Telomerase activity indicating recombinant herpes simplex virus as well as preparation method and application thereof
By inserting a reverse hTERTp promoter and a fluorescent protein expression cassette into herpes simplex virus, the problem of real-time detection of telomerase activity at the single-cell level in existing technologies has been solved, enabling selective replication and live cell indication, and improving the accuracy and safety of tumor diagnosis and research.
Patent Information
- Application Number
- CN202511747973.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies are unable to detect telomerase activity in real time at the single-cell level, and cannot selectively replicate and indicate telomerase activity in living cells, thus limiting the early diagnosis of tumor cells and multi-omics research.
By deleting the ICP4 coding sequence of herpes simplex virus using CRISPR/Cas9 technology and inserting a reverse-transcribed hTERTp promoter and a fluorescent protein expression cassette, a recombinant herpes simplex virus was constructed. This virus replicates and expresses fluorescence only in cells with high TERT expression, achieving selective replication and live cell indication.
It enables the identification and sorting of TERT-active cells at the single-cell level, and can detect telomerase activity in real time, which can be used for early tumor diagnosis and multi-omics research, improving the sensitivity and safety of detection.
Smart Images

Figure CN121555439A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a recombinant herpes simplex virus and its preparation method, as well as a technique for indicating telomerase-active cells using the recombinant herpes simplex virus, and includes a detection kit containing the virus. The recombinant herpes simplex virus improves selective replication ability and telomerase activity indication ability in telomerase-active cells. This invention relates to its application in detecting telomerase-active cells such as tumor cells, stem cells, and immune cells, and in the preparation of tumor detection and therapeutic drugs. Background Technology
[0002] Telomeres are special structures at the ends of eukaryotic chromosomes. Their function is to maintain chromosome structural stability, including preventing chromosome ends from fusing, protecting chromosome structural genes, and preventing the loss of genetic information during replication.
[0003] Telomerase is a reverse transcriptase composed of small RNA and protein molecules. It uses its own RNA as a template to synthesize telomeric DNA, compensating for the gradual shortening of telomeres during cell mitosis. It has three main components: human telomerase RNA (hTR), telomerase-associated protein (TP1 / TLP1), and human telomerase reverse transcriptase (hTERT). Telomerase RNA is expressed in most cells, while human telomerase reverse transcriptase is the rate-limiting component of telomerase, expressed only in telomerase-positive cells, and is associated with telomerase activity.
[0004] Telomerase is inactive in most normal human cells, but it is highly active in stem cells, germ cells, and tumor cells.
[0005] The TERT (telomerase reverse transcriptase) gene knockout mouse model has confirmed the role of telomeres in aging. Telomere dysfunction accelerates signs and symptoms of aging, such as shortened life expectancy, physical aging, and reduced tissue stem cell reserves.
[0006] Telomerase activity can be detected in most tumor cells, such as lung cancer, colon cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, and leukemia. Therefore, based on this characteristic of telomerase, its activity is often detected clinically for the diagnosis of neoplastic diseases.
[0007] There are many methods for detecting telomerase activity. Isotope methods are highly sensitive, but they suffer from radioactive contamination and require a long time. Staining methods are simple to operate and quick, but they can only detect relative telomerase activity and still have many limitations: they cannot detect telomerase activity at the single-cell level; they cannot detect telomerase activity in real time in live cells; they cannot use telomerase as a marker to sort single cells with flow cytometry for subsequent multi-omics studies; and they cannot capture or sort rare cells with high telomerase activity.
[0008] Currently, there are HSV1 viruses that insert hTERTp-ICP4 at the ICP4 site and CMV-GFP at the ICP34.5 site. In these viruses, GFP expression is not directly controlled by hTERTp. Summary of the Invention
[0009] TERT is strictly regulated in normal somatic cells, and no TERT is expressed in mature cells. However, most tumor cells maintain telomere length by abnormally upregulating TERT expression. In cells with stem cell activity, the TERT promoter also has high activity.
[0010] Herpes simplex virus (HSV) possesses good replication ability and safety, making it suitable for gene therapy or delivery, and it has received widespread attention in cancer treatment. Herpes simplex virus type I (HSV-1) is a double-stranded DNA virus approximately 152 kb in length, belonging to the alphaherpesvirus subfamily. HSV-1 can enter cells via HVEM (herpesvirus entry medium, also known as TNFRSF14) and replicate in the nucleus of infected host cells. It is a broad-spectrum virus and a commonly used oncolytic virus. Herpes simplex virus type II (HSV-2) has a genome length of approximately 154 kb and belongs to the alphaherpesvirus subfamily of the herpesviridae family, similar to HSV-1. It is also a broad-spectrum virus and a commonly used oncolytic virus.
[0011] The inventors discovered that by replacing the ICP4 coding gene of oncolytic type II human herpes simplex virus with an hTERTp promoter that reverses the transcription direction and the ICP4 coding sequence and fluorescent protein coding sequence under its control, the obtained type II recombinant herpes simplex virus selectively replicates only in cells with TERT activity, and after the type II recombinant herpes simplex virus successfully infects cells, the strength of TERT activity in the cells can be indicated by red fluorescence.
[0012] The present invention aims to provide a recombinant herpes simplex virus that selectively replicates in cells that highly express human TERT reverse transcriptase and does not replicate in cells that do not express human TERT. The present invention also aims to provide a recombinant herpes simplex virus that indicates TERT activity by replicating in cells that highly express human TERT and expressing a fluorescent protein.
[0013] The first objective of this invention is to provide a method for modifying recombinant herpes simplex virus.
[0014] Pharmaceutical compositions comprising the recombinant herpes simplex virus of the present invention.
[0015] The second objective of this invention is to provide a stem cell activity detection kit and a tumor diagnostic kit.
[0016] The third objective of this invention is to provide a live biological fluorescence imaging technology, including a safe and efficient gene delivery system for delivering imaging genes into cells, and an imaging element that is highly responsive to TERT activity, wherein the imaging element comprises an hTERT promoter element (hTERTp) and a fluorescent protein expression cassette controlled by it.
[0017] The invention's objective and the solution to its technical problems can also be achieved using the following technical measures in the recombinant herpes simplex virus, where the viral modification is performed in the ICP4 region of the viral genome. The fluorescent protein expression cassette is selected from the hTERT-ICP4-fluorescent protein expression cassette, which comprises: an hTERTp promoter element, an ICP4 coding sequence connected downstream of the hTERTp promoter element, a fluorescent protein (e.g., red fluorescent protein mCherryFP or other fluorescent proteins) coding sequence connected downstream of the hTERTp promoter element, and a terminator element. Furthermore, the transcription direction of the fluorescent protein expression cassette is opposite to that of the ICP4 promoter in the genome.
[0018] The recombinant herpes simplex virus, wherein the ICP34.5 gene is optionally deleted.
[0019] The recombinant herpes simplex virus is selected from herpes simplex virus type II (HSV 2).
[0020] The recombinant herpes simplex virus, wherein the type II herpes simplex virus is selected from type II herpes simplex oncolytic virus (oHSV 2).
[0021] The recombinant herpes simplex virus has the microbial preservation number CCTCC NO:V202586.
[0022] The objective of this invention and the technical problem it solves are achieved by the following technical solution. A method for preparing recombinant herpes simplex virus according to this invention includes the following steps: The wild-type ICP4 coding sequence of recombinant herpes simplex virus was deleted using CRISPR / Cas9 technology. An hTERTp promoter element was then inserted into the recombinant herpes simplex virus, linking to the ICP4 coding sequence downstream of hTERTp, and to a fluorescent protein coding sequence and a terminator element downstream of hTERTp. The transcriptional direction of the aforementioned hTERTp promoter element, ICP4 coding sequence, and fluorescent protein coding sequence is opposite to that of the wild-type ICP4 coding sequence. (1) Constructing a CRISPR / Cas9 plasmid that targets the ICP4 region of the viral genome a. Using pX459V2.0 plasmid as a vector, construct plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2. The plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 can target and cleave target sites 1 and 2 of the ICP4 region of the viral genome. They are preferably constructed using homologous recombination, with the start and end points of the original ICP4 coding sequence to be replaced located at target sites 1 and 2, respectively. The target site editing site sequence of plasmid pX459 V2.0 sgICP4-1 (SEQ ID NO:11): gcgggtcgaacatgagggccggg; The target site 2 editing site sequence of plasmid pX459 V2.0 sgICP4-2 (SEQ ID NO:12): cggggcgcagtaggcctccaggg, The sequence of the edited region in shuttle plasmid pX459 V2.0 is shown in SEQ ID NO:6. The homologous recombination primers for plasmid pX459 V2.0 sgICP4-1 are as follows: sgICP4 1: tggctttatatatcttgtggaaaggacgaaacaccgcgggtcgaacatgagggcc (SEQID NO: 14); sgICP4 2:taacttgctatttctagctctaaaacggccctcatgttcgacccgcggtgtttc (SEQID NO: 15); The homologous recombination primers for plasmid pX459 V2.0 sgICP4-2 are as follows: sgICP4 3:ctttatatatcttgtggaaaggacgaaacaccgcggggcgcagtaggcctcca (SEQ IDNO: 16); sgICP4 4: ttaacttgctatttctagctctaaaactggaggcctactgcgccccgcggtgtttc (SEQID NO: 17), The shuttle plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 were obtained. (2) Construct homologous recombinant plasmids for inserting expression cassettes 2a. A gene sequence is obtained through full-sequence gene synthesis, the gene sequence comprising two homologous arms and an hTERTp-ICP4-fluorescent protein-BGHpA expression cassette connected between the two homologous arms, wherein the two homologous arms are the DNA sequence from positions 128145 to 129181 of the HSV2HG52 genome (ICP4 downstream) and the DNA sequence from positions 132097 to 133444 (ICP4 upstream). The hTERTp-ICP4-fluorescent protein-BGHpA expression cassette comprises: an hTERTp promoter element, an ICP4 coding sequence downstream of the hTERTp promoter element, a fluorescent protein coding sequence downstream of the hTERTp promoter element, and a terminator element, preferably BGHpA. 2b. Insert the two homologous arms and the expression cassette connected between the two homologous arms into the pcDNA3.4 plasmid to obtain the ICP4 site homologous recombinant plasmid pHG52ICP4-htert-ICP4-fluorescent protein-BGHpA.
[0023] (3) The three plasmids constructed in (1) and (2) and the virus to be recombined were transfected into Vero cells. After homologous recombination, the original ICP4 coding sequence of herpes simplex virus was deleted and replaced with an hTERTp promoter element with the opposite transcription direction. The ICP4 coding sequence downstream of the hTERTp was connected, as well as the fluorescent protein coding sequence and terminator element downstream of the hTERTp, so that the recombinant virus emitted fluorescence. The deleted original ICP4 coding sequence was selected from the complete, full-length ICP4 coding sequence. The inserted foreign gene is located in the HSV2 viral genome between the ICP4 FR1 and ICP4 FR2 regions, and can be, for example, the sequence shown in SEQ ID NO:2, or a sequence with 99-95% or more identity with it.
[0024] After several rounds of plaque purification, fluorescent plaques were selected to purify the recombinant virus oHSV2-hTERT-fluorescent protein virus.
[0025] The invention's purpose and the solution to its technical problems are further achieved through the following technical measures.
[0026] In the above-mentioned method for preparing recombinant herpes simplex virus, the fluorescent protein can be selected from fluorescent proteins of various colors, such as green fluorescent protein, blue fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc., and preferably a fluorescent protein suitable for live cell labeling.
[0027] There are no particular limitations on fluorescent proteins suitable for live cell labeling, and the higher the fluorescence intensity, the better. For example, the following properties are preferred: monomeric (to avoid interfering with the function of the target protein); rapid maturation: ≤1 hour (suitable for dynamic process tracking); high photostability: resistant to laser bleaching (especially for long-term imaging); low pH sensitivity: maintains fluorescence in acidic organelle environments (such as lysosomes and Golgi apparatus); efficient folding at 37°C (suitable for mammalian cell expression).
[0028] The red fluorescent protein can be derived from corals, jellyfish, and sea anemones (e.g., Discosoma striata). The fluorescence emission spectrum peak of the red fluorescent protein DsRed derived from Discosoma striata is 583 nm, while the main peak of the excitation spectrum is 558 nm, with other minor peaks around 500 nm. The fluorescent protein can be selected from red (or cherry) fluorescent proteins mCherry, mScarlet, mApple, orange fluorescent proteins mOrange, mOrange2, etc., with mCherry being preferred.
[0029] MCherry for Discosoma The monomeric red fluorescent protein mCherry, derived from *Sp. mushroom coral*, exhibits high brightness, rapid maturation, good photostability, and low toxicity. MCherry is suitable for long-term live cell tracking and is suitable for multicolor labeling due to its lack of spectral overlap with GFP / YFP. In one embodiment, the red fluorescent protein mCherry of this invention includes already developed mCherry variants, such as those with low cytotoxicity and altered excitation and emission spectra. These variants may have different colors, such as mCherry2, LSSmCherry1, RDSmCherry0.1, RDSmCherry0.2, RDSmCherry0.5, RDSmCherry1, etc.
[0030] The above-mentioned method for preparing recombinant herpes simplex virus further includes a step of sequencing or PCR identification of the plasmids involved to confirm that the construction is correct and that no mutations have occurred.
[0031] The objectives of this invention and the technical problems it solves are also achieved by the following technical solutions. A pharmaceutical composition according to this invention comprises the aforementioned recombinant herpes simplex virus, and a pharmaceutically acceptable carrier or excipient.
[0032] Another objective of this invention is to provide the application of the above-mentioned recombinant herpes simplex virus in the preparation of drugs for diagnosing and treating cancer, in the study of tumor mechanisms of action and stem cell mechanisms of action, in health evaluation, in immune assessment, in the screening of tumor drugs, in the development of diagnostic reagents and in the establishment of animal models.
[0033] Another object of the present invention is to provide a stem cell and immune cell activity detection kit and a tumor imaging, indicator and / or detection kit, which comprises the above-mentioned recombinant herpes simplex virus or the recombinant herpes simplex virus prepared by the above method.
[0034] The samples for testing are selected from the subject's whole blood, fresh tissues and body fluids, or for in vivo imaging, but are not limited to these.
[0035] Compared with the prior art, the present invention has obvious advantages and beneficial effects, and has industrial practical value, and has at least the following advantages.
[0036] 1. The recombinant virus disclosed herein can recognize, enrich, and sort TERT-highly active cells at the single-cell level; 2. The recombinant virus disclosed herein can be used to capture live cells for subsequent multi-omics research and analysis; 3. The recombinant virus disclosed herein can accurately count live cells with high proliferative potential, and therefore can be used for tumor screening, early diagnosis, immune assessment, biological age assessment, stem cell quality control, and in vivo tracking.
[0037] This disclosure relates to recombinant viruses and their applications. (1) Compared with existing herpesviruses, the recombinant herpes simplex virus of the present invention can effectively and selectively replicate in human cells with high TERT activity, such as stem cells, tumor cells, and immune cells, but not in normal human cells, thus having higher biosafety.
[0038] Recombinant herpes simplex virus has strong cell selectivity and will not cause normal cells to appear in the detection, thus it is suitable for identifying, enriching and sorting cells with high human TERT activity at the single-cell level. When applied to modify oncolytic viruses, the modified viruses can more effectively kill cancer cells and protect normal cells.
[0039] (2) The fluorescent protein of the recombinant herpes simplex virus of the present invention has high fluorescence sensitivity, and can be used to observe the size, volume and drug location of tumors through imaging, and to assess and indicate the content and activity of stem cells, etc.; it can be used to quickly, accurately, sensitively and broadly realize the early diagnosis of tumors and the diagnosis of tumor metastasis.
[0040] (3) The recombinant herpes simplex virus obtained in this invention is classified as human herpes simplex virus oHSV2-hTERT-ICP4-mCFP, with the Latin scientific name Human alpha herpesvirus 2 and the biological preservation number CCTCC: V202586.
[0041] (4) The target of this invention can be type I or type II herpes simplex virus, and can be an oncolytic virus or not. This invention provides an example of modifying a virus by removing the ICP 34.5 gene, only to demonstrate that the purpose of this invention can be achieved even in such modified viruses. The implementation of this invention does not depend on whether the gene is removed, nor on whether the virus is an oncolytic virus, and can be applied flexibly and widely.
[0042] (5) The recombinant virus disclosed herein can detect TERT activity at the single-cell level; can detect TERT activity in real time in the live cell state; can use TERT as a marker to sort single cells with flow cytometry for subsequent multi-omics research; and can be used to capture or sort rare cells with high TERT activity.
[0043] The above description is merely an overview of the present invention. To further understand the present invention, preferred embodiments will be described below in conjunction with examples. These descriptions are merely illustrative of the features and advantages of the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention. Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other. Attached Figure Description
[0044] To more clearly describe the technical solution of the present invention, a brief introduction will be given below in conjunction with the accompanying drawings. Obviously, these drawings are merely some specific embodiments described in the present invention. The present invention includes, but is not limited to, these drawings.
[0045] Figure 1 A schematic diagram illustrating the method for constructing the virus of the present invention. Figure 1 A is a diagram showing the location for editing in oHSV-2. Figure 1 B is a schematic diagram showing the location of the expression cassette inserted into the vector plasmid and the composition of the expression cassette.
[0046] Figure 2This is a schematic diagram of plasmid pX59 V2.0 sgICP4-1, showing the positions of the recombinant primers.
[0047] Figure 3 This is a schematic diagram of plasmid pX59 V2.0 sgICP4-2, showing the positions of the recombinant primers.
[0048] Figure 4 Electrophoresis image for PCR identification of recombinant herpes simplex virus.
[0049] Figure 5 Fluorescence micrograph of recombinant herpes simplex virus-infected mesenchymal stem cells.
[0050] Figure 6 Fluorescence micrograph of melanoma tumor cells A375 infected with recombinant herpes simplex virus.
[0051] Figure 7 Fluorescence micrograph of gastric cancer cells BGC823 infected with recombinant herpes simplex virus. Detailed Implementation
[0052] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Through these descriptions, the features and advantages of the present invention will become clearer and more apparent.
[0053] The term “exemplary” as used herein means “serving as an example, embodiment, or illustration.” Any embodiment illustrated herein as “exemplary” is not necessarily to be construed as superior to or better than other embodiments. Although various aspects of embodiments are shown in the accompanying drawings, the drawings are not necessarily drawn to scale unless specifically indicated otherwise.
[0054] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent applications, and publications cited in this document are incorporated herein in their entirety. When trade names appear herein, they are intended to refer to the corresponding product or its active ingredient.
[0055] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention. In this invention, it must be noted that, unless clearly stated otherwise, the singular form used in this specification and claims includes the plural form of the referred to. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.
[0056] Various methods can be used to carry out the reaction and purification techniques using kits with instructions provided by the manufacturer, or according to methods known in the art, or according to the methods described in this invention. Generally, the foregoing techniques and steps can be carried out by conventional methods well known in the art and described in various general or more specific documents, which are cited and discussed herein.
[0057] The term "subject" as used in this instruction manual refers to mammals including humans, primates such as chimpanzees, pet animals such as dogs and cats, livestock such as cattle, horses, sheep, and goats, and rodents such as mice and rats.
[0058] In this article, "sensitivity" refers to the value of (number of true positives) / (number of true positives + number of false negatives).
[0059] In this article, "specificity" refers to (number of true negatives) / (number of true negatives + number of false positives).
[0060] The recombinant herpes simplex virus used in this study was selected from HSV2, including oHSV2 (type II oncolytic herpes simplex virus).
[0061] In this study, the expression cassettes for ICP4 protein and fluorescent protein controlled by the hTERTp promoter can be selected from the hTERT-ICP4-fluorescent protein expression cassette, and the fluorescent protein in the expression cassette can be replaced with other types of fluorescent proteins.
[0062] This article does not have any particular restrictions on cells with TERT activity, cells with high TERT activity, or cells with high proliferative capacity. Examples include cancer cells (tumor cells), stem cells, immune cells, and germ cells.
[0063] In this article, stem cells refer to a class of cells with self-renewal capacity and multipotent differentiation potential. Based on their origin and differentiation potential, stem cells can be divided into several types, mainly including: embryonic stem cells (ESCs), adult stem cells (such as hematopoietic stem cells, neural stem cells, mesenchymal stem cells, etc.), and induced pluripotent stem cells (iPSCs).
[0064] Immune cells can induce high levels of TERT activity during the activation / proliferation phase. In this study, detectable immune cells can include those in the aforementioned phase, such as activated T cells and B cells: when these cells receive specific antigen stimulation and are activated through their antigen receptors (TCR or BCR), TERT activity is rapidly upregulated.
[0065] The alpha herpesvirus genome consists of two covalently bound segments: a long region (UL) and a short region (US). Each region is flanked by inverted repeat sequences. The repeat sequences between the UL and US are called internal repeats (IR), while the repeat sequences at both ends of the genome are called terminal repeats (TR). The ICP4 gene has one copy in each of the two repeat regions of the viral genome—IR and TR—making it one of only two double-copy genes in alpha herpesviruses.
[0066] The oHSV2-ICP34.5 used in this preparation method Δ The virus is merely an example; other recombinant or non-recombinant type I and type II herpes simplex viruses can be used in the method for preparing the virus disclosed herein, with a preference for viruses possessing oncolytic virus characteristics. The HSV strains used in this preparation method can be those commonly used in biological experiments, without special restrictions, such as those selected from: HSV2 333 strain, HSV2 HG52 strain, various oHSV2 strains, etc.
[0067] The location of the genes and elements mentioned in this article is described using HSV-2 HG52 strain, NC_001798, as an example.
[0068] The deleted original ICP4 coding sequence can be selected from the DNA sequence located in the HSV-2 HG52 virus genome: positions 139182-132096 and 149646-152560, with a sequence identity of 99-95% or more.
[0069] The inserted ICP4 coding sequence (the ICP4 coding sequence contained in the expression cassette) can be selected from the sequence located between the ICP4 FR1 and ICP4 FR2 regions in the HSV2 viral genome. Examples include DNA sequences at viral genome coordinates 129740-133717 and 153435bp-157412, with a sequence having 99-95% or more identity.
[0070] In this paper, bGH polyA (bovine growth hormone polyadenylation signal) is a transcription termination and tailing signal sequence derived from the bovine growth hormone gene.
[0071] In this article, stem cells refer to a class of cells with self-renewal capacity and multi-lineage differentiation potential. Based on their origin and differentiation potential, they can be divided into several types, mainly including embryonic stem cells (ESCs), adult stem cells (such as hematopoietic stem cells, neural stem cells, mesenchymal stem cells, etc.), and induced pluripotent stem cells (iPSCs). Embryonic stem cells possess unlimited proliferative capacity and multi-lineage differentiation potential, capable of differentiating into all types of adult cells.
[0072] Immune cells can induce high levels of TERT activity during the activation / proliferation phase. In this study, detectable immune cells can include those in the aforementioned phase, such as activated T cells and B cells: when these cells receive specific antigen stimulation and are activated through their antigen receptors (TCR or BCR), TERT activity is rapidly upregulated.
[0073] The present invention provides a recombinant herpes simplex virus, wherein the recombinant herpes simplex virus is made by replacing the ICP4 coding gene in the human herpes simplex virus genome with an ICP4 gene controlled by the hTERT promoter and a fluorescent protein expression cassette, which are transcribed in the opposite direction to the original ICP4 promoter.
[0074] In one embodiment, the herpes simplex virus containing the ICP4 gene used as the viral vector can be a wild-type herpes simplex virus, or a virus from which any gene segment (except the ICP4 gene and the ICP4 gene promoter) has been removed from the wild-type herpes simplex virus genome, but is not limited thereto. It can be any herpes simplex virus containing the ICP4 gene obtained by those skilled in the art through conventional techniques, and can be optionally a type I or type II herpes simplex virus.
[0075] In one embodiment, the biological accession number of the recombinant herpes simplex virus is CCTCC: V202586.
[0076] Preferably, the recombinant herpes simplex virus is an oncolytic virus or a virus that has been modified to be selective for tumors. In one embodiment, the recombinant herpes simplex virus may be a virus with the ICP34.5 gene deleted, which may make the oncolytic virus safer, promote immune response and enhance oncolytic activity, etc., but is not limited thereto, and may also be a virus that retains the ICP34.5 gene.
[0077] This invention provides a method for preparing recombinant herpes simplex virus, comprising the following steps: The original ICP4 coding sequence of recombinant herpes simplex virus was deleted using CRISPR / Cas9 technology and replaced with an hTERTp promoter element, an ICP4 coding sequence downstream of hTERTp, a fluorescent protein mCherryFP coding sequence downstream of hTERTp, and a BGHpA terminator element. These elements can be combined into an expression cassette for insertion.
[0078] The P2A sequence may be optionally present between the ICP4 encoded sequence and the mCherryFP encoded sequence.
[0079] The transcriptional direction (or transcriptional direction of the expression cassette) of the hTERTp promoter element, the ICP4 coding sequence, and the fluorescent protein mCherryFP (referred to as mFP in some nomenclature in this article) is opposite to that of the original wild-type ICP4 promoter and the original ICP4 coding sequence. In one embodiment, the method of deleting the original ICP4 coding sequence and inserting it as an expression cassette can use methods commonly used in the field of gene editing, such as CRISPR-HDR Prime Editing and non-CRISPR-dependent site-specific recombinase systems, in addition to CRISPR / Cas9 technology. The deleted original ICP4 coding sequence is preferably a complete full-length sequence, and there are no special requirements for the vector used; commonly used vectors in the field can be used.
[0080] In one embodiment, the fluorescent protein may be selected from green fluorescent protein, cyan fluorescent protein, red fluorescent protein expression cassette, yellow fluorescent protein, and other indicator proteins, preferably a fluorescent protein suitable for live cell labeling. Fluorescent proteins suitable for live cell labeling, for example, possess monomericity (to avoid interfering with target protein function); rapid maturation: ≤1 hour (suitable for dynamic process tracking); high photostability: resistant to laser bleaching (especially for long-term imaging); low pH sensitivity: maintaining fluorescence in acidic organelle environments (e.g., lysosomes, Golgi apparatus); and efficient folding at 37°C (for mammalian cell expression).
[0081] As a red fluorescent protein, it can be selected from tdTomato, mStrawberry, mRFP1, TagRFP / TagRFP-T, mKate / mKate2, mNeptune / mNeptune2, mCardinal, mScarlet, mRuby3, mCherryFP, preferably selected from monomeric fluorescent proteins mScarlet, mRuby3, mCherryFP, etc., and more preferably mCherryFP.
[0082] Recombinant viruses containing mCherryFP can be used for: a) fluorescence microscopy techniques, including wide-field fluorescence microscopy, laser scanning confocal microscopy, rotating disk confocal microscopy, two-photon microscopy, etc.; b) in vivo imaging, including small animal in vivo fluorescence imaging, where the red light emitted by mCherry (~610 nm) has better tissue penetration and lower autofluorescence background than green light; c) flow cytometry; d) fluorescence correlation spectroscopy / fluorescence cross-correlation spectroscopy; e) super-resolution microscopy, etc.
[0083] In one embodiment, the terminator may use those terminator elements commonly used in the art.
[0084] The method includes the following steps: (1) Constructing CRISPR / Cas9 plasmids that target two sites in the ICP4 region of the viral genome: a. Using pX459V2.0 plasmid as a vector, construct plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2. The plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 can target and cleave target sites 1 and 2 in the ICP4 region of the viral genome, and are preferably constructed using homologous recombination. The target site editing sequence of plasmid pX459 V2.0 sgICP4-1 is: gcgggtcgaacatgagggccggg (SEQ ID NO:11); The target site 2 editing site sequence of plasmid pX459 V2.0 sgICP4-2 is: cggggcgcagtaggcctccaggg (SEQ ID NO:12). The sequence of the edited region of shuttle plasmid pX459 V2.0 is shown in SEQ ID NO:6. Homologous recombination primers for plasmid pX459 V2.0sgICP4-1: sgICP4 1: tggctttatatatcttgtggaaaggacgaaacaccgcgggtcgaacatgagggcc (SEQID NO: 14); sgICP4 2:taacttgctatttctagctctaaaacggccctcatgttcgacccgcggtgtttc (SEQID NO: 15); Homologous recombination primers for plasmid pX459 V2.0 sgICP4-2: sgICP4 3:ctttatatatcttgtggaaaggacgaaacaccgcggggcgcagtaggcctcca (SEQ IDNO: 16); sgICP4 4: ttaacttgctatttctagctctaaaactggaggcctactgcgccccgcggtgtttc (SEQID NO: 17), The shuttle plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 were obtained. In one embodiment, the pX459V2.0 plasmid can be replaced with other plasmids commonly used in the art.
[0085] Target sites 1 and 2, located between homologous arm sequences, were selected as editing sites.
[0086] (2) Constructing viral homologous recombinant plasmids for inserting expression cassettes 2a. A gene sequence is obtained through full-sequence gene synthesis, the gene sequence comprising two homologous arms and an expression cassette hTERTp-ICP4-mCherryFP-BGHpA linked between the two homologous arms. The hTERTp-ICP4-mCherryFP-BGHpA expression cassette includes: an hTERTp promoter element, an ICP4 coding sequence downstream of the hTERTp promoter element, an mCherryFP coding sequence downstream of the hTERTp promoter element, and optionally a terminating element, preferably BGHpA. In one embodiment, the length of the two homologous arms can range from 1000 to 3000 bp, preferably from 1000 to 1500 bp. Preferably, the two homologous arms comprise a 5' homologous arm and a 3' homologous arm, wherein the 5' homologous arm is the DNA sequence at viral genome coordinates 128145-129181, and the 3' homologous arm is the DNA sequence at viral genome coordinates 132097-133444, with the viral genome coordinates referenced to the whole genome sequence of HSV2 HG52.
[0087] In one implementation, the method for obtaining the expression cassette, apart from full-sequence gene synthesis, can use common methods selected from PCR methods, without particular limitations.
[0088] 2b. Insert the two homologous arms and the expression cassette connected between the two homologous arms into the pcDNA3.4 plasmid to obtain the ICP4 site homologous recombination plasmid pHG52ICP4-htert-ICP4-mFP-BGHpA; In one embodiment, the pcDNA3.4 plasmid can be replaced with other plasmids commonly used in the art, such as pcDNA. TM 3.1 Upgrades or variants of the pcDNA series such as (+ / -), pEF series, pCMV series, pCI series, etc., as long as the plasmid copy number is high.
[0089] (3) The three plasmids constructed in (1) and (2) and the virus to be recombined were transfected into Vero cells. After homologous recombination, the wild-type ICP4 coding sequence of the recombinant herpes simplex virus was deleted and replaced with an hTERTp promoter element with the opposite transcription direction. The ICP4 coding sequence downstream of the hTERTp, and the fluorescent protein coding sequence and terminator element downstream of the hTERTp were connected, so that the recombinant virus emitted fluorescence. After several rounds of plaque purification, fluorescent plaques were selected to purify the recombinant virus oHSV2-hTERT-fluorescent protein virus.
[0090] The above-described method for preparing recombinant herpes simplex virus preferably further includes a step of sequencing or PCR identification of all involved plasmids and / or viruses to confirm that the construction is correct and that no mutations have occurred.
[0091] One embodiment of the present invention provides a pharmaceutical composition comprising the aforementioned recombinant herpes simplex virus and a pharmaceutically acceptable carrier or excipient.
[0092] One embodiment of the present invention provides the application of the above-mentioned recombinant herpes simplex virus in the preparation of drugs for diagnosing and treating cancer, studying the mechanism of action of tumors and stem cells, health diagnosis, immune assessment, screening of tumor drugs, development of diagnostic reagents and establishment of animal models, such as detecting and indicating the presence, location and activity of stem cells.
[0093] One embodiment of the present invention provides a stem cell, immune cell, tumor cell detection kit and a tumor imaging, indicator and / or detection kit, which contains the above-mentioned recombinant herpes simplex virus or the recombinant herpes simplex virus prepared by the above method.
[0094] The samples for testing can be selected from the subject's whole blood, fresh tissue and body fluids, or for in vivo imaging.
[0095] application The recombinant herpes simplex virus obtained in this invention can be preserved using conventional methods. For example, for short-term preservation, the virus can be directly sealed in or suspended in 50% glycerol saline and placed in a -30°C freezer. For long-term preservation, (1) rapid low-temperature freezing method can be used, in which inactivated animal serum or other protein protectants are added to the virus suspension, preferably dimethyl sulfoxide (e.g., 5% to 10%), and then rapidly frozen and stored at -70°C or -196°C. Tissue materials containing the virus can be directly cryopreserved: for example, first immersed in 50% glycerol buffered saline, and then cryopreserved (at -70°C or -196°C).
[0096] (2) Freeze-drying method: Dehydrating frozen virus suspensions under vacuum conditions. This typically involves low-temperature dehydration, followed by the removal of excess uncondensed water vapor from the condenser using a desiccant or condensation method. Commonly used desiccants include phosphorus pentoxide, calcium sulfate, calcium chloride, and silica gel.
[0097] This invention provides the use of viruses that express green fluorescent protein in response to TERT activity in indicating stem cells. This includes indicating the presence of human stem cells, such as human umbilical cord mesenchymal stem cells.
[0098] Instructing human stem cells using the virus or a kit containing the virus, specifically, the instruction includes the following steps: After mesenchymal stem cells were plated and cultured overnight, they were infected with the recombinant herpes simplex virus of the present invention (virus infection group). After inoculation, they were cultured at 37°C and 5% CO2, and the expression of green fluorescent protein was observed.
[0099] The application of this invention is not limited to human cells that naturally express TERT, in vivo or in vitro fresh tissues, but can also be used to evaluate other cells that artificially modify TERT, in vivo or in vitro fresh tissues, or other animal models.
[0100] The viral vector used in this preparation method is merely an example. Other recombinant or non-recombinant type I or type II herpes simplex virus can be used in the method for preparing the virus disclosed herein, preferably a virus with oncolytic virus characteristics. The HSV strain used in this preparation method can be selected from HSV2 HG52 strain, other clinically isolated HSV2 strains, and laboratory-modified HSV2 strains.
[0101] The type II herpes simplex virus strain prepared in this disclosure is deposited at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO: V202586. Deposit date: November 11, 2025. Classification and nomenclature: Human herpes simplex virus oHSV2-hTERT-ICP4-mCFP.
[0102] The present invention includes, for example, the following embodiments.
[0103] One embodiment provides a recombinant herpes simplex virus, wherein In the herpes simplex virus genome containing the ICP4 gene, the original ICP4 coding sequence is replaced with an hTERTp-ICP4-fluorescent protein expression cassette, which includes an hTERTp promoter element and, under the control of the hTERTp promoter element, an ICP4 coding sequence and a fluorescent protein coding sequence. The transcription direction of the expression cassette is opposite to that of the ICP4 promoter in the herpes simplex virus genome.
[0104] In one embodiment, the ICP4 coding sequence and the fluorescent protein coding sequence, controlled by the hTERTp promoter element, are located downstream of the hTERTp promoter element.
[0105] The recombinant herpes simplex virus described in the above embodiments, wherein the hTERTp-ICP4-fluorescent protein expression cassette comprises: an hTERTp promoter element, an ICP4 coding sequence located downstream of the hTERTp promoter element, a fluorescent protein coding sequence connected downstream of the hTERTp promoter element, and optionally a terminator element located downstream of the fluorescent protein coding sequence.
[0106] One embodiment provides a method for preparing the recombinant herpes simplex virus described in the above embodiments, comprising: The steps include deleting the original ICP4 coding sequence of the recombinant herpes simplex virus and inserting an hTERTp-ICP4-fluorescent protein expression cassette into the recombinant herpes simplex virus at the site where the original ICP4 coding sequence was deleted, the steps including: (1) Constructing a CRISPR / Cas9 plasmid that targets the ICP4 region of the viral genome Using pX459 V2.0 as a vector, CRISPR / Cas9 plasmids targeting the ICP4 region of the viral genome were constructed via homologous recombination, resulting in plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2. The plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 can respectively target and cleave target sites 1 and 2 of the ICP4 region of the viral genome. The start and end points of the original ICP4 coding sequence are located at target sites 1 and 2, respectively. Target 1 edit site sequence: gcgggtcgaacatgagggccggg (SEQ ID NO:11), Target 2 edit site sequence: cggggcgcagtaggcctccaggg (SEQ ID NO:12), Edit the region of the sequence shown in SEQ ID NO:6 in plasmid pX459 V2.0. Homologous recombination primers for plasmid pX459V2.0 sgICP4-1: sgICP4 1: tggctttatatatcttgtggaaaggacgaaacaccgcgggtcgaacatgagggcc (SEQID NO: 14); sgICP4 2:taacttgctatttctagctctaaaacggccctcatgttcgacccgcggtgtttc (SEQID NO: 15); Homologous recombination primers for plasmid pX459 V2.0 sgICP4-2: sgICP4 3:ctttatatatcttgtggaaaggacgaaacaccgcggggcgcagtaggcctcca (SEQ IDNO: 16); sgICP4 4: ttaacttgctatttctagctctaaaactggaggcctactgcgccccgcggtgtttc (SEQID NO: 17); (2) Constructing an ICP4 site homologous recombination plasmid for insertion into the expression cassette. 2a. Obtain the gene sequence, which contains two homologous arms and an expression cassette hTERTp-ICP4-fluorescent protein-BGHpA connected between the two homologous arms. The two homologous arms are the sequence 1000 bp upstream of the original ICP4 coding sequence in the viral genome and the sequence 1000 bp downstream of the original ICP4 coding sequence. The hTERTp-ICP4-fluorescent protein-BGHpA expression cassette comprises: an hTERTp promoter element, an ICP4 coding sequence downstream of the hTERTp promoter element, a fluorescent protein coding sequence downstream of the hTERTp promoter element, and a terminator element BGHpA. 2b. Insert the gene sequence into the plasmid to obtain the ICP4 site homologous recombination plasmid.
[0107] (3) Transfect the three plasmids constructed in (1) and (2) with the virus (viral vector) to be recombined into the cells and perform homologous recombination to obtain recombinant herpes simplex virus.
[0108] The preparation method described in the above embodiments includes deleting the ICP34.5 gene of the virus to be recombined before or after replacing the ICP4 coding gene.
[0109] The preparation method described in the above embodiments includes replacing the red fluorescent protein mCherryFP coding sequence with a fluorescent protein coding sequence selected from green fluorescent protein, blue fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc.
[0110] One embodiment provides a pharmaceutical composition, characterized in that the pharmaceutical composition comprises the recombinant herpes simplex virus described in the above embodiments, and a pharmaceutically acceptable carrier or excipient.
[0111] The above-described embodiments describe the application of the recombinant herpes simplex virus in the preparation of reagents for treating cancer. The above-described embodiments also describe the application of the recombinant herpes simplex virus in the preparation of reagents for detecting stem cells, tumor cells, and / or immune cells. Finally, the above-described embodiments describe the application of the recombinant herpes simplex virus in screening tumor drugs and in immune assessment.
[0112] One embodiment provides a cell detection kit comprising the aforementioned recombinant herpes simplex virus, wherein the cells are selected from stem cells, tumor cells, and / or immune cells. The stem cells are selected from human umbilical cord mesenchymal stem cells.
[0113] Example The embodiments disclosed herein are merely illustrative of the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art, based on their understanding of the core concept of the present invention, can make various modifications or substitutions to the specific methods, reagents, elements, steps, etc., in the embodiments, and these modifications or substitutions should not limit the present invention in any way.
[0114] Example 1: Construction and validation of TERT-responsive fluorescent recombinant herpes simplex virus In this embodiment, the inventors constructed a TERT-responsive fluorescent recombinant herpes simplex virus using oncolytic virus type II oHSV2 as the viral vector. The specific steps are as follows. A schematic diagram of gene editing is shown below. Figure 1 A. Figure 1 In diagram A, the triangular arrow between FLR1 and FLR2 indicates that this is the promoter and the transcription direction of the promoter. The blue triangular arrow (closer to FLR1) represents the hTERTp promoter, the white triangular arrow (closer to FLR2) represents the ICP4 promoter, and the red rectangle represents the coding sequence of mCFP.
[0115] 1) Edit oHSV2-ICP34.5 Δ and the design and construction of guided CRISPR / Cas9 plasmids First, a CRISPR / Cas9 system was designed to cut the ICP4 region of the herpes simplex virus type II genome, deleting the wild-type ICP4 coding gene from the virus. The deleted sequence did not include the ICP4 promoter.
[0116] Specifically, a targeted cleavage design was developed for the following two sites in the ICP4 region of the type II herpes simplex virus genome.
[0117]
[0118] Using the shuttle plasmid pX459V2.0 as a vector, CRISPR / Cas9 system plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 were constructed via homologous recombination. The sequence of the edited region in the shuttle plasmid pX459 V2.0 is shown in SEQ ID NO:6, the corresponding region in the constructed pX459 V2.0 sgICP4-1 is shown in SEQ ID NO:7, and the corresponding region in the constructed pX459 V2.0 sgICP4-2 is shown in SEQ ID NO:8. In the sequence listing at the end of this document, the U6 promoter is indicated by a single underscore, and the gRNA scaffold portion is indicated by a double underscore.
[0119]
[0120] The spectra of plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 are shown in the figure. Figure 2 , Figure 3 The constructed plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 were sequenced to verify the correct insertion position and fragment.
[0121] 2) Design and construction of ICP4 site homologous recombination plasmid Using pcDNA3.4 plasmid as a vector, approximately 1000-1500 bp of sequences upstream and downstream of the ICP4 site in the genome of type II herpes simplex virus were used as homologous recombination sequences to construct the ICP4 site homologous recombination plasmid pHG52ICP4-htert-ICP4-mCFP.
[0122] Specifically, firstly, through commissioned full-sequence gene synthesis, two homologous recombination sequences (homologous arms) and the hTERTp-ICP4-mCFP-BGHpA expression cassette linked between the two homologous arms were obtained. The hTERTp-ICP4-mCFP-BGHpA expression cassette contains the hTERTp promoter, the ICP4 coding fragment, the mCFP coding sequence, and BGHpA.
[0123] The sequence of the hTERTp-ICP4-mCFP-BGHpA expression cassette is shown in SEQ ID NO:13, the sequence of the hTERTp promoter is shown in SEQ ID NO:1, the sequence of the ICP4 coding fragment is shown in SEQ ID NO:2, the sequence encoding P2A is shown in SEQ ID NO:3, the sequence encoding mCFP is shown in SEQ ID NO:4, and the GH poly A sequence is shown in SEQ ID NO:5.
[0124] The two homologous arms are: the DNA sequence (1036 bp, downstream of ICP4) at genomic coordinates 128145-129181 of the HG52 virus, and the DNA sequence (1347 bp, upstream of ICP4) at 132097-133444. The genomic coordinates of the virus are referenced to the whole genome sequence of HSV2HG52.
[0125] The hTERT promoter sequence corresponds to positions 2960 to 3414 of the Homo sapiens gene for telomerase transcriptase, partial cds gene (Sequence ID: AB016767.1).
[0126] Then, the above sequence was inserted into the pcDNA3.4 plasmid vector to obtain the plasmid pHG52 ICP4-htert-ICP4-mCFP. A schematic diagram of the hTERTp-ICP4-mCFP expression cassette, including restriction enzyme sites, is shown below. Figure 1 B.
[0127] The constructed plasmid pHG52 ICP4-htert-ICP4-mCFP was sequenced to verify the correct insertion position and fragment.
[0128] 3) Construct recombinant oHSV2-hTERT-ICP4-mCFP virus The oHSV2-hTERT-ICP4-mCFP virus was constructed using CRISPR / Cas9 recombination technology.
[0129] Test materials oHSV2 virus oHSV2-ICP34.5Δ: purchased from Wuhan Binhui Biotechnology Co., Ltd.; the virus has the ICP34.5 gene of wild-type II herpes simplex virus strain HG52 removed. Vero cells, brand: USA / ATCC (American Center for Type Culture Collection). Calcium phosphate transfection kit, purchased from Invitrogen.
[0130] First, Vero cells were seeded into six-well plates at a gradient (2E6 / well) and cultured overnight. Wells where cell confluence reached 80% after overnight culture were used as transfection wells.
[0131] Six μg of plasmids (pX459 V2.0sgICP4-1, pX459 V2.0sgICP4-2, and pHG52ICP4-htert-ICP4-mCFP) were co-transfected into cells in each well using the calcium phosphate transfection method. The mass ratio of each plasmid in the co-transfection was pX459 V2.0sgICP4-1:pX459 V2.0sgICP4-2:pHG52ICP4-htert-ICP4-mCFP 1:1:2.
[0132] Four hours after transfection, the transfection wells were inoculated with oHSV2 virus oHSV2-ICP34.5Δ at an MOI of 0.1 and cultured overnight. Subsequently, under a fluorescence microscope, the phage plaques displaying red fluorescence were picked, yielding the successfully constructed oHSV2-hTERT-ICP4-mCFP virus.
[0133] Purification and virus titer detection The aforementioned red fluorescent phagocytic plaques were then inoculated into Vero cells for further culture. After six rounds of purification, purified oHSV2-hTERT-ICP4-mCFP virus was obtained, designated as the original seed culture P0.
[0134] The original seed culture P0 was further inoculated into T300 cell flasks. After culture, the culture supernatant was collected to obtain harvest culture P1. The harvest culture P1 was centrifuged at 4000 r / min for 20 min, and the supernatant was collected. The supernatant was then centrifuged at 12000 r / min for 2 h, and the precipitate was collected.
[0135] The precipitate was resuspended in a certain volume of cell culture medium to obtain virus concentrate P3. After serially diluting virus concentrate P3 10-fold, it was inoculated into Vero cells in 96-well plates. Cytopathic effects were then observed, and the viral titer of the obtained oHSV2-hTERT-ICP4-mCFP was detected. At the same time, the diseased Vero cells were used as PCR templates to identify gene modifications in the viral editing regions.
[0136] PCR identification The Vero cells described above were used as a PCR template for identification, confirming the correct construction of the recombinant virus. The identification primer information is as follows:
[0137] Electrophoresis diagram of PCR products is shown below. Figure 4 .
[0138] Example 2: oHSV2-hTERT-ICP4-mCFP infection of human umbilical cord mesenchymal stem cells Test materials Human umbilical cord mesenchymal stem cells (purchased from Wuhan Binhui Biotechnology Co., Ltd.) Human umbilical cord mesenchymal stem cells were seeded at a cell density of 2E6 cells / well in six-well plates and cultured overnight in complete mesenchymal stem cell culture medium.
[0139] After overnight culture, cells were infected with oHSV2-hTERT-ICP4-mCFP virus (infected group), with cells without virus serving as the control group (simulated infection group). The virus inoculation concentration was 0.1 MOI. After inoculation, cells were cultured at 37℃ and 5% CO2 for 16 h, and the expression of red fluorescence of mCherryFP (mCFP) was observed under a fluorescence microscope.
[0140] The results showed that the hTERT-ICP4-mCFP recombinant herpes simplex virus constructed in this invention could be detected with strong mCherryFP fluorescence in TERT-active stem cells. These results demonstrate that the method of this invention can be used to construct indicator viruses with high sensitivity to TERT activity, and these viruses can be used for fluorescence imaging of cells, fresh tissues, and living organisms.
[0141] Example 3: oHSV2-hTERT-ICP4-mCFP infection of human melanoma cells (A375) and gastric cancer cells BGC823 Test materials Melanoma cells A375: A-375 (human malignant melanoma cells), purchased from Wuhan Binhui Biotechnology Co., Ltd.
[0142] Gastric cancer cells BGC823: purchased from Wuhan Binhui Biotechnology Co., Ltd.
[0143] oHSV2-GFP virus: purchased from Wuhan Binhui Biotechnology Co., Ltd.; the virus has the ICP34.5 gene of wild type II herpes simplex virus strain HG52 knocked out, and a fluorescent protein expression cassette is inserted at the knocked-out ICP34.5 gene position.
[0144] Two types of tumor cells were seeded in six-well plates at a density of 2E6 cells / well. Melanoma cells A375 were cultured in DMEM high-glucose basal medium (10% fetal bovine serum), and gastric cancer cells BGC823 were cultured in RPMI-1640 medium (10% fetal bovine serum).
[0145] Two types of tumor cells were cultured overnight and then infected with oHSV2-hTERT-ICP4-mCFP virus (oHSV2-hTERT-ICP4-mCFP infection group), with oHSV2-GFP virus as the control group (oHSV2 infection group). The virus inoculation concentration was 0.1 MOI.
[0146] After inoculation with the virus, the cells were cultured at 37°C and 5% CO2 for 16 hours. The expression of mCherryFP (mCFP) fluorescence in the cells was then observed under a fluorescence microscope. Images of melanoma cells A375 and gastric cancer cells BGC823 under a fluorescence microscope are shown below. Figure 6 and Figure 7 .
[0147] The results showed that both cell types could be indicated by mCherryFP fluorescence, proving that the method of the present invention can be used to construct an indicator virus with high sensitivity to TERT activity. The virus can be used for fluorescence imaging of cells, fresh tissues, and living organisms.
[0148] The present invention has been described above with reference to preferred embodiments; however, these embodiments are merely exemplary and illustrative. Various substitutions and modifications can be made to the present invention based on these embodiments, all of which fall within the scope of protection of the present invention.
[0149] sequence list SEQ ID NO:1 hTERTp promoter: tggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg SEQ ID NO:2 ICP4 coding fragment: SEQ ID NO:3 P2A sequence: gccacgaacttctctctgttaaagcaagcaggagacgtggaagaaaaccccggtcct SEQ ID NO:4 mCherryFP coding sequence: atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa SEQ ID NO:5 BGH poly A sequence: ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaa taaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctgggga SEQ ID NO:6pX459 V2.0 edited region sequence (single underlined portion is U6 promoter; double underlined portion is gRNA scaffold): gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgg aattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagttt gcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctt tatatatcttgtggaaaggac gaaacaccgggtcttcgagaagacct gttttagagctagaaatagcaagttaaaa taaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc ; SEQ ID NO:7 pX459 V2.0 sgICP4-1 edited region sequence (single underlined portion represents U6 promoter; double underlined portion represents gRNA scaffold): gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgg aattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagttt gcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctt tatatatcttgtggaaaggac gaaacaccgcgggtcgaacatgagggcc gttttagagctagaaatagcaagttaa aataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc SEQ ID NO:8 pX459 V2.0 sgICP4-2 edited region sequence (single underlined portion represents U6 promoter; double underlined portion represents gRNA scaffold): gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgg aattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagttt gcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctt gaaacaccgcggggcgcagtaggcctcca SEQ ID NO:9 Identification primer P2A F: gccacgaacttctctctgttaaagcaagcagga SEQ ID NO:10 Identification primer mCFP R: Actgatcagcgagctctaggaattccagtta SEQ ID NO:11 Edit site sequence 1 gcgggtcgaacatgagggccggg SEQ ID NO:12 Edit site sequence 2 cggggcgcagtaggcctccaggg SEQ ID NO:13 Expression cassette hTERTp-ICP4-mCFP-BGHpA: SEQ ID NO:14 Homologous recombination primer sgICP4 1 tggctttatatatcttgtggaaaggacgaaacaccgcgggtcgaacatgagggcc SEQ ID NO:15 Homologous recombination primer sgICP4 2 taacttgctatttctagctctaaaacggccctcatgttcgacccgcggtgtttc SEQ ID NO:16 Homologous recombination primer: sgICP4 3 ctttatatatcttgtggaaaggacgaaacaccgcggggcgcagtaggcctcca SEQ ID NO:17 Homologous recombination primer: sgICP4 4 ttaacttgctatttctagctctaaaactggaggcctactgcgccccgcggtgtttc
Claims
1. Recombinant herpes simplex virus, among which In the herpes simplex virus genome containing the ICP4 gene, the original ICP4 coding sequence is replaced with the hTERTp-ICP4-fluorescent protein expression cassette, which includes an hTERTp promoter element and, under the control of the hTERTp promoter element, an ICP4 coding sequence and a fluorescent protein coding sequence. The transcription direction of the expression cassette is opposite to that of the ICP4 promoter in the original herpes simplex virus genome.
2. The recombinant herpes simplex virus according to claim 1, wherein... The ICP4 coding sequence and the fluorescent protein coding sequence, controlled by the hTERTp promoter element, are located downstream of the hTERTp promoter element.
3. The recombinant herpes simplex virus according to claim 1 or 2, wherein the hTERTp-ICP4-fluorescent protein expression cassette comprises: an hTERTp promoter element, an ICP4 coding sequence downstream of the hTERTp promoter element, a fluorescent protein coding sequence downstream of the hTERTp promoter element, and optionally a terminator element downstream of the fluorescent protein coding sequence.
4. A method for preparing recombinant herpes simplex virus according to any one of claims 1-3, comprising: The steps include deleting the original ICP4 coding sequence of the recombinant herpes simplex virus and inserting an hTERTp-ICP4-fluorescent protein expression cassette at the site where the original ICP4 coding sequence was deleted. (1) Constructing a CRISPR / Cas9 plasmid that targets the ICP4 region of the viral genome Using pX459 V2.0 as a vector, CRISPR / Cas9 plasmids that cleave the ICP4 region of the viral genome were constructed, resulting in plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2. The plasmids pX459 V2.0 sgICP4-1 and pX459 V2.0 sgICP4-2 target and cleave the ICP4 region of the viral genome at target sites 1 and 2, respectively. The start and end points of the original ICP4 coding sequence are located at target sites 1 and 2, respectively. The sequence of the edit site for target 1 is shown in SEQ ID NO:
11. The sequence of the edit site for target 2 is shown in SEQ ID NO:12; (2) Constructing an ICP4 site homologous recombination plasmid for insertion into the expression cassette. 2a. Obtain a gene sequence comprising two homologous arms for homologous recombination and an expression cassette hTERTp-ICP4-fluorescent protein-BGHpA linked between the two homologous arms. The expression cassette hTERTp-ICP4-fluorescent protein-BGHpA comprises: an hTERTp promoter element, an ICP4 coding sequence downstream of the hTERTp promoter element, a fluorescent protein coding sequence downstream of the hTERTp promoter element, and a terminator element BGHpA. 2b. Insert the gene sequence into a plasmid to obtain an ICP4 site homologous recombination plasmid; (3) The plasmids pX459 V2.0 sgICP4-1, pX459 V2.0 sgICP4-2 and ICP4 site homologous recombination plasmid obtained in (1) and (2) are transfected into cells with the viral DNA to be recombined, and homologous recombination is performed to obtain recombinant herpes simplex virus.
5. The preparation method according to claim 4, comprising deleting the ICP34.5 gene of the virus before replacing the original ICP4 coding sequence gene with the hTERTp-ICP4-fluorescent protein expression cassette.
6. The preparation method according to claim 4 or 5, wherein the fluorescent protein is selected from: red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, and green fluorescent protein.
7. A pharmaceutical composition comprising the recombinant herpes simplex virus of any one of claims 1-3, and a pharmaceutically acceptable carrier or excipient.
8. The use of the recombinant herpes simplex virus according to any one of claims 1-3 in the preparation of a reagent for treating cancer.
9. The use of the recombinant herpes simplex virus according to any one of claims 1-3 in the preparation of reagents for detecting stem cells, tumor cells, and / or immune cells.
10. The use of recombinant herpes simplex virus according to any one of claims 1-3 in immune assessment.
11. A telomerase activity assay kit comprising the recombinant herpes simplex virus according to any one of claims 1-3. The telomerase activity is derived from stem cells, tumor cells, and / or immune cells.