cells and tissues and long-term super-resolution imaging in expanded microscopy (ExM). The recombinant virus containing mBaoJin disclosed herein can be used in Bleaching / Blinking Assisted Localization Microscopy (BaLM) techniques, as well as other localization microscopy techniques such as stochastic optical reconstruction microscopy (STORM) and photo-activated localization microscopy (PALM).

[0068] In one embodiment, the terminator element may use those terminators commonly used in the art.

[0069] The method includes the following steps: (1) Constructing homologous recombinant plasmids for inserting expression cassettes 1a. Using pcDNA3.4 plasmid as a vector, a plasmid containing an expression cassette inserted between the ICP4 FLR1 and ICP4 FLR2 regions of recombinant herpes simplex virus was constructed. The plasmid contains two homologous arms and the expression cassette hTERT-mBaoJin located between the two homologous arms. The expression cassette hTERT-mBaoJin contains the hTERTp promoter, the coding sequence for the fluorescent protein mBaoJin, and BGHpA. The two homologous arms are a 5' homologous arm and a 3' homologous arm. The 5' homologous arm is a 1000-3000 bp DNA sequence upstream of the 5' end of the deletion site, and the 3' homologous arm is a 1000-3000 bp DNA sequence downstream of the 3' end of the deletion site. The homologous recombinant plasmid pHSV1-d4-hTERT-mBaoJin was obtained; In one embodiment, the pcDNA3.4 plasmid can be replaced with other plasmids commonly used in the art, such as pcDNA. TM 3.1 (+ / -) and other upgrades or variants of the pcDNA series, such as the pEF series, pCMV series, and pCI series.

[0070] In one embodiment, the expression cassette can be inserted into the region between the FLR1 region and the FLR2 region of ICP4 in the genome of type I or type II herpes simplex virus. The present inventors have found that the construction efficiency of recombinant viruses can be increased between the FLR1 region and the FLR2 region of ICP4.

[0071] In one embodiment, the lengths of the 5' and 3' homologous arms can range from 1000 to 3000 bp, preferably from 2000 to 1500 bp, for example, 1524 to 2000 bp or 1500 to 1666 bp. Preferably, the 5' homologous arm is a 1524 bp DNA sequence located at position 125254~126777 of the viral genome, and the 3' homologous arm is a 1666 bp DNA sequence located at position 131735 bp~133400 of the viral genome.

[0072] (2) The homologous recombination plasmid constructed in (1) and the wild-type HSV1 virus to be recombined are transfected into cells for recombination, such as Vero cells. After homologous recombination, the original sequence between the ICP4 FLR1 and ICP4 FLR2 regions of the ICP4 gene of the recombinant herpes simplex virus is deleted, and an hTERTp-fluorescent protein expression cassette is inserted, so that the recombinant virus emits fluorescence. The hTERTp-fluorescent protein expression cassette contains an hTERTp promoter element, and a fluorescent protein coding sequence and a terminator element connected downstream of the hTERTp promoter. After several rounds of plaque purification, fluorescent plaques were selected and the recombinant virus HSV1-hTERT-mBaoJin was purified.

[0073] In one implementation, the method for obtaining the expression cassette, apart from full-sequence gene synthesis, can use common methods selected from PCR methods, without particular limitations.

[0074] The above-mentioned method for preparing recombinant herpes simplex virus preferably further includes a step of sequencing or PCR identification of all involved plasmids and / or viruses to confirm that the construction is correct and that no mutations have occurred.

[0075] One embodiment of this disclosure provides a pharmaceutical composition comprising the aforementioned recombinant herpes simplex virus and a pharmaceutically acceptable carrier or excipient.

[0076] One embodiment of this disclosure provides the application of the above-mentioned recombinant herpes simplex virus in the preparation of drugs for diagnosing and treating cancer, studying the mechanism of action of tumors and stem cells, health assessment, screening of tumor drugs, development of diagnostic reagents and establishment of animal models, such as detecting and indicating the presence, location and activity of stem cells.

[0077] One embodiment of this disclosure provides a stem cell activity detection kit and a tumor imaging, indicator, and / or detection kit, comprising the above-described recombinant herpes simplex virus or a recombinant herpes simplex virus prepared by the above method. The recombinant herpes simplex virus of this disclosure can be used for various protein labeling and subcellular labeling applications, particularly for subcellular dynamics of cells and tissues, extended microscopy, etc., and is especially suitable for long-term super-resolution imaging of live cells. The recombinant herpes simplex virus of this disclosure can be used in BaLM (Balanced Microscopy) microscopy, and other BaLM microscopy techniques such as stochastic optical reconstruction microscopy and photoactivated localization microscopy.

[0078] The samples used for testing are selected from the subject's whole blood, fresh tissues and body fluids, or for in vivo imaging.

[0079] The recombinant herpes simplex virus obtained in this disclosure can be preserved using conventional methods. For example, for short-term preservation, the virus can be directly sealed in or suspended in 50% glycerol saline and placed in a -30°C freezer. For long-term preservation, (1) rapid cryopreservation can be used, in which inactivated animal serum or other protein protectants are added to the virus suspension, preferably dimethyl sulfoxide (e.g., 5% to 10%), and then rapidly frozen and preserved at -70°C or -196°C. Tissue materials containing the virus can be directly cryopreserved: for example, first immersed in 50% glycerol-buffered saline, and then cryopreserved (at -70°C or -196°C).

[0080] (2) Freeze-drying method: Dehydrating frozen virus suspensions under vacuum conditions. This typically involves low-temperature dehydration, followed by the removal of excess uncondensed water vapor from the condenser using a desiccant or condensation method. Commonly used desiccants include phosphorus pentoxide, calcium sulfate, calcium chloride, and silica gel.

[0081] This disclosure provides the use of viruses that express green fluorescent protein in response to TERT activity in indicator stem cells. This includes the presence of indicator human stem cells, such as human umbilical cord mesenchymal stem cells.

[0082] Indicating TERT-active cells using the virus or a kit containing the virus, specifically, the indication includes the following steps: After overnight culture of TERT-active cells, HSV1-hTERT-mBaoJin virus was added to the cells for infection (virus infection group). After inoculation, the cells were cultured at 37°C and 5% CO2 to observe the expression of green fluorescent protein.

[0083] The application of this disclosure is not limited to human cells that naturally express TERT, in vivo or in vitro fresh tissues, but can also be used to evaluate other cells that artificially modify TERT, in vivo or in vitro fresh tissues, or other animal models.

[0084] The HSV1 virus used in this preparation method is merely an example. Other recombinant or non-recombinant type I or type II herpes simplex viruses can be used in the method for preparing the virus disclosed herein, preferably viruses with oncolytic virus characteristics. The HSV strains applicable to this preparation method are, for example, selected from HSV1 17+ strains that have been or have not been artificially edited.

[0085] The type I herpes simplex virus strain prepared in this disclosure is deposited at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO: V202575. Deposit date: November 11, 2025. Classification and nomenclature: Human herpes simplex virus oHSV1-hTERT-mBaoJin.

[0086] This disclosure includes, for example, the following embodiments.

[0087] One embodiment provides a recombinant herpes simplex virus, wherein The ICP4 coding sequence in the genome of herpes simplex virus containing the ICP4 gene was replaced with the hTERTp-fluorescent protein expression cassette. The hTERTp-fluorescent protein expression cassette includes an hTERTp promoter element and a fluorescent protein coding sequence controlled by the hTERTp promoter element.

[0088] In one embodiment, the fluorescent protein coding sequence controlled by the hTERTp promoter element is located downstream of the hTERTp promoter element.

[0089] The above-mentioned recombinant herpes simplex virus, among which The hTERTp-fluorescent protein expression cassette includes: an hTERTp promoter element, a fluorescent protein coding sequence located downstream of the hTERTp promoter element, and optionally a terminator element located downstream of the fluorescent protein coding sequence. The transcription direction of the expression cassette is opposite to that of the ICP4 promoter in the herpes simplex virus genome.

[0090] In one embodiment, the deleted ICP4 coding sequence is located between the ICP4 FLR1 and ICP4 FLR2 regions. In one embodiment, the ICP4 promoter in the recombinant herpes simplex virus is not deleted. In one embodiment, the insertion cassette is located between the ICP4 FLR1 and ICP4 FLR2 regions in the genome; in another embodiment, the insertion cassette is located at the site where the ICP4 coding sequence is deleted; in yet another embodiment, the insertion cassette is located between 126778 and 131734 of the viral genome (based on the complete genomes of 17 HSV-1 strains).

[0091] One embodiment provides a method for preparing the recombinant herpes simplex virus as described above, comprising: The steps include deleting the ICP4 coding sequence from the genome of a recombinant herpes simplex virus containing the ICP4 gene and inserting an hTERTp-fluorescent protein expression cassette between the ICP4 FLR1 and ICP4 FLR2 regions, the steps of which include: (1) Constructing homologous recombinant plasmids for inserting expression cassettes Homologous recombination plasmids are obtained using plasmids as vectors. The homologous recombination plasmids include a 5' homologous arm and a 3' homologous arm for homologous recombination, as well as an hTERTp promoter element, a fluorescent protein coding sequence, and a terminator element located between the 5' homologous arm and the 3' homologous arm. (2) The homologous recombination plasmid obtained in (1) is transfected into the cell with the virus to be recombined to perform homologous recombination and obtain recombinant herpes simplex virus.

[0092] One embodiment provides the above preparation method, wherein the fluorescent protein coding sequence is selected from the coding sequences of red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, and green fluorescent protein, preferably green fluorescent protein. In one embodiment, the green fluorescent protein coding sequence can be replaced with a fluorescent protein coding sequence selected from red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, etc.

[0093] One embodiment provides a pharmaceutical composition comprising the recombinant herpes simplex virus of the above embodiments, and a pharmaceutically acceptable carrier or excipient.

[0094] The recombinant herpes simplex virus of the above embodiments is used in the preparation of reagents for treating cancer. It is also used in the preparation of reagents for detecting stem cells, immune cells, and / or tumor cells, and in immune assessment. Finally, it is used in screening tumor drugs.

[0095] One embodiment provides a TERT activity assay kit comprising the recombinant herpes simplex virus of the above embodiments, wherein the assay cells are selected from stem cells, tumor cells, and / or immune cells.

[0096] Example The embodiments disclosed herein are for illustrative purposes only and are not intended to limit the scope of protection of this disclosure. Those skilled in the art, based on their understanding of the core concepts of this disclosure, can make various modifications or substitutions to the specific methods, reagents, components, steps, etc., in the embodiments, and these modifications or substitutions should not limit this disclosure in any way.

[0097] Example 1: Construction and validation of TERT-responsive fluorescent recombinant herpes simplex virus In this embodiment, the inventors constructed a TERT-responsive fluorescent recombinant herpes simplex virus using type I herpes simplex virus as a viral vector. The specific steps are as follows. A schematic diagram of gene editing is shown below. Figure 3 . Figure 3 In the diagram, the triangular arrow between FLR1 and FLR2 indicates that this is the promoter and the transcription direction of the promoter. The blue triangular arrow (near FLR1) represents the hTERTp promoter, the white triangular arrow (near FLR2) represents the ICP4 promoter, and the green rectangle represents the coding sequence of mBaojin.

[0098] 1) Constructing a homologous recombination plasmid that edits the ICP4 site of the HSV1 virus: like Figure 3 As shown, approximately 1500 bp upstream and downstream of the HSV1 virus ICP4 coding sequence were designed as homologous recombination sequences (homologous arms), and the expression cassette hTERTp-mBaoJin was inserted between these two homologous recombination sequences. Using pcDNA3.4 plasmid as a vector, the two homologous recombination sequences and the expression cassette hTERTp-mBaoJin located between them were inserted into the vector. This resulted in the deletion of the ICP4 coding sequence between the HSV1 virus ICP4 FLR1 region and the ICP4 FLR2 region after homologous recombination, and the insertion of the expression cassette hTERTp-mBaoJin at that position.

[0099] Specifically, firstly, a gene sequence is obtained through commissioned full-sequence gene synthesis. This gene sequence contains a 5' homologous arm and a 3' homologous arm, and includes the expression cassette hTERTp-mBaoJin connected between the two homologous arms. The expression cassette hTERTp-mBaoJin contains the hTERTp promoter, encoding the mBaoJin sequence, BGHpA, with specific elements and orientations as follows. Figure 4 As shown.

[0100] The 5' homologous arm is a 1524 bp DNA sequence located at positions 125254-126777 of the HSV1 viral genome, and the 3' homologous arm is a 1666 bp DNA sequence located at positions 131735 bp-133400 of the HSV1 viral genome. The full-length sequence of the expression cassette hTERTp-mBaoJin is shown in SEQ ID NO:4. The sequence of the hTERTp promoter is shown in SEQ ID NO:1, the coding sequence of mBaoJin is shown in SEQ ID NO:2, and the sequence of BGHpA is shown in SEQ ID NO:3.

[0101] Then, the synthesized full-sequence gene sequence was placed into the pcDNA3.4 plasmid vector to obtain the plasmid pHSV1-d4-hTERT-mBaoJin. The constructed plasmid pHSV1-d4-hTERT-mBaoJin was sequenced to verify that the insertion position and the inserted fragment were correct.

[0102] 2) Construct recombinant HSV1-hTERT-mBaoJin virus The HSV1-hTERT-mBaoJin virus was constructed using homologous recombination technology.

[0103] Test materials Construction vector: HSV1 virus, HSV1 17+ strain, purchased from Wuhan Binhui Biotechnology Co., Ltd.; Vero cells, brand: USA / ATCC (American Center for Type Culture Collection); Calcium phosphate transfection kit, purchased from Invitrogen.

[0104] First, Vero cells were seeded in a gradient (2E6 / well) into six-well plates and cultured overnight. Wells with 80% cell confluence after overnight culture were used as transfection wells. 6 μg of plasmid pHSV1-d4-hTERT-mBaoJin and the constructed vector HSV1 viral DNA were co-transfected into each well using calcium phosphate transfection.

[0105] 48 hours after transfection, the six-well plates were frozen at -70°C for at least 2 hours. After thawing, the culture supernatant from the six-well plates was seeded into Vero cells for overnight culture.

[0106] Subsequently, under a fluorescence microscope, green fluorescent phage spots were selected to obtain the successfully constructed HSV1-hTERT-mBaoJin virus.

[0107] Purification and virus titer detection The aforementioned green fluorescent phagocytic plaques were further inoculated into Vero cells for culture. After six rounds of purification, purified HSV1-hTERT-mBaoJin virus was obtained, denoted as the original seed culture P0.

[0108] The original seed culture P0 was further inoculated into T300 cell culture flasks to obtain harvest culture P1. The P1 harvest culture was centrifuged at 4000 r / min for 20 min, and the supernatant was collected. The supernatant was then centrifuged at 12000 r / min for 2 h, and the precipitate was collected.

[0109] The precipitate was resuspended in a certain volume of cell culture medium to obtain virus concentrate P3. After serial dilution of virus concentrate P3 by 10-fold, it was inoculated into Vero cells in 96-well plates. The cytopathic effect was then observed, and the viral titer of the obtained HSV1-hTERT-mBaoJin was detected. At the same time, the diseased cells were used as PCR templates to identify the gene modification of the viral editing region.

[0110] PCR identification The Vero cells described above were used as a PCR template for identification, confirming the correct construction of the recombinant virus. The identification primer information is as follows:

[0111] Electrophoresis diagram of PCR products is shown below. Figure 1 .

[0112] Example 2: HSV1-hTERT-mBaoJin infection of human umbilical cord mesenchymal stem cells Test materials Human umbilical cord mesenchymal stem cells: purchased from Wuhan Binhui Biotechnology Co., Ltd.

[0113] Culture medium: Mesenchymal stem cell medium MSCM (Catalog No. 7501, Brand: SCIENCELL).

[0114] Mesenchymal stem cells (human umbilical cord mesenchymal stem cells) were seeded at a cell density of 2E6 cells / well in six-well plates and cultured overnight in MSCM mesenchymal stem cell culture medium.

[0115] After overnight culture, cells were infected with HSV1-hTERT-mCFP virus (infection group), while the control group (mock infection group) received no virus. The virus infection titer was MOI 0.1. After inoculation, cells were cultured at 37°C and 5% CO2 for 24 hours. Green fluorescence was observed under a fluorescence microscope at 6 hours and 24 hours. The results are shown below. Figure 2 .

[0116] The results showed that TERT-active stem cells infected with the hTERT-ICP4-mBaoJin recombinant herpes simplex virus constructed in this disclosure exhibited strong green fluorescence. These results demonstrate that the method disclosed herein can be used to construct indicator viruses highly sensitive to TERT activity, and these viruses can be used for fluorescence imaging of cells, fresh tissues, and living organisms.

[0117] sequence list SEQ ID NO:1, hTERTp promoter tggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagc gcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggaggg actggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccc tcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg SEQ ID NO:2, mBaoJin encoding sequence atggtctcaaagggagaggaggaaaacatggctagtacaccatttaaatttcaacttaaaggaaccatcaatggcaaatcgtttaccgttgaaggcgaaggtgaagggaactcacatgaaggttctcataaaggaaaatatgtttgtacaagtggaaaactaccgatgtcatgggcagcacttgggacaacctttggttatggaatgaaatattataccaaatatcctagtggactgaagaactggtttcgtgaagtaatgcccggaggctttacctacgatcgtcatattcaatataaaggcgatgggagtatccatgcaaaacaccaacactttatgaaaaatgggacttatcacaacattgtagaatttaccggtcaggattttaaagaaaatagtccagtcttaactggagatatgaatgtctcattaccgaatgaagtcccacaaatacccagagatgatggagtagaatgcccagtgaccttgctttatcctttattatcggataaatcaaaatacgtcgaggctcaccaatatacaatctgcaagcctcttcataatcaaccagcacctgatgtcccatatcactggattcgtaaacaatacacacaaagcaaagatgatgccgaggaacgcgatcatatctgtcaatcagagactctcgaagcacacttaaagggcatggacgagctgtataag SEQ ID NO:3 BGHpA sequence gtgtcacctaaatgctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagc SEQ ID NO:4 Expression cassette hTERTp-mBaoJin-BGHpA SEQ ID NO:5 upstream primer mBaoJin F atggtctcaaagggagaggaggaaaacatggc SEQ ID NO:6 Downstream primer mBaoJin R aacaacagatggctggcaactagaaggca.

Claims

1. Recombinant herpes simplex virus, among which In a herpes simplex virus genome containing the ICP4 gene, the ICP4 coding sequence was replaced with an hTERTp-fluorescent protein expression cassette, the transcription direction of which was opposite to that of the ICP4 promoter in the original herpes simplex virus genome. The hTERTp-fluorescent protein expression cassette includes an hTERTp promoter element and a fluorescent protein coding sequence controlled by the hTERTp promoter element.

2. The recombinant herpes simplex virus according to claim 1, wherein the fluorescent protein coding sequence under the control of the hTERTp promoter element is located downstream of the hTERTp promoter element.

3. The recombinant herpes simplex virus according to claim 1 or 2, wherein... The hTERTp-fluorescent protein expression cassette includes: an hTERTp promoter element, a fluorescent protein coding sequence located downstream of the hTERTp promoter element, and optionally a terminator element located downstream of the fluorescent protein coding sequence.

4. A method for preparing recombinant herpes simplex virus according to any one of claims 1-3, comprising: The steps include deleting the ICP4 coding sequence from the genome of a recombinant herpes simplex virus containing the ICP4 gene and inserting an hTERTp-fluorescent protein expression cassette between the ICP4 FLR1 and ICP4 FLR2 regions, the steps of which include: (1) Constructing homologous recombinant plasmids for inserting expression cassettes Homologous recombination plasmids are obtained using plasmids as vectors. The homologous recombination plasmids include a 5' homologous arm and a 3' homologous arm for homologous recombination, and an hTERTp promoter element, a fluorescent protein coding sequence, and a terminator element located between the 5' homologous arm and the 3' homologous arm. (2) The homologous recombination plasmid obtained in (1) is transfected into the cell with the viral DNA to be recombined to obtain recombinant herpes simplex virus.

5. The preparation method according to claim 4, wherein the fluorescent protein is selected from: red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, and green fluorescent protein.

6. A pharmaceutical composition comprising the recombinant herpes simplex virus of any one of claims 1-3, and a pharmaceutically acceptable carrier or excipient.

7. The use of the recombinant herpes simplex virus according to any one of claims 1-3 in the preparation of reagents for diagnosing cancer.

8. The use of the recombinant herpes simplex virus according to any one of claims 1-3 in the preparation of reagents for detecting stem cells, tumor cells, and / or immune cells.

9. The use of recombinant herpes simplex virus according to any one of claims 1-3 in immune assessment.

10. A telomerase activity assay kit comprising recombinant herpes simplex virus according to any one of claims 1-3, wherein the telomerase activity is derived from stem cells, tumor cells, and / or immune cells.

Images