SNP site primer combination for identifying authenticity of texture tomato varieties and hybrid purity and application thereof
By developing a primer combination covering the entire tomato genome using KASP marker SNP sites, the problem of identifying the authenticity of tomato varieties and the purity of hybrids has been solved, enabling efficient and accurate variety identification and purity testing, and protecting the legitimate rights and interests of producers.
Patent Information
- Application Number
- CN202511426649.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-26
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2045-01-26
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately identifying the authenticity of tomato varieties and the purity of hybrids, especially for flavor tomatoes, which suffer from "numerous, chaotic, and mixed" varieties and counterfeit products, hindering the development of the industry.
We developed a primer set of KASP marker SNP sites covering the entire tomato genome, and screened out high-quality SNP sites through PCR amplification and fluorescence signal detection to identify the authenticity of flavor tomato varieties and the purity of hybrids.
It enables high-throughput, accurate, and low-cost identification of tomato varieties and hybrids, protecting the rights and interests of producers and breeders, and supporting variety management and seed quality assurance.
Smart Images

Figure CN121555670B_ABST
Abstract
Description
Technical Field
[0001] This application is a divisional application of the patent application filed on January 26, 2025, with application number 202510124715.6, entitled "SNP site primer combinations for identifying the authenticity of tomato varieties and the purity of hybrids and their applications".
[0002] This invention belongs to the field of molecular markers and their detection, specifically relating to SNP site primer combinations and their applications for identifying the authenticity of flavor tomato varieties and the purity of hybrids. Background Technology
[0003] Tomatoes are an important vegetable crop, with a global annual production of 170 million tons, ranking first among vegetable crops. In recent years, the tomato seed industry has developed rapidly, with significant improvements in breeding levels and a steady increase in the proportion of domestically bred varieties in production. However, with the increasing demand for varieties and seeds, the seed market is plagued by problems such as "numerous, chaotic, and mixed" products, "different names for the same species," and "counterfeit and cloned products," seriously affecting the healthy development of the tomato industry. Meanwhile, as one of the important indicators for measuring seed quality, the purity of hybrid varieties is receiving increasing attention from seed producers and growers. Therefore, establishing a set of efficient, accurate, easy-to-operate, and environmentally unaffected technologies for identifying tomato varieties and seeds can provide technical support for standardizing variety management and protecting the legitimate rights and interests of producers.
[0004] Compared with traditional field morphological identification, molecular marker identification technology has advantages such as short cycle time, insensitivity to environmental conditions, and high-throughput testing, and is widely used in variety authenticity identification and hybrid seed purity identification. In recent years, with the completion of tomato genome sequencing and the accumulation of resequencing data, a large number of variant sites have been discovered, providing convenient conditions for the development of molecular markers. SNP (single nucleotide polymorphism) markers, due to their abundant quantity, wide distribution, and high stability, are more advantageous than traditional markers such as RFLP, SSR, and InDel. Kompetitive Allele Specific PCR (KASP) is a fluorescence-based genotyping technique with advantages such as high marker transformation success rate, accurate genotyping, low cost, and flexible detection throughput. The SNP markers used for genotyping using this technology are also known as KASP markers. Currently, genome-wide KASP markers are widely used in research on vegetable crops such as cabbage, broccoli, watermelon, pepper, melon, and legumes. However, in tomato research, most of the reported KASP markers are foreground markers linked to traits, while there are fewer reports on genome-wide background markers.
[0005] Based on tomato resequencing data, this study screened high-quality SNP loci using bioinformatics methods, developed KASP markers covering the entire tomato genome, and verified their applicability using tomato varieties from different sources and types, aiming to provide scientific reference for tomato genetic diversity analysis, variety identification, and hybrid purity identification. Summary of the Invention
[0006] Modern cultivated tomatoes can be divided into processing tomatoes and fresh-eating tomatoes according to their uses. Processing tomatoes are mainly used for processing various condiments and extracting functional substances. Fresh-eating tomatoes can be further subdivided into regular tomatoes, flavorful tomatoes, and cherry tomatoes. Regular tomatoes are mainly used for stir-frying or salads; flavorful tomatoes have medium-sized fruits, rich flavor, and a sweet and sour taste, and can be eaten directly as fruit; cherry tomatoes are small tomatoes with bright colors and diverse shapes, and are a distinct group of varieties clearly different from large-fruited fresh-eating tomatoes. Molecular biological studies have shown that cherry tomatoes are clearly different from large-fruited tomatoes on chromosomes 4, 5, and 12. Therefore, identifying different types of tomatoes can improve the accuracy and effectiveness of identification.
[0007] To address the aforementioned issues, this invention provides a combination of SNP primers for identifying the authenticity and hybridization purity of tomato varieties and their applications.
[0008] This invention is achieved through the following technical solution:
[0009] In a first aspect, the present invention provides a primer combination for identifying the authenticity of a tomato variety and the purity of a hybrid, including the SNP sites and primers shown in the table below.
[0010]
[0011] Secondly, the present invention provides a method for detecting whether two unknown tomato varieties with different tastes belong to the same variety, comprising the following steps:
[0012] S1. Extract genomic DNA from the tomato sample to be tested for flavor;
[0013] S2. PCR amplification of the tomato to be tested using the primers described in the first aspect;
[0014] S3. Result Analysis: If the number of different loci between two tested tomato varieties is 1 or 0, then the two tested tomato varieties are suspected to be the same tomato variety; if the number of different loci between two tested tomato varieties is 2 or more, then the two tested tomato varieties belong to different tomato varieties.
[0015] Thirdly, the present invention provides a method for identifying the purity of a flavorful tomato hybrid, comprising the following steps:
[0016] DNA extraction steps: Extract genomic DNA from N hybrids of a tomato variety to be tested; N is a natural number greater than 12, preferably a natural number greater than or equal to 94;
[0017] Screening of target primer sets: For hybrid purity identification of known varieties, the DNA of the parental materials of the hybrid was first used as a template, with three replicates for each parental material. PCR amplification and genotyping were performed using the primers described in the first aspect. Primers with stable genotyping results among the parents were screened for hybrid purity identification. For hybrid purity identification of unknown varieties, the DNA of 12 F1 hybrid individual plants was used as a template. PCR amplification and genotyping were performed using the primers described in the first aspect. Primers with heterozygous and stable genotyping results were screened for hybrid purity identification.
[0018] PCR amplification with target primer set: Using the genomic DNA of the N tomato hybrids to be tested as templates, competitive allele-specific PCR amplification reactions were performed with the target primer set to obtain the PCR reaction products of the target primer set;
[0019] Purity identification: The PCR reaction products of the target primer set were detected, and the purity of the tomato hybrid to be tested was calculated based on the detection results.
[0020] Preferably, in the screening and purity detection steps of the target primer set, the detection method is selected from: fluorescence signal detection and direct sequencing.
[0021] Preferably, in the target primer set screening step, for the purity identification of hybrids of known varieties, when using fluorescence signal detection, the primer set that shows stable and consistent homozygous polymorphism in the parental samples as described in the first aspect is the target primer set; when using direct sequencing, the primer set that shows stable and consistent homozygous polymorphism in the parental samples at the SNP loci as described in the first aspect is the target primer set.
[0022] For the purity identification of hybrids of unknown varieties, when using fluorescence signal detection, the number of plants displaying fluorescent signals indicating the color of heterozygotes as shown in the primer set described in the first aspect is counted; the primer set with the largest number of fluorescent plants displaying the color of heterozygotes is the target primer set; when using direct sequencing, the number of plants with heterozygous genotypes at the SNP sites described in the first aspect is counted; the primer set with the largest number of heterozygous plants is the target primer set.
[0023] Preferably, in the purity detection step, the method for calculating the purity of the tomato hybrid to be tested is as follows:
[0024] When using fluorescence signal detection, the number of plants displaying fluorescence indicating heterozygotes and the number of plants without fluorescence for each target primer set are counted. The purity is calculated separately, and then the average value is calculated. This average value is the purity of the tomato hybrid to be tested. The number of plants without fluorescence = N - the number of plants displaying fluorescence indicating heterozygotes - the number of plants displaying fluorescence indicating the first type of homozygote - the number of plants displaying fluorescence indicating the second type of homozygote; Purity = [the number of plants displaying fluorescence indicating heterozygotes with the target primer set / (N - the number of plants without fluorescence with the target primer set)] × 100%;
[0025] When using direct sequencing: count the number of heterozygous plants based on the SNP locus of each target primer set and the number of plants that did not obtain PCR amplification products, calculate the purity of each, and then calculate the average value. This average value is the purity of the tomato hybrid to be tested; Purity = [Number of heterozygous plants based on the SNP locus of the target primer set / (N - Number of plants that did not obtain PCR amplification products of the target primer set)] × 100%.
[0026] Preferably, the flavorful tomato hybrids are 56FE, Pinfan 2045, Pinfan 4027, Pinfan 4031, Pinfan 20311, Anlida, Xiuqing, Fuxing, Youkang SS28, Jiawen No. 1, Shengfan No. 2, Qingdaiyulang No. 3, Fanyu 2099, Xiantao No. 5, Tiancuicui-2, Zhewei No. 3, Wanmei, Strawberry No. 5, Yuanwei 128, Cuiyu No. 2, Chudai No. 6, Fengtian 126, Strawberry No. 15, Tianmei, Jingfan 309, XX45, Taomengxi, Diana, Xianmei No. 5, Provence, Strawberry No. 2, Beiweimei, and Zhewei No. 2. The following are listed: Ironberry No. 6, Zhenyoumei, Fengyun, Hongxiu, Huiwei 99, Fengtian A8, 23G666, Fantaro No. 8, Yashu No. 11, Yuxi, Zhongza 315, Lianji, Hefan No. 1, JPCQ6, Ichiban Zha, Tianzhu Latte, Gala Fruit, Beishi No. 3, S22022, JSH46, Fini, Guanghui 101, Youyou Fruit, Boyan 68, Boyan 366, Jingfan H2205, Jingfan H2302, Jingfan H2305, Jingfan 308, Strawberry Tomato, Huangyu, Xiangbalang, Weimeijia, Medivh, Shatian No. 2, and Tianmimi.
[0027] Fourthly, the present invention provides any of the following applications:
[0028] (1) The application of the SNP primer combination described in the first aspect in the preparation of products for identifying or assisting in the identification of the authenticity of flavorful tomato varieties; (2) The application of the SNP primer combination described in the first aspect in the preparation of products for identifying or assisting in the identification of the purity of flavorful tomato varieties; (3) The application of the SNP primer combination described in the first aspect in the identification or assisting in the identification of the authenticity of flavorful tomato varieties; (4) The application of the SNP primer combination described in the first aspect in the identification or assisting in the identification of the purity of flavorful tomato varieties; (5) The application of the SNP primer combination described in the first aspect in tomato breeding; (6) The application of the method described in the second or third aspect in the identification or assisting in the identification of the authenticity of flavorful tomato varieties; (7) The application of the method described in the second or third aspect in the identification or assisting in the identification of the purity of flavorful tomato varieties; (8) The application of the method described in the second or third aspect in tomato breeding.
[0029] The beneficial effects of the technical solution of this invention are mainly reflected in:
[0030] (1) The SNP primer combination provided in the first aspect of this invention can be used for early identification of flavorful tomato varieties at the seed or seedling stage, ensuring the authenticity of flavorful varieties and the purity of hybrids. It can also identify whether two or more unknown flavorful tomato varieties belong to the same variety, and the hybrid purity of the flavorful tomato variety to be tested. This method can identify both unknown and known flavorful tomato varieties. It effectively protects the rights and interests of producers and breeders, and provides technical support for the protection of flavorful tomato germplasm resources and new varieties.
[0031] (2) The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, saving manpower and material resources, and has a very broad application prospect. Attached Figure Description
[0032] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0033] Figure 1 This describes the SNP genotyping effect of 32 primer sets in Example 1 of the present invention in some tested tomato varieties with different tastes;
[0034] Figure 2 This is a cluster diagram of 70 tested tomato varieties with different tastes, established using 32 primer sets in Example 1 of this invention.
[0035] Figure 3In Example 1 of this invention, primer 7-2 was used to identify the seed purity of 94 tomato varieties "Pinfan 4031". Points closer to the Y-axis (paternal parent) and points closer to the X-axis (maternal parent) represent two different homozygous genotypes. Points on the diagonal of the coordinate axes represent heterozygous genotypes, i.e., F1 hybrids. Detailed Implementation
[0036] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0037] Where specific experimental steps or conditions are not specified in the embodiments, they can be performed according to the conventional experimental steps or conditions described in the literature in this field. All raw materials or instruments used are commercially available products, including but not limited to those used in the embodiments of this application.
[0038] Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods described in the following detailed embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the manufacturer's recommendations.
[0039] Example 1: Obtaining SNP primer combinations for identifying the authenticity of tomato varieties and the purity of hybrids
[0040] 1. Obtaining and screening SNP loci
[0041] This invention is based on resequencing data from 120 tomato samples, covering fresh tomatoes, flavor tomatoes, and cherry tomatoes. It basically includes the main ecological types and agronomic traits of tomatoes currently available on the market, reflecting germplasm representativeness as much as possible and exhibiting high genetic diversity.
[0042] Specifically, the screening criteria for SNP sites are as follows: (1) Minimum allele frequency (MAF) > 0.1; (2) Polymorphism information content (PIC) > 0.3; (3) Evenly distributed in the chromosome; (4) No other variations within 100 bp before and after the site.
[0043] 2. Obtaining the optimal SNP primer combination
[0044] For each chromosome, 10-12 high-quality SNP sites were selected and designed preferentially, resulting in a total of 140 SNP primer combinations designed for the whole genome. Each primer set consists of 3 primer sequences and is used to amplify one SNP site.
[0045] 3. Obtaining genomic DNA from the tested tomato varieties
[0046] Genomic DNA was extracted from leaves (true leaves from 5 seeds) of 70 tested tomato varieties using the CTAB method to obtain the genomic DNA of the tested tomato varieties. Basic information on the 70 tested tomato varieties in this example is shown in Table 1. All 70 tested tomato varieties are common superior varieties or some introduced varieties.
[0047] Table 1 Information on the tested tomato varieties
[0048]
[0049] 4. Validation and screening of SNP primer combinations
[0050] Using genomic DNA from 70 tested tomato varieties as templates, PCR amplification was performed using 140 SNP primer pairs, and the genotyping results were statistically analyzed. Based on principles such as a marker PIC value > 0.40, relatively uniform marker distribution on each chromosome, and no linkage, core SNP primer sets suitable for identifying the authenticity of flavor-enhancing tomato varieties and the purity of hybrids were selected. A total of 32 SNP primer sets were finally obtained, and their information is shown in Table 2. In the primer name, the first number indicates the chromosome number, and the second number indicates the primer number on that chromosome. The 5' end of the forward primer F1 required the addition of the FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT, and the 5' end of the forward primer F2 required the addition of the HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT. The location of the SNP sites on the chromosome was determined based on the tomato reference genome SL4.0 sequence alignment (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome).
[0051] Table 2. Information on 32 SNP primer sets used to identify flavor-enhancing tomato varieties and hybrid purity.
[0052]
[0053] 5. Cluster analysis
[0054] like Figure 1 As shown, the fluorescence signals of the PCR amplification products of the 32 SNP loci in 70 tested flavorful tomato hybrids clearly presented in three forms: 1) Samples aggregated near the X-axis showed orange, indicating the genotype of the allele linked to the FAM fluorescent tag sequence; 2) Samples aggregated near the Y-axis showed blue, indicating the genotype of the allele linked to the HEX fluorescent tag sequence; 3) Samples located on the diagonal of the X and Y axes showed green, indicating the genotype of the heterozygous combination of the two alleles. Therefore, the 32 SNP primer sets can achieve good genotyping results in the tested flavorful tomato hybrids.
[0055] Based on the genotyping results of 70 tested tomato varieties using 32 SNP loci, cluster analysis was performed on the 70 tested tomato varieties using NTSYS-pc2.11 software. The cluster diagram of the 70 tested tomato varieties based on the 32 SNP primer sets is shown below. Figure 2 As shown in the figure. The results indicate that the 32 SNP primer sets can completely distinguish the 70 tested flavor tomato varieties in Table 1. Therefore, the 32 SNP primer sets developed in Example 1 can be applied to the construction of a DNA fingerprint database for flavor tomato varieties and the identification of variety authenticity.
[0056] Experimental Example 1
[0057] I. Application of the KASP marker primer set in Example 1 in detecting the authenticity of flavor tomato varieties (i.e., a method for detecting whether two unknown flavor tomato varieties belong to the same variety), the specific operation is as follows:
[0058] 1. Extract genomic DNA from the tomato samples to be tested.
[0059] Genomic DNA was extracted from the samples using the CTAB method. NanoDrop was used for DNA quality testing and concentration determination, and the DNA concentration was adjusted to 30-50 ng / μL for later use.
[0060] The 32 SNP primer sets obtained from Example 1 were used to amplify the test samples by PCR, with three replicates for each test sample.
[0061] 2. Preparation of PCR reaction system and setting of reaction program
[0062] The PCR amplification system is as follows: 10 μL reaction volume includes 1.5 μL template DNA, 5 μL KASP Master mix, 0.7 μL KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL universal primer R), and 2.8 μL ddH2O.
[0063] PCR amplification program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ The first round of PCR was performed with annealing at 57°C for 60 seconds, for a total of 10 Touch Down cycles (with a temperature decrease of 0.8°C per cycle); the second round of PCR consisted of denaturation at 94°C for 20 seconds, followed by annealing and extension at 57°C for 60 seconds, for a total of 32 cycles. Finally, the fluorescence signal was read.
[0064] It should be noted that if the fluorescence signal is weak after PCR amplification, affecting data analysis, additional cycles can be added (94℃ denaturation for 20s, 55℃ annealing and extension for 1min, 5 cycles) until the results are satisfactory.
[0065] 3. Results Analysis
[0066] If two tomato varieties tested have one or zero different loci, they are suspected to be the same tomato variety. If two tomato varieties tested have two or more different loci, they are different tomato varieties; the more different loci, the more distant the genetic relationship.
[0067] II. Application of the KASP-labeled primer set in Example 1 in detecting the purity of flavorful tomato varieties
[0068] This example scheme is a method for determining the purity of a flavorful tomato hybrid with known parents. The specific operation is as follows:
[0069] 1. Samples: 100-200 tomato seeds were selected from the seeds of the flavorful tomato variety "Pinfan 4031" submitted for testing and cultivated to obtain no less than 94 tomato plants. Together with the male and female parent plants of this variety (the male and female parent plants were used as control samples), a total of 96 samples were obtained.
[0070] 2. Genomic DNA was extracted from the above-mentioned common tomato samples using a rapid 96-well plate extraction method. The specific procedures are as follows:
[0071] (1) When the tomato has grown to two leaves and one heart, take one true leaf and place it in a 96 deep hole plate, and add one stainless steel bead.
[0072] (2) Add 500 μL of extraction solution (formulation: 12.1 g Tris, 28.1 g NaCl, 18.6 g EDTA, and bring the volume to 1 L) to each well using a multi-channel pipette. After covering with a silicone pad, grind the tissue in an automatic grinder for 2 min and then centrifuge at 4000 rpm for 15 min to separate the tissue from the extraction solution.
[0073] (3) Pipette 200 μL of supernatant into a new 96-well plate, add 2 times the volume of ice-cold ethanol to precipitate, place at -20 ℃ for 30 minutes, centrifuge at 4000 rpm for 15 minutes, discard the supernatant, add 500 μL of 75% ethanol to wash and discard the ethanol, air dry and add 100 μL of ddH2O to dissolve.
[0074] (4) The final DNA concentration is uniformly diluted 5 times for later use.
[0075] 3. PCR amplification
[0076] The PCR amplification system is as follows: 10 μL reaction volume includes 1.5 μL template DNA, 5 μL KASP Master mix, 0.7 μL KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL universal primer R), and 2.8 μL ddH2O.
[0077] PCR amplification program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ The first round of PCR was performed with annealing at 57°C for 60 seconds, for a total of 10 Touch Down cycles (with a temperature decrease of 0.8°C per cycle); the second round of PCR consisted of denaturation at 94°C for 20 seconds, followed by annealing and extension at 57°C for 60 seconds, for a total of 32 cycles. Finally, the fluorescence signal was read.
[0078] 4. Screening of identification markers
[0079] First, using DNA from the parental materials of the flavorful tomato variety "Pinfan 4031" as templates, three replicates were set for each parental material. Thirty-two SNP primer sets were used, arranged in Table 6, and divided into two batches (or two groups). The second batch of primers was randomly selected for PCR amplification and genotyping. Polymorphic markers with stable genotyping results among the parents were screened for hybrid purity identification. Among the primer sets in the second batch, primer 7-2 showed stable genotyping results and polymorphism, and could be used for subsequent experiments.
[0080] It should be noted that, in accordance with the actual experimental procedure, in order to save identification time and reagent costs, primers from other batches can be used as alternatives and the screening process can be stopped after stable polymorphic markers are screened out.
[0081] 5. Identification of purity of hybrid seeds
[0082] The primers 7-2 selected in "Step 4" were used to perform PCR amplification and genotyping on the F1 hybrid DNA, and the results were statistically analyzed. The points located on the diagonal of the coordinate axis represent heterozygous genotypes, which are true F1 hybrids.
[0083] The purity calculation method is as follows: Number of plants without fluorescence = N - Number of plants displaying fluorescence indicating heterozygotes - Number of plants displaying fluorescence indicating the first type of homozygotes - Number of plants displaying fluorescence indicating the second type of homozygotes;
[0084] Purity = [Number of strains displaying color fluorescence indicating heterozygotes using the target primer set / (N - Number of strains without fluorescence using the target primer set)] × 100%;
[0085] In this example, the number of strains without fluorescence was 0, the number of strains showing color fluorescence indicating heterozygotes with the target primer set was 94, N was 94, and the purity was measured to be 100%.
[0086] The typing test results are as follows: Figure 3 As shown, all F1 plants were heterozygous, indicating a seed purity of 100%. Further field testing revealed that all F1 plants exhibited traits distinct from their parents, with consistent and stable behavior, consistent with the molecular marker identification results. This demonstrates that the KASP marker purity identification method based on the selected primer set has high accuracy and can be used for efficient detection of the purity of flavor-enhancing tomato hybrids.
[0087] It should be noted that this invention is only applicable to the purity identification of hybrid F1 varieties with only parental mixing, and not applicable to the identification of mixing of several varieties due to mechanical mixing.
[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A primer combination for identifying the authenticity of tomato varieties and the purity of hybrids, characterized in that, Includes the primers shown in the table below, wherein the primers are a combination of SEQ ID NO.1-SEQ ID NO.96: The 5' end of the forward primer F1 needs to be supplemented with the FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT, and the 5' end of the forward primer F2 needs to be supplemented with the HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT.
2. A method for detecting whether two unknown tomato varieties with different tastes belong to the same variety, characterized in that, Includes the following steps: S1. Extract genomic DNA from the tomato sample to be tested for flavor; S2. PCR amplification of the tomato to be tested using the primers described in claim 1; S3. Results Analysis: If the number of different sites between two tested tomato varieties is 1 or 0, then the two tested tomato varieties are suspected to be the same tomato variety; if the number of different sites between two tested tomato varieties is 2 or more, then the two tested tomato varieties belong to different tomato varieties.
3. A method for identifying the purity of a hybrid tomato variety, characterized in that, Includes the following steps: DNA extraction steps: Extract genomic DNA from N hybrids of a tomato variety to be tested; N is a natural number greater than 12, preferably a natural number greater than or equal to 94; Screening of target primer sets: For hybrid purity identification of known varieties, the DNA of the parental materials of the hybrid was first used as a template, with three replicates for each parental material. PCR amplification and genotyping were performed using the primers described in claim 1. Polymorphic primers with stable genotyping results among the parents were screened for hybrid purity identification. For hybrid purity identification of unknown varieties, the DNA of 12 F1 hybrid individual plants was used as a template. PCR amplification and genotyping were performed using the primers described in claim 1. Primers with heterozygous and stable genotyping results were screened for hybrid purity identification. PCR amplification with target primer set: Using the genomic DNA of the N tomato hybrids to be tested as templates, competitive allele-specific PCR amplification reactions were performed with the target primer set to obtain the PCR reaction products of the target primer set; Purity identification: The PCR reaction products of the target primer set were detected, and the purity of the tomato hybrid to be tested was calculated based on the detection results.
4. The method as described in claim 3, characterized in that, The methods used in the screening and purity identification of the target primer set are selected from: fluorescence signal detection and direct sequencing.
5. The method as described in claim 4, characterized in that, In the screening step of the target primer set, for the purity identification of hybrids of known varieties, when using fluorescence signal detection, the primer set that shows stable and consistent homozygous polymorphism in the parental samples is the target primer set; when using direct sequencing, the primer set that shows stable and consistent homozygous polymorphism in the parental samples at the SNP loci as described in claim 1 is the target primer set. For the purity identification of hybrids of unknown varieties, when using fluorescence signal detection, count the number of plants with fluorescence signals indicating the color of heterozygotes as described in claim 1; the primer set with the largest number of fluorescent plants indicating the color of heterozygotes is the target primer set; when using direct sequencing, count the number of plants with heterozygous genotypes at the SNP sites described in claim 1; the primer set with the largest number of heterozygous plants is the target primer set.
6. The method as described in claim 4, characterized in that, In the purity identification step, the method for calculating the purity of the tomato hybrid to be tested is as follows: When using fluorescence signal detection, select 1 to 3 sets of target primers for purity calculation. Count the number of plants with color fluorescence indicating heterozygotes and the number of plants without fluorescence in the selected target primer sets, calculate the purity separately, and then calculate the average value. This average value is the purity of the tomato hybrid to be tested. Number of plants without fluorescence = N - Number of plants displaying fluorescence indicating heterozygotes - Number of plants displaying fluorescence indicating the first type of homozygotes - Number of plants displaying fluorescence indicating the second type of homozygotes; Purity = [Number of strains displaying color fluorescence indicating heterozygotes using the target primer set / (N - Number of strains without fluorescence using the target primer set)] × 100%; When using direct sequencing: Select 1-3 sets of target primers for purity calculation. Count the number of plants with heterozygous genotype and the number of plants that did not obtain PCR amplification products in the selected target primer sets. Calculate the purity of each, and then calculate the average value. This average value is the purity of the tomato hybrid to be tested. Purity = [Number of strains with heterozygous genotypes based on SNP sites in the target primer set / (N - Number of strains for which no PCR amplification product was obtained in the target primer set)] × 100%.
7. The method as described in claim 6, characterized in that, The aforementioned flavorful tomato hybrids are 56FE, Pinfan 2045, Pinfan 4027, Pinfan 4031, Pinfan 20311, Anlida, Xiuqing, Fuxing, Youkang SS28, Jiawen No. 1, Shengfan No. 2, Qingdaiyulang No. 3, Fanyu 2099, Xiantao No. 5, Tiancuicui-2, Zhewei No. 3, Wanmei, Strawberry No. 5, Yuanwei 128, Cuiyu No. 2, Chudai No. 6, Fengtian 126, Strawberry No. 15, Tianmei, Jingfan 309, XX45, Taomengxi, Diana, Xianmei No. 5, Provence, Strawberry No. 2, Beiweimei, Zhewei No. 2, and Tie. The following are listed: Strawberry No. 6, Zhenyoumei, Fengyun, Hongxiu, Huiwei 99, Fengtian A8, 23G666, Fantaro No. 8, Yashu No. 11, Yuxi, Zhongza 315, Lianji, Hefan No. 1, JPCQ6, Ichiban Zha, Tianzhu Latte, Gala Fruit, Beishi No. 3, S22022, JSH46, Fini, Guanghui 101, Youyou Fruit, Boyan 68, Boyan 366, Jingfan H2205, Jingfan H2302, Jingfan H2305, Jingfan 308, Strawberry Tomato, Huangyu, Xiangbalang, Weimeijia, Medivh, Shatian No. 2, and Tianmimi.
8. The application of the SNP site primer combination according to claim 1 in the preparation of products for identifying or assisting in the identification of the authenticity of tomato varieties and the purity of seeds.
9. The application of the SNP site primer combination according to claim 1 in identifying or assisting in the identification of the authenticity of flavor tomato varieties and seed purity.
10. The application of the method of claim 2 or any one of claims 3-7 in identifying or assisting in the identification of the authenticity of tomato varieties and the purity of seeds.
11. The application of the SNP site primer combination of claim 1, the method of claim 2, or the method of any one of claims 3-7 in tomato breeding.