Novel broad-spectrum antibacterial peptide and application thereof
By modifying and chimeric designing the Ceg10 sequence of Legionella pneumophila protein, a novel antimicrobial peptide TN3 was developed. This overcomes the shortcomings of existing antimicrobial peptides in terms of broad-spectrum antimicrobial activity and cytotoxicity, achieving highly efficient antibacterial activity and low toxicity against a variety of bacteria, and has promising clinical application prospects.
Patent Information
- Application Number
- CN202511887140.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-02-27
AI Technical Summary
Existing antimicrobial peptides are insufficient in terms of broad-spectrum antimicrobial activity, stability, and low cytotoxicity, making them difficult to effectively combat multi-species infections and drug-resistant strains.
A novel antimicrobial peptide, TN3, was designed by tandemly recombining the amino acid sequence QERRSKKRELHCK of Legionella pneumophila protein Ceg10 three times and chimerizing it with a cell-penetrating peptide YGRKKRRQRRR containing six arginine residues to form a chimeric peptide, thereby enhancing the binding force and penetration ability of the peptide to the bacterial cell membrane.
It achieved significant antibacterial effects against Staphylococcus aureus, Escherichia coli, Listeria, and Pseudomonas fluorescens, with low cytotoxicity and good biocompatibility, demonstrating potential for clinical application.
Smart Images

Figure CN121574265A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a novel broad-spectrum antimicrobial peptide and its applications. Background Technology
[0002] The discovery and application of antibiotics is a milestone in the history of human medicine. However, with the overuse and misuse of antibiotics, the emergence and spread of multidrug-resistant bacteria has become a major crisis in the global public health field. The overuse of traditional antibiotics has led to the rapid evolution and spread of drug-resistant strains, making infectious diseases increasingly difficult to cure. Currently, the severe challenges facing clinical practice lie in two aspects: firstly, the types and numbers of drug-resistant bacteria are constantly increasing; secondly, the pipeline for developing new antibiotics is becoming increasingly depleted. Against this backdrop, developing antimicrobial drugs with novel mechanisms of action has become a crucial issue that the scientific community and the pharmaceutical industry urgently need to address.
[0003] Antimicrobial peptides (AMPs) are considered one of the most promising drug candidates in the post-antibiotic era due to their unique bactericidal mechanism and low tendency to induce drug resistance. Unlike traditional antibiotics that act on a single target, many antimicrobial peptides exert rapid bactericidal effects by disrupting the integrity of microbial cell membranes. This physical mechanism makes it difficult for bacteria to develop resistance through a single mutation. In addition, some antimicrobial peptides also possess immunomodulatory functions, enhancing the host's ability to clear infection. However, naturally derived antimicrobial peptides still face many bottlenecks in their clinical translation, such as a narrow antimicrobial spectrum: many natural antimicrobial peptides are only active against Gram-positive or Gram-negative bacteria, making it difficult to address complex multi-species infections. They also present cytotoxicity issues; at effective bactericidal concentrations, they may produce hemolytic toxicity or other cytotoxic effects on host cells (such as erythrocytes), resulting in a narrow therapeutic window.
[0004] The prior art, patent application number CN202311373911.4, discloses a nucleolar localization signal peptide, and also provides a nucleolar localization marker for the signal peptide and a method for carrying the protein polypeptide into the nucleolus of eukaryotic cells. This invention can be applied to the study of the physiological functions of eukaryotic cells and the pathogenic mechanisms of pathogens, and can also be used for the development of nucleolar-targeted drug delivery technology. However, the signal peptide of this invention does not have a broad-spectrum antibacterial effect.
[0005] Patent application number 202411893923.4 specifically relates to a cell-penetrating peptide, Phage-Dec, and its application in antibacterial activity. Phage-Dec possesses excellent cell-penetrating ability and antibacterial activity, effectively penetrating cell membranes to target and inhibit bacterial growth, thereby achieving antibacterial effects. Studies have shown that Phage-Dec has significant inhibitory effects on various pathogenic bacteria and can effectively reduce bacterial reproduction rates. The use of this cell-penetrating peptide provides a new approach to antibacterial therapy, has good clinical application prospects, and lays a solid foundation for the development of novel antibacterial drugs based on bacteriophages. In the prior art, while Phage-Dec (CN202411893923.4), as a representative of a new class of antibacterial agents, has demonstrated inhibitory capabilities against some Gram-positive and Gram-negative bacteria, it still has the following inherent defects: the molecular configuration of this antibacterial peptide is relatively simple, and no enhanced designs such as tandem repeats or modular chimerism have been introduced. This structural uniformity limits its multivalent binding ability to bacterial membrane components (such as phospholipids and LPS), thus affecting the speed and thoroughness of its disruption of membrane integrity. It also provides an opportunity for bacteria to develop adaptive resistance through mechanisms such as altering membrane charge. Furthermore, this technical solution primarily focuses on its core antibacterial function and does not reveal or develop the application value of this peptide in other biotechnology fields, such as its subcellular localization ability in eukaryotic cells. This limits its technological value and application market.
[0006] Therefore, there is an urgent need in this field to develop a novel antimicrobial peptide that combines broad-spectrum and highly effective antimicrobial activity, good stability, and low cytotoxicity to overcome the shortcomings of existing technologies and provide a completely new solution for dealing with drug-resistant bacterial infections. Summary of the Invention
[0007] The purpose of this invention is to propose a novel broad-spectrum antimicrobial peptide and its applications. This antimicrobial peptide possesses certain broad-spectrum antimicrobial activity, exhibiting significant inhibitory effects against Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens. Furthermore, this broad-spectrum antimicrobial peptide exhibits low cytotoxicity and good biocompatibility, indicating its potential for clinical application.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] A novel antimicrobial peptide is a polypeptide obtained by 3-5 recombination tandemly of the amino acid sequence SEQ ID NO.1 (QERRSKKRELHCK), and a chimeric peptide is formed by linking the sequence SEQ ID NO.1 with a cell-penetrating peptide containing 2-10 arginines, named TN3.
[0010] Preferably, the amino acid sequence of the chimeric peptide is as shown in SEQ ID NO.3, specifically YGRKKRRQRRRQERRSKKRELHCKQERRSKKRELHCKQERR
[0011] SKKRELHCK.
[0012] The preferred embodiment of any of the above methods is to obtain the polypeptide by three tandem recombinations of the amino acid sequence SEQ ID NO.1.
[0013] The preferred embodiment of any of the above schemes is to obtain a polypeptide by tandem recombination of the amino acid sequence SEQ ID NO.1 three times, wherein the amino acid sequence SEQ ID NO.1 is QERRSKKRELHCK.
[0014] In any of the above schemes, it is preferred to use the sequence SEQ ID NO.1 to link with a cell-penetrating peptide containing 6 arginines to form a chimeric peptide, the amino acid sequence of which is shown in SEQ ID NO.2, specifically YGRKKRRQRRR.
[0015] Preferably, in any of the above embodiments, the amino acid sequence SEQ ID NO.1 is obtained by screening Legionella pneumophila protein Ceg10 (Lpg0284, GenBank: AAU26391.1). This invention is based on a sequence (QERRSKKRELHCK) selected from Legionella pneumophila Ceg10 and has been designed and modified accordingly. This sequence is highly disordered and can target the nucleolus.
[0016] There are two methods for preparing novel antimicrobial peptides. The first method uses prokaryotic expression and purification, while the second method involves chemically synthesizing the peptide sequence.
[0017] This invention also discloses the application of the novel antimicrobial peptides described above in inhibiting or suppressing cell membrane formation in Gram-negative bacteria, and in the preparation of antimicrobial drugs or antimicrobial products.
[0018] Preferably, the Gram-negative bacteria include at least one or more of Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens.
[0019] Preferably, in any of the above embodiments, the Gram-negative and Gram-positive bacteria include Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens.
[0020] Beneficial effects:
[0021] This invention is based on a sequence (amino acid sequence SEQ ID NO.1-QERRSKKRELHCK) screened from the Legionella pneumophila protein Ceg10 (Lpg0284, GenBank: AAU26391.1), which was designed and modified. This sequence is highly disordered and can target the nucleolus. This invention enhances multivalent interactions by using a triple tandem design of this sequence (amino acid sequence SEQ ID NO.1), greatly enhancing the initial electrostatic attraction and binding force between the peptide and the negatively charged bacterial cell membrane, and optimizing the amphiphilic structure of the peptide. Simultaneously, to achieve cell penetration capability, cell-penetrating peptides were screened, and a cell-penetrating peptide containing six arginine residues (amino acid sequence SEQ ID NO.2-YGRKKRRQRRR) was selected to link with the above peptide to form a chimeric peptide (amino acid sequence SEQ ID NO.3-YGRKKRRQRRRQERRSKKRELHCKQERRSKKRELHCKQERRSKKRELHCK), named TN3. The six arginine residues not only enable the peptide to penetrate cells, but also increase the charge number of the sequence, further enhancing the antibacterial activity of the peptide.
[0022] The broad-spectrum antimicrobial peptide disclosed in this invention possesses certain broad-spectrum antimicrobial activity, exhibiting significant inhibitory effects against Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens. Furthermore, this peptide exhibits low cytotoxicity, good biocompatibility, and potential for clinical application. Attached Figure Description
[0023] Figure 1 This is a graph of MIC determination results. In the graph, A represents the identification results of Staphylococcus aureus, Escherichia coli, and Pseudomonas fluorescens, and B represents the identification results of Listeria monocytogenes.
[0024] Figure 2 This is a graph showing the in vitro antibacterial (E. coli) effect and bactericidal rate of antimicrobial peptides. Figure 2 A is a plate plot showing the antibacterial effect of different concentrations of peptides on Escherichia coli, and 2B is a bar chart showing the antibacterial effect of different concentrations of peptides on Escherichia coli.
[0025] Figure 3 Figure A shows the in vitro antibacterial effect of antimicrobial peptides against Staphylococcus aureus and its bactericidal rate. Figure B is a plate plot showing the antibacterial effect of different concentrations of peptides against Staphylococcus aureus, and Figure B is a bar chart showing the antibacterial effect of different concentrations of peptides against Escherichia coli.
[0026] Figure 4 Figure A shows the in vitro antibacterial effect of antimicrobial peptides against Pseudomonas fluorescens and its bactericidal rate. Figure B shows the plate plot of the antibacterial effect of different concentrations of peptides against Pseudomonas fluorescens and the bar chart of the antibacterial effect of different concentrations of peptides against Pseudomonas fluorescens.
[0027] Figure 5 Figure A shows the in vitro antibacterial (Listeria) effect of antimicrobial peptides and their bactericidal rate. Figure A is a plate plot showing the antibacterial effect of different concentrations of peptides on Listeria, and Figure B is a bar chart showing the antibacterial effect of different concentrations of peptides on Listeria.
[0028] Figure 6 The effects of antimicrobial peptides on the biofilm of four strains are shown in Figure A, which is a plate plot comparing the antimicrobial effects of antimicrobial peptides on the biofilm of strains, and Figure B is a bar chart showing the antimicrobial effects of antimicrobial peptides on the biofilm of strains.
[0029] Figure 7 , Figure 8 , Figure 9 , Figure 10 , Figure 11 The effect of antimicrobial peptides on the survival rate of four bacterial strains, among which Figures 7-10 This is a scatter plot used to analyze the bactericidal effects of different treatments (control, peptide, antibiotic) on four bacterial strains, as determined by flow cytometry. Figure 11 This is a bar chart;
[0030] Figure 12 This is the result of the cytotoxicity test for the antimicrobial peptide. Detailed Implementation
[0031] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.
[0032] Materials required for this experiment: Rapid digestion enzymes NcoI and BamHI were purchased from Thermo Fisher Scientific. High-fidelity PCR enzyme 2×Phanta Flash Master Mix (Dye Plus) from Novizan Technologies, product number: P520-02. DNA homologous recombination kit ClonExpress Ultra One Step Cloning Kit V2 from Novizan Technologies, product number: C116-01. Peptide sequence plasmid template pCDNA3.1-4xNoLS-EGFP (preparation method detailed in patent CN202311373911.4). pET-28b(+)-6His vector plasmid from Addgene. DH5α strain, BL21 Gold strain. Ultrapure water, 10×TAE, agarose, Topred. LB medium, kanamycin (30 mg / ml), buffer (20 mM Tris-HCl pH=8.0, 200 mM NaCl), IPTG (1 M), nickel column, imidazole elution buffer (20 mM Tris-HCl pH=8.0, 200 mM NaCl, 20 / 50 / 500 mM imidazole). Human HEK293T cell lines were purchased from ATCC (cell number: CRL-3216). The MTT cell proliferation and cytotoxicity assay kit was purchased from Beyotime Biotechnology, product number: C0009S.
[0033] Example 1
[0034] Obtaining a novel broad-spectrum antimicrobial peptide: The novel broad-spectrum antimicrobial peptide of this application is a polypeptide obtained by 3-5 recombination tandemly of the amino acid sequence SEQ ID NO.1, and the sequence SEQ ID NO.1 is linked with the cell-penetrating peptide SEQ ID NO.2 containing 6 arginines to form a chimeric peptide SEQ ID NO.3, named TN3.
[0035] Method 1: Prokaryotic expression and purification
[0036] 1. First, a prokaryotic expression vector was constructed using homologous recombination. The polypeptide sequence SEQ ID NO.1 was digested into the pET-28b vector using restriction endonucleases NcoI and BamHI as restriction sites. Specifically, the plasmid pCDNA3.1-4xNoLS-EGFP (the preparation method is common knowledge in the art, and can be found in patent CN202311373911.4) and the pET-28b(+)-6His vector plasmid were used as PCR templates. The PCR recombination primers were designed as follows:
[0037] 1:CTTAAGTTTAAAGCGGCGGCGCTGGCGGCGTTTTTTGCGGCCATA;
[0038] 2:CAAAGGCGGATCCCTCGAGCACCACCACC;
[0039] 3:CAGCGCCGCCGCTTTAAACTTAAGCTTCAAGAAAGAC;
[0040] 4:GGTGGTGGTTGCTCGAGGGATCCGCCTTTGCAGTGAAG;
[0041] The plasmid template pCDNA3.1-4xNoLS-EGFP was amplified using Novozymes 2×Phanta Flash Master Mix enzyme primers 3 and 4 to obtain a polypeptide fragment in tandem. The PCR amplification conditions are shown in Table 1 below:
[0042] Table 1
[0043]
[0044] Primers 1 and 2 were used for reverse amplification of the empty plasmid pET-28b to obtain a linearized vector with an N-terminal transmembrane peptide, SEQ ID NO. 2. The PCR amplification conditions are shown in Table 2 below:
[0045] Table 2
[0046]
[0047] The PCR products digested by enzymes were recovered by agarose gel electrophoresis. The successfully tandemly linked peptide target fragments were ligated to the linearized vector pET-28b(+)-6His containing the membrane-penetrating peptide (SEQ ID NO.2) using the Novizan ClonExpress II OneStep Cloning Kit. The ligation system followed the instructions. After mixing the reaction mixture, the cells were incubated at 37 °C for 30 min. DH5α competent cells were thawed on ice, the recombinant product was added, and the cells were incubated on ice for 30 min, followed by heat shock at 42 °C for 90 s. Then, 900 μL of LB broth was added and the cells were shaken for 1 h. After centrifugation at 5000 rpm for 5 min, most of the culture supernatant was aspirated in a clean bench, leaving a small amount of resuspended bacterial pellet. The bacterial culture was then spread onto LB agar plates containing the appropriate antibiotic and incubated upside down at 37 °C overnight. The next day, single clones were picked and sent to General Technology for sequencing verification.
[0048] 2. The successfully constructed plasmid pET-28b-TN3-6His was transformed into *E. coli* BL21 Gold competent cells and cultured overnight upside down on plates containing the appropriate antibiotic. Single colonies were then picked and inoculated into 20 mL of LB broth containing the appropriate antibiotic, and cultured overnight at 37 ℃ and 220 rpm. The next day, the entire 20 mL of the shaken bacterial culture was inoculated into a 1 L LB flask containing the appropriate antibiotic. The culture was shaken at 37 ℃ and 220 rpm until the OD600 value was between 0.6 and 0.8. Then, 0.2 mM IPTG was added for induction at 37 ℃ for 5 h. After induction, the cells were harvested. The bacterial culture was poured into a 1 L collection flask, centrifuged at 4000 rpm for 20 min, and most of the supernatant was discarded. The bacterial pellet was resuspended in a small amount of culture medium. The suspension was transferred to a 50 mL conical centrifuge tube, centrifuged at 4000 rpm for 20 min, and all supernatant was discarded, retaining the bacterial pellet. Pre-cool the high-pressure homogenizer to 4°C. After the preserved bacterial cell pellet thaws, resuspend the bacterial cell pellet in Binding Buffer (20 mM Tris-HCl pH=8.0, 200 mM NaCl) and add it to the high-pressure homogenizer. Disrupt the pellet at 1000 bar, repeating 4-5 times until the bacterial solution becomes clear and transparent. Centrifuge the disrupted bacterial solution at 12000 rpm at 4°C for 1 hour, and collect the supernatant. Then perform nickel affinity chromatography. Add the protein supernatant to the nickel column and incubate at 4°C for 20 min on a rotary mixer to allow the protein to react with the Ni. 2+ The protein was fully eluted. The supernatant was collected and eluted with 20 mL of buffer containing 20 mM and 50 mM imidazole, respectively. Finally, the protein was eluted with 500 mM imidazole. 10 mL of the eluent was collected and poured into a concentration tube for concentration. Binding Buffer was then used for concentration and replacement three times. The successfully replaced peptide solution was collected to obtain the chimeric peptide amino acid sequence shown in SEQ ID NO.3.
[0049] Method 2: The polypeptide sequence SEQ ID NO.3 (YGRKKRRQRRRQERRS)
[0050] KKRELHCKQERRSKKRELHCKQERRSKKRELHCK) is directly chemically synthesized.
[0051] (1) Instruments and equipment:
[0052] The MS mass spectrometer is a Shimadzu LCMS-2020 model.
[0053] The HPLC instrument used is a Shimadzu HPLC-20AD / AT model.
[0054] (2) Basic route:
[0055] 1. Resin type: Rink; Synthesis method: FMOC solid-phase synthesis; Synthesis amount: 0.15 mmol
[0056] Amino acids are represented as Fmoc-AA-OH
[0057] 2. Amino acid and resin condensation: Synthesis began from the C-terminus of the peptide. 0.195 mmol (1.3 eq) of Fmoc-AA-OH was coupled to the resin using 0.5 mmol DIEA and 3 ml DCM as solvents. The reaction was carried out at room temperature for 1.5 h. Then, 0.5 mmol methanol and 10 ml DCM solution were added, and the reaction was allowed to proceed for 20 min to block unreacted sites on the resin.
[0058] 3. FMOC Removal: FMOC is removed using a DMF solution containing 20% piperidine, reacting at room temperature for 20 min. After removal, the resin is washed with DMF four times, 1 min each time.
[0059] 4. Amino acid condensation: 0.5 mmol Fmoc-AA-OH (3 eq) and the resin peptide were dehydrated and condensed using 0.5 mmol DIC + 0.5 mmol HOBT and 3 ml DMF as solvents.
[0060] 5. Repeat steps 3-4 to condense the remaining amino acids sequentially (C-terminus to N-terminus). Finally, add 0.5 mmol DIEA + 0.5 mmol HBTU and 3 ml DMF as solvents to react 0.5 mmol Fam (3 eq) and the resin peptide in the dark for 4 hours.
[0061] 6. Peptide lysis: The lysis buffer composition is 95% TFA, 1% H2O, 2% EDT, and 2% TIS. The lysis time is 2 hours. After lysis, the lysate is filtered into ice-cold diethyl ether, centrifuged, and lyophilized to obtain the crude product.
[0062] 7. Peptide purification
[0063] Preparation conditions: Column: 20*250mm Daisogel, 8 μm
[0064] Mobile phase: A: 0.1% TFA + Water; B: 0.1% TFA + Acetonitrile
[0065] Flow rate: 10 ml / min
[0066] The sample was loaded onto pump A, and then the gradient was started after running a 10% acetonitrile water balance for 5 minutes.
[0067]
[0068] Prepare and collect sample peaks for detection, with an analytical purity greater than 95%.
[0069] This invention is based on a sequence (amino acid sequence SEQ ID NO.1-QERRSKKRELHCK) screened from Legionella pneumophila Ceg10, and its design was modified accordingly. Specifically, this invention uses a tandem design with three repeats of this sequence (amino acid sequence SEQ ID NO.1). Simultaneously, to achieve cell-penetrating ability of the peptide, cell-penetrating peptides were screened, and ultimately a cell-penetrating peptide containing six arginine residues (amino acid sequence SEQ ID NO.2-YGRKKRRQRRR) was selected and linked to the above peptide to form a chimeric peptide (chimeric peptide amino acid sequence SEQ ID NO.3-YGRKKRRQRRRQERRS).
[0070] KKRELHCKQERRSKKRELHCKQERRSKKRELHCK), and named it TN3.
[0071] Example 2: Detection of antimicrobial activity of antimicrobial peptides
[0072] (1) Determination of minimum inhibitory concentration
[0073] The minimum inhibitory concentration (MIC) was determined by the micro-broth dilution method, and the results were interpreted according to the CLSI standard (2019 version).
[0074] Staphylococcus aureus, Escherichia coli (DH5α), Pseudomonas fluorescens, and Listeria monocytogenes cultured to the logarithmic growth phase were all diluted to 1×10⁻⁶. 5 CFU / mL, add 100 μL of the above bacterial culture to each well of a 96-well plate, and then... Figure 1 It can be seen that the final concentrations of antimicrobial peptide solution added to Listeria were 0, 0.0375, 0.0675, 125, 0.25, 0.5, 1, 2, 4, and 8 μM, respectively. For the remaining bacteria, the final concentration of antimicrobial peptide added was increased to 160 μM. The 96-well plate was placed in a 37°C incubator for static incubation, and the turbidity of the liquid in the well was observed and the OD600 value was measured. The concentration with an OD600 value lower than that of the control group and clear liquid was taken as the MIC value. This experiment was repeated three times, as shown in Table 3.
[0075] Table 3
[0076]
[0077] (2) Calculation of the bactericidal rate of antimicrobial peptides against bacteria
[0078] In a plating antibacterial experiment, Staphylococcus aureus, Escherichia coli (DH5α), Pseudomonas fluorescens, and Listeria monocytogenes cultured to the logarithmic growth phase were diluted to 1×10⁻⁶. 5 CFU / mL, 100 μL of bacterial suspension was incubated with different final concentrations of antimicrobial peptides for 30 min, then samples were spread on LB solid medium, and after the bacterial suspension was completely absorbed, it was placed in a 37℃ constant temperature incubator for 12-16 h and colony count was performed. This experiment was repeated three times.
[0079] Figure 1 This is a graph of MIC determination results. In the graph, A represents the identification results of Staphylococcus aureus, Escherichia coli, and Pseudomonas fluorescens, and B represents the identification results of Listeria monocytogenes. Figure 2 This is a graph showing the in vitro antibacterial (E. coli) effect and bactericidal rate of antimicrobial peptides. Figure 2 A is a plate plot showing the antibacterial effect of different concentrations of peptides on Escherichia coli, and 2B is a bar chart showing the antibacterial effect of different concentrations of peptides on Escherichia coli. Figure 3 Figure A shows the in vitro antibacterial effect of antimicrobial peptides against Staphylococcus aureus and its bactericidal rate. Figure B is a plate plot showing the antibacterial effect of different concentrations of peptides against Staphylococcus aureus, and Figure B is a bar chart showing the antibacterial effect of different concentrations of peptides against Escherichia coli. Figure 4 Figure A shows the in vitro antibacterial effect of antimicrobial peptides against Pseudomonas fluorescens and its bactericidal rate. Figure B shows the plate plot of the antibacterial effect of different concentrations of peptides against Pseudomonas fluorescens and the bar chart of the antibacterial effect of different concentrations of peptides against Pseudomonas fluorescens. Figure 5 This is a graph showing the in vitro antibacterial (Listeria) effect and bactericidal rate of antimicrobial peptides. Figure A is a plate plot showing the antibacterial effect of different concentrations of peptides against Listeria, and Figure B is a bar chart showing the antibacterial effect of different concentrations of peptides against Listeria. Figures 1-5 It was found that when the antimicrobial peptide concentration reached 20 μM, it could effectively kill more than 98% of Staphylococcus aureus (P<0.001), and when the final concentration reached 40 μM, it could effectively kill more than 98% of Escherichia coli (P<0.001). When the final concentration reached 250 nM, it could effectively kill more than 98% of Pseudomonas fluorescens (P<0.001). When the final concentration reached 100 μM, it could effectively kill more than 98% of Pseudomonas fluorescens (P<0.001). These results indicate that the antimicrobial peptide has significant bactericidal activity against these four bacteria.
[0080] The formula for calculating the sterilization rate is: Sterilization rate = 1 - (number of colonies in the experimental group / number of colonies in the blank group × 100%)
[0081] Example 3: Inhibitory effect of antimicrobial peptides on cell membrane formation
[0082] The inhibitory effect of antimicrobial peptides on biofilm formation of Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens was detected by crystal violet staining and measurement of the absorbance of the formed biofilm at a wavelength of 570 nm.
[0083] The specific procedure is as follows: Add 100 μL of LB medium to each well of a 96-well plate, followed by adding a 1×10⁻⁶ solution of LB medium. 5 CFU / mL bacterial suspensions (Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens) were prepared, and then antimicrobial peptides were added to final concentrations of 20, 40, 0.25, and 100 μM, respectively. A negative control without antimicrobial peptides was used. 96-well microplates containing the samples were incubated at 37°C for 72 h. After discarding the supernatant, the plates were gently washed three times with phosphate-buffered saline (PBS, pH 7.4) to remove airborne bacteria. Then, 100 μL of 0.1% crystal violet solution was added and stained at room temperature for 30 min. The crystal violet solution was then discarded, and the plate was washed with 75% anhydrous ethanol to remove any remaining stain. This process was repeated three times. Images were then taken. Quantitative analysis was performed simultaneously. The absorbance of the formed biofilm at 570 nm was measured using a multi-mode microplate reader to analyze the amount of biofilm formed. The experiment was repeated three times. Figure 6 This paper describes the effects of antimicrobial peptides on the biofilms of four bacterial strains. Figure A shows a plate plot comparing the antimicrobial effects of antimicrobial peptides on bacterial biofilms, and Figure B shows a bar chart of the antimicrobial effects of antimicrobial peptides on bacterial biofilms. Figure 6 It can be seen that the antimicrobial peptide has a significant inhibitory effect on the biofilm of all four strains.
[0084] Example 4: Detection of bacterial viability after treatment with antimicrobial peptides
[0085] This experiment used a bacterial live / dead staining kit (Beyotime Biotechnology Co., Ltd.) and flow cytometry to quantitatively analyze the bacterial viability after peptide treatment.
[0086] The specific procedure is as follows: Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens are cultured in LB medium until the logarithmic growth phase. 1 mL of bacterial suspension (OD600=1.0) is taken from each suspension, centrifuged at 10000Xg at room temperature for 5 min, the supernatant is discarded, and the suspension is washed once with physiological saline (PBS). The suspension is then resuspended in physiological saline to 100 μL. Antimicrobial peptides (20, 40, 0.25, and 100 μM, respectively) are added and incubated with the suspension at room temperature for 30 min (the antimicrobial peptide concentration is the bactericidal concentration for each strain). The suspension is centrifuged at 10000Xg at room temperature for 5 min, the supernatant is discarded, and the suspension is washed once with physiological saline (PBS). The suspension is then resuspended in physiological saline to 100 μL. The staining working solution is then prepared by adding 1 μL of DMAO (1000X) and 1 μL of PI (1000X) to 8 μL of detection buffer and mixing thoroughly to obtain 10 μL of bacterial viability / death staining working solution (100X). Add 1 μL of staining working solution to each bacterial culture and incubate at 37°C in the dark for 15 min. After incubation, perform flow cytometry analysis directly, ensuring the entire process is conducted in the dark. DMAO is green fluorescence, Ex / Em = 503 / 530 nm, and PI is red fluorescence, Ex / Em = 535 / 617 nm. For double-stained bacterial flow cytometry analysis, two relatively independent bacterial populations should be obtained: either only green fluorescent bacterial populations or a group of dead bacteria with red fluorescence. The experiment should be performed in triplicate. Figures 7-11 The study investigated the effect of antimicrobial peptides on the survival rates of four bacterial strains. Figures 7-10 This is a scatter plot used to analyze the bactericidal effects of different treatments (control, peptide, antibiotic) on four bacterial strains, as determined by flow cytometry. Figure 11 For bar charts, by Figures 7-11 It can be seen that the antimicrobial peptides have a very significant inhibitory effect on the four strains, and the inhibitory efficiency is no significantly different from that of antibiotics.
[0087] Example 5: Cytotoxicity assay, the specific steps are as follows
[0088] First, a polypeptide gene was integrated into 293T cells using genetic engineering techniques, named TN, followed by an MTT assay. Single-cell suspensions were prepared by digesting and resuspending this cell line in logarithmic growth phase and wild-type 293T cells, and then plotted at 5 x 10⁻⁶ cells per well. 3Cells were precisely seeded at a standardized seeding density into 96-well plates and then incubated overnight at 37°C with 5% CO2 to ensure adequate cell adhesion. After one night of incubation, the absorbance of one group of cells was directly measured as the baseline value for "0 hours". Cells in other wells were cultured and analyzed at 24, 48, and 72 hours. At each analysis time point, 10 μl of MTT solution (5 mg / ml) was added to each well, and the cells were incubated for another 4 hours. During this time, succinate dehydrogenase in the mitochondria of live cells reduced the yellow MTT to insoluble blue-purple formazan crystals. The old culture medium was carefully removed from the wells, and 150 μl of dimethyl sulfoxide (DMSO) was added to dissolve the formazan crystals. The cells were then shaken at 60 rpm for 10 minutes at room temperature to ensure complete dissolution of the crystals. The absorbance of each well was then measured at 490 nm using a multi-plate reader. The experiment was performed in triplicate. Figure 12 It can be seen that the stable expression of antimicrobial peptides has no obvious toxic effect on cells and does not inhibit normal cell growth and proliferation, proving that it has a certain degree of biocompatibility.
[0089] The above are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A novel broad-spectrum antimicrobial peptide, characterized in that, The polypeptide is obtained by 3-5 recombination tandems of the amino acid sequence SEQ ID NO.1, and is named TN3 by linking the sequence SEQ ID NO.1 with a cell-penetrating peptide containing 2-10 arginines.
2. The novel broad-spectrum antimicrobial peptide as described in claim 1, characterized in that, The amino acid sequence of the chimeric peptide is shown in SEQ ID NO.
3.
3. The novel broad-spectrum antimicrobial peptide as described in claim 1, characterized in that, The polypeptide was obtained by three tandem recombinations using the amino acid sequence SEQ ID NO.
1.
4. The novel broad-spectrum antimicrobial peptide as described in claim 1, characterized in that, A chimeric peptide was formed by linking the sequence SEQ ID NO.1 with a cell-penetrating peptide containing 6 arginine residues. The amino acid sequence of the cell-penetrating peptide is shown in SEQ ID NO.
2.
5. The novel broad-spectrum antimicrobial peptide as described in claim 4, characterized in that, The amino acid sequence SEQ ID NO.1 was obtained by screening Legionella pneumophila Ceg10.
6. The application of the novel broad-spectrum antimicrobial peptides as described in claims 1-5 in inhibiting or suppressing cell membrane formation in Gram-negative and Gram-positive bacteria, and in the preparation of antimicrobial drugs or antimicrobial products.
7. The novel broad-spectrum antimicrobial peptide as described in claim 6, characterized in that, The Gram-negative and Gram-positive bacteria include Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Pseudomonas fluorescens.
Citation Information
Patent Citations
Nucleus localization signal peptide and application thereof
CN117304282A
Cell penetrating peptide phage-de and its application in antibiosis
CN119841907B