Guanosine oxidation piRNA-014733, antisense nucleotide and application of guanosine oxidation piRNA-014733
By inhibiting the expression of o8G piRNA-014733 in myocardial tissue and utilizing guanosine to oxidize piRNA-014733 and its antisense nucleotides, the problem of insufficient research on signaling pathways in myocardial infarction and myocardial ischemia-reperfusion injury was solved, achieving effective inhibition of myocardial cell ferroptosis and therapeutic effects on heart disease.
Patent Information
- Application Number
- CN202511700102.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-02-24
AI Technical Summary
The pathogenesis of cardiovascular diseases is not fully understood, and the prevention, diagnosis, and treatment of cardiovascular diseases have not yet achieved satisfactory results. In particular, research on the signaling pathways of myocardial damage caused by myocardial infarction and myocardial ischemia-reperfusion is not in-depth enough, and ferroptosis, as a novel form of cell death, has not been fully studied.
We provide guanosine-oxidized piRNA-014733 and its antisense nucleotides, which inhibit cardiomyocyte ferroptosis and improve myocardial ischemia-reperfusion injury by suppressing the expression level of o8G piRNA-014733 in myocardial tissue.
Significantly downregulating the expression of o8G piRNA-014733 inhibits cardiomyocyte ferroptosis, improves cell survival, and reduces oxidative stress and malondialdehyde levels, demonstrating broad potential for the prevention and treatment of heart diseases.
Smart Images

Figure CN121555503A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a guanosine-oxidized piRNA-014733, an antisense nucleotide, and their applications. Background Technology
[0002] Cardiovascular diseases have become the leading cause of death among Chinese residents. According to statistics from the "China Cardiovascular Health and Disease Report 2024 Summary," the number of cardiovascular disease patients in my country has reached 330 million, with a mortality rate far exceeding that of cancer and respiratory diseases. Currently, the pathogenesis of cardiovascular diseases is not fully understood, and the prevention, diagnosis, and treatment of cardiovascular diseases have not yet achieved satisfactory results. Continued development of new technologies and methods for the diagnosis and prevention of cardiovascular diseases is crucial.
[0003] piRNAs are a class of non-coding small RNAs, typically 24-35 nt in length. They bind to PIWI proteins and maintain genome stability by silencing transposons. They are widely studied in germline and stem cell lines. Guanosine oxidation is a reaction that occurs in tissues or cells after oxidative stress. This oxidative modification exists in DNA or RNA, where o... 8 G is a common product of guanine oxidation, specifically involving the oxidation of the 8th carbon atom in the guanine base. This alteration leads to guanine recognizing thymine, resulting in translational errors and changes in signal regulation. Further research has revealed that o 8 G piRNA-014733 plays an important role in cardiovascular diseases.
[0004] Myocardial injury induced by myocardial infarction and ischemia-reperfusion is one of the main causes of cardiovascular disease. Ischemia-reperfusion is a relatively common pathological state of myocardial injury, characterized by an initial restriction of blood supply to the organ or tissue, followed by increased oxidative damage due to the restoration of blood flow, which further leads to abnormal cardiac function and, in severe cases, heart failure or even death. In animal models, this is called the IR model. Myocardial infarction is a chronic, long-term pathological injury of the myocardium, known as MI in animal models, primarily induced by ligation of the left anterior descending lobe. Cardiomyocyte death caused by myocardial hypoxia includes apoptosis, autophagy, pyroptosis, and ferroptosis. Ferroptosis is a novel iron-dependent programmed cell death mechanism induced by excessive lipid peroxide accumulation, and its morphological characteristics, mode of action, and molecular mechanism are distinctly different from other programmed cell death mechanisms. Currently, ferroptosis has become a new hot topic in the field of cell death research.
[0005] Cell death plays a crucial role in normal embryonic development, maintaining normal physiological functions of cell populations, preventing malignant lesions, and ensuring the healthy survival and repair processes of multicellular organisms. However, current research on the signaling pathways of cardiomyocyte ferroptosis is far from in-depth. Summary of the Invention
[0006] The first objective of this invention is to provide a guanosine-oxidized piRNA, named o 8 G piRNA-014733, which is associated with the regulation of myocardial ischemia-reperfusion injury and cardiomyocyte ferroptosis, the o 8 The nucleic acid sequence of the G piRNA-014733 gene is shown in SEQ ID NO. 1: UAo8GCUGCAUUCAAUAAGo8G CAGAAUUUUo8GUC A second objective of this invention is to provide a medicament for preparing an intervention and / or treatment for heart disease, said medicament being o 8 G piRNA-014733 antisense nucleotide, the o 8 The antisense nucleotide sequence of G piRNA-014733 is shown in SEQ ID NO.2: GAAAAAAUUCUGACUUAUUGAAUGCAGAUA A third object of the present invention is to provide the o 8 G piRNA-014733 or the o 8 Application of G piRNA-014733 antisense nucleotide in heart disease-related products.
[0007] A fourth objective of the present invention is to provide a medicament for the prevention and / or treatment of heart disease, the medicament containing the o 8 G piRNA-014733 antisense nucleotide.
[0008] The present invention also includes o 8 Application of G piRNA-014733 as a biomarker for myocardial ischemia-reperfusion injury.
[0009] In this invention, by inhibiting o in cardiac tissue 8 The expression level of G piRNA-014733 was reduced to inhibit ferroptosis, thereby effectively improving myocardial ischemia-reperfusion injury.
[0010] Compared with the prior art, the present invention has the following beneficial effects: The o provided by this invention 8G piRNA-014733 is significantly upregulated in cardiac tissues and cardiomyocytes undergoing ischemia-reperfusion injury and iron-depleted processes. The o provided by this invention... 8 G piRNA-014733 antisense nucleotide can downregulate o 8 The expression level of GpiRNA-014733 and its inhibition of cardiomyocyte ferroptosis, the drug provided by this invention for the prevention and / or treatment of heart disease contains o 8 G piRNA-014733 antisense nucleotide, this drug works by inhibiting o 8 The expression of G piRNA-014733 can effectively prevent and / or treat myocardial injury. At the same time, this drug has significant therapeutic effects, a wide range of applications, and is environmentally friendly. Attached Figure Description
[0011] Figure 1 o 8 Expression levels of G piRNA-014733 in a hypoxia / reoxygenation (H / R) model of primary cardiomyocytes in neonatal rats and an ischemia-reperfusion injury model in adult mice; Figure 2 Transfection of primary cardiomyocytes 8 Inhibitors of G piRNA-014733 (o 8 Following the inhibition of G piRNA-014733 inhibitor, o in primary cardiomyocytes 8 Expression level of G piRNA-014733; Figure 3 Primary cardiomyocytes were treated with H / R and transfected with o 8 Cardiomyocyte survival rate after G piRNA-014733 inhibitor; Figure 4 Primary cardiomyocytes were treated with H / R and transfected with o 8 The level of reactive oxygen species (ROS) in cardiomyocytes after G piRNA-014733 inhibitor administration; Figure 5 Primary cardiomyocytes were treated with H / R and transfected with o 8 The level of malondialdehyde (MDA) in cells after G piRNA-014733 inhibitor administration; Figure 6 Primary cardiomyocytes were treated with H / R and transfected with o 8 The level of ferrous ions in cells after G piRNA-014733 inhibitor. Detailed Implementation
[0012] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0013] Experimental Example 1: o 8 Expression levels of G piRNA-014733 in primary myocardial cell hypoxia-reoxygenation model in neonatal rats and ischemia-reperfusion injury model in adult mice.
[0014] (1) Culture of primary mouse cardiomyocytes Cardiac cells were isolated from 1-2 day old newborn mice (C57BL / 6). The newborn mice were washed with 75% alcohol. Under sterile conditions, the heart was removed with surgical scissors and placed in a culture dish containing pre-chilled PBS. The heart was washed three times with PBS. The heart tissue was minced with surgical scissors and transferred to 10 mL of digestion solution (1.2 mg / mL trypsin and 0.14 mg / mL collagenase II). The mixture was gently shaken in a 37°C water bath for 6 min. After each digestion, the supernatant was transferred to a centrifuge tube containing serum. The centrifuge tube was stored on ice. Fresh digestion solution was added again until the heart tissue disappeared. Centrifuge at 1000 rpm for 10 min, collect the supernatant, resuspend in F12 / DMEM containing 10% serum, centrifuge again at 1000 rpm for 10 min, collect the supernatant, filter through a 70-mesh cell filter, place the filtered cardiomyocytes in a 10 cm culture dish, and incubate at 37°C in a 5% CO2 humidified incubator for 1.5 h. Fibroblasts adhere to the culture medium. Collect the culture medium containing cardiomyocytes into a new centrifuge tube, centrifuge at 1000 rpm for 10 min, discard the supernatant, resuspend in fresh serum-containing medium, and add 0.1 mM 5-bromodeoxyuridine (BrdU). Plate according to the experimental design and incubate at 37°C in a 5% CO2 humidified incubator. On the second day, change the culture medium in the culture dish and continue incubation for one more day.
[0015] (2) H / R model of cardiomyocytes According to the experimental groups, cells requiring hypoxia were placed in a hypoxic incubator for 18 hours, then replaced with normal culture medium and placed in normal culture medium for reoxygenation for 6 hours, followed by subsequent experiments.
[0016] (3) Mouse model of myocardial ischemia-reperfusion Male C57BL / 6J mice aged 6-8 weeks were purchased from Jinan Pengyue Experimental Animal Breeding Center, Shandong Province. All animal experiments were conducted under the guidance of the Ethics Committee of the Experimental Animal Center of Qingdao University. Animals had free access to food during the experiments. After anesthesia, mice were placed on a ventilator. All ventilator parameters were set according to the mice's physiological conditions. An electric blanket was placed on the back to maintain the mice's body temperature. The mice's chest was shaved, and a slit was carefully made between the third and fourth ribs using micro-forceps. After locating the heart, the pericardium was slowly peeled off. The heart was gently moved to the side, and the blood vessel was ligated at the left anterior descending coronary artery using 6-0 sutures. After 45 minutes, the sutures were loosened to allow blood reperfusion. Subsequently, the third and fourth ribs, skin, and muscles were sutured with 4-0 sutures, and the mice were kept on the ventilator for at least 30 minutes. The limbs were gently squeezed until the mice responded, at which point the ventilator was removed.
[0017] (4) Real-time quantitative PCR (RT-qPCR) Total RNA was extracted from mouse cardiomyocytes or tissues using the TRIZOL method, and its concentration and purity were determined using nanodrop One. The total RNA was converted to cDNA using the AG Evo M-MLV RT Kit reverse transcription assay. Quantitative real-time PCR was performed using the SYBR Green Kit. RT-qPCR was performed using the CFX96 real-time quantitative PCR detection system. Reaction conditions: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 40 cycles. Experimental results are presented using 2... -△△Ct Qualitative analysis of relative expression levels was performed using this method. The qPCR primer sequences are:
[0018] Note: piRNA-014733-F and piRNA-014733-R are used for o 8 Expression levels of the G piRNA-014733 gene; U6-F and U6-R were used to measure the expression levels of the U6 gene.
[0019] result: like Figure 1 As shown, compared with the control group, o 8 The expression level of G piRNA-014733 gene was significantly upregulated in the H / R model of primary cardiomyocytes in suckling mice (p<0.001), and was also significantly upregulated in the mouse model of myocardial ischemia-reperfusion injury (p<0.001).
[0020] Experimental Example 2: Transfection of o into primary cardiomyocytes 8 After G piRNA-014733 inhibitor, o 8Expression level of G piRNA-014733.
[0021] Lipofectamine® 3000-mediated cell transfection After isolating primary cardiomyocytes from neonatal rats and treating them with F12 / DMEM medium for 24 h, take one 1.5 mL EP tube, add 400 μL of DMEM high-glucose medium to the 1.5 mL EP tube, and add 5 μL of o 8 Add 2.5 μL of Lipofectamine® 3000 to G piRNA-014733 inhibitor, gently pipette to mix, and incubate at room temperature for 20 min. Then add the prepared transfection reagent to the culture dish to be transfected.
[0022] result: like Figure 2 As shown, o was detected by RT-qPCR. 8 The expression level of G piRNA-014733 was detected to determine its silencing efficiency. Compared with the control group, the silencing efficiency of o in cells was significantly reduced. 8 The expression level of G piRNA-014733 gene was significantly downregulated (p<0.001).
[0023] Experimental Example 3: Primary cardiomyocytes were treated with H / R and transfected with o 8 Cell survival rate after G piRNA-014733 inhibitor.
[0024] Cell viability detection Cell viability was assessed using a commercially available CCK-8 assay kit purchased from Shanghai Taoshu Biotechnology. Primary cardiomyocytes were isolated from each suckling mouse, enough to seed 10 wells of a 96-well plate. After transfection and H / R treatment to the required time, the culture medium in the 96-well plates was discarded, and each well was refilled with a mixture of 90 μL LF12 / DMEM and 10 μL CCK-8. The plates were then placed back into the cell culture incubator and cultured for 2–4 h. The absorbance at 450 nm was then measured using a microplate reader. Cell viability was calculated as: (Experimental wells / Control wells) * 100%.
[0025] result: like Figure 3 As shown, using the CCK-8 cell viability assay kit, after H / R, cell viability was significantly lower than the control group (p<0.001), but after transfection with o 8 After G piRNA-014733 inhibitor treatment, cell viability was significantly improved compared to H / R treatment (p<0.001). The results demonstrate that silencing G piRNA-014733 significantly improves cell viability. 8G piRNA-014733 can rescue the decreased survival rate of primary cardiomyocytes caused by H / R.
[0026] Experimental Example 4: Primary cardiomyocytes were treated with H / R and transfected with o 8 The expression level of ROS in cells after G piRNA-014733 inhibitor gene is activated.
[0027] Lipid ROS detection Lipid ROS in cells and tissues were detected using the DCFH-DA probe, purchased from Solarbio Science & Technology Co., Ltd. DCFH-DA was diluted to a final concentration of 10 μM with PBS, and 50 μL of staining solution was added to each well. Staining was performed at 37 °C for 30 min. After washing with 1 mL of PBS in each well of a 24-well plate (repeated three times), fixation with 4% paraformaldehyde, DAPI staining, PBS washing, and mounting were performed. Relevant fluorescence signal images under 488 nm and 565 nm excitation were acquired using laser confocal fluorescence microscopy.
[0028] Result: As Figure 4 As shown, cells undergo oxidative stress after H / R treatment, leading to increased intracellular ROS levels. ROS detection revealed that, compared to the control group, primary rat cardiomyocytes treated with H / R showed significantly increased ROS levels (p<0.001), while those transfected with o 8 After G piRNA-014733 inhibitor treatment, the ROS level in cells was significantly reduced compared to H / R treatment (p<0.001).
[0029] Experimental Example 5: Primary cardiomyocytes were treated with H / R and transfected with o 8 The level of MDA in cells after G piRNA-014733 inhibitor.
[0030] MDA content detection The MDA assay kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd. Following the kit instructions, a TBA stock solution with a final concentration of 0.37% was prepared using TBA preparation solution. MDA working solution was prepared according to the number of samples to be tested, with a volume ratio of TBA diluent:TBA stock solution:antioxidant of 150:50:3. The solution was then vortexed vigorously at 70 °C to dissolve the MDA working solution. MDA standards were serially diluted according to the instructions to 0, 1, 2, 5, 10, and 20 μM to plot a standard curve. Cardiomyocytes were digested with lysis buffer to determine the total protein content. 100 μL of the test sample and 200 μL of MDA working solution were mixed in a 1.5 mL EP tube and boiled for 15 min. During boiling, a metal block was used to weigh down the centrifuge tube opening to prevent boiling over and sample loss. The EP tube was then placed on a float in water to allow for slow cooling. The tube was centrifuged at 1000 g for 10 min. Transfer 200 μL of supernatant to a 96-well plate and measure the absorbance at 562 nm using a microplate reader. Plot a standard curve based on the OD value and MDA concentration: y(OD value) = kx(concentration) + b. Substitute the measured OD value of the sample into the formula of the standard curve to calculate the MDA concentration. The final MDA content is expressed as the MDA concentration per unit mass of sample.
[0031] Result: As Figure 5 As shown, compared with the control group, the MDA level in primary cardiomyocytes of neonatal rats was significantly increased after H / R treatment (p<0.001), and the level was higher after transfection with o 8 After G piRNA-014733 inhibitor treatment, the MDA level in cells was significantly reduced compared to H / R treatment (p<0.001).
[0032] Experimental Example 6: Primary cardiomyocytes were treated with H / R and transfected with o 8 The level of ferrous ions in cells after G piRNA-014733 inhibitor.
[0033] Ferrous Ion Score Analysis Kit For the detection of ferrous ion content, we used a commercially available kit purchased from Wuhan Elite Biotechnology Co., Ltd. According to the kit instructions, iron standards were serially diluted as required by the instructions to 0, 5, 10, 15, 20, 30, 40, and 50 μmol / L to plot a standard curve. Primary cardiomyocytes were digested with reagent five, and 300 μL of the sample was added to the corresponding 1.5 mL EP tube. Then, 150 μL of reagent two was added to the EP tube. The mixture was thoroughly mixed and incubated at 37°C for 10 min. Each tube was centrifuged at 12000 × g for 10 min. 300 μL of the supernatant was added to a 96 μL empty plate, and the OD value of each well was measured at 593 nm using a microplate reader.
[0034] Result: As Figure 6 As shown, the intracellular ferrous ion level changed after hypoxia / reoxygenation treatment. Detection using a ferrous ion ratio assay kit revealed that, compared to the control group, the ferrous ion level in primary neonatal rat cardiomyocytes was significantly increased after H / R treatment (p<0.001), while that transfected with o... 8 After G piRNA-014733 inhibitor treatment, the level of ferrous ions in cells was significantly reduced compared with H / R treatment (p<0.001).
[0035] In conclusion: o 8 G piRNA-014733 plays an important role in the regulation of cardiomyocyte ferroptosis and shows significant potential in modulating myocardial ischemia-reperfusion. This finding indicates that o 8 G piRNA-014733 has multiple applications: firstly, it can serve as a biomarker for clinical detection and diagnosis of myocardial ischemia-reperfusion injury; secondly, it can be used as an active ingredient in therapeutic drugs; and thirdly, it can enable precise targeted drug delivery. These properties provide new insights into the treatment of cardiovascular diseases, namely, by inhibiting the activity of G piRNA in cardiac tissue. 8 Increasing the expression level of G piRNA-014733 to inhibit ferroptosis and thus effectively improve myocardial ischemia-reperfusion injury, this strategy is expected to become an important breakthrough in the treatment of cardiovascular diseases.
[0036] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A guanosine-oxidized piRNA, characterized in that: The guanosine-oxidized piRNA was named o 8 G piRNA-014733, which is associated with the regulation of myocardial ischemia-reperfusion injury and cardiomyocyte ferroptosis, the o 8 The nucleic acid sequence of the G piRNA-014733 gene is shown in SEQ ID NO. 1: UAo8GCUGCAUUCCAAUAAGo8G CAGAAUUUUo8GUC。 2. The o as described in claim 1 8 Application of G piRNA-014733 in the preparation of heart disease-related products.
3. The o as described in claim 1 8 Application of G piRNA-014733 as a biomarker for myocardial ischemia-reperfusion injury.
4. The o as described in claim 1 8 The antisense nucleotide of G piRNA-014733, the o 8 The antisense nucleotide sequence of G piRNA-014733 is shown in SEQ ID NO. 2: GAAAAAAUUCUGACUUAUUGAAUGCAGAUA.
5. The o as described in claim 4 8 Application of G piRNA-014733 antisense nucleotide in the preparation of heart disease-related products.
6. A medicament for the prevention and / or treatment of heart disease, said medicament comprising the o according to claim 3. 8 G piRNA-014733 antisense nucleotide.