Cell sensor as well as preparation method and application thereof

Abstract

The invention discloses a cell sensor as well as a preparation method and application thereof. The present invention provides a cell sensor comprising a skin cell comprising a reporter gene operably linked to an exogenous chemical response element (XRE) and a minimum promoter (minP); wherein the reporter gene is expressed or activated when an AhR signal channel of the skin cell is activated, and a detectable signal is generated. The cell sensor provided by the invention can be used for rapidly screening the health risk of cosmetics, prompting the health risk caused by long-term exposure of various chemicals and commercial products, providing supplement for the existing method, and providing technical means and data support for perfecting related detection. The method is used for screening potential health risks of substances, such as cosmetics, in direct contact with skin, and can also rapidly indicate the toxicity of environmental pollutants and compounds.

Description

Technical Field

[0001] This invention belongs to the field of cell engineering and relates to a cell sensor, its preparation method, and its application. Specifically, it relates to a skin cell-based cell sensor for cosmetic safety screening, its preparation method, and its application. Background Technology

[0002] With a wide variety of cosmetics on the market and an increasing number of approved or pending cosmetic ingredients, the necessity for comprehensive assessment of the health risks of cosmetics is constantly growing as new products and application scenarios emerge in the commercial market. Regarding cosmetic safety testing, China has issued relevant safety technical specifications, which stipulate the prohibited and restricted ingredients, physicochemical testing methods, and toxicological testing methods for cosmetics.

[0003] In existing cosmetic safety evaluation systems, sensitization is a key focus. Skin sensitization involves multiple key events (KEs) and molecular pathways. Given the complexity of its biological processes, the Organization for Economic Co-operation and Development (OECD) has proposed a skin sensitization prediction strategy based on the Adverse Outcome Pathway (AOP). The AOP stage mainly includes the following four KEs: KE1 covalent binding of chemicals to skin proteins, KE2 inflammatory or oxidative stress responses in keratinocytes, KE3 dendritic cell (DC) activation, and KE4 T cell proliferation and sensitization memory formation. Among these, in vitro detection methods using cell-based assays mainly fall into two categories:

[0004] (1) In the in vitro alternative detection system for skin sensitization testing, the OECD TG 442D cosmetic in vitro skin sensitization test ARE-Nrf2 luciferase assay evaluates the sensitization potential of cosmetics by measuring the expression level of the luciferase gene, which belongs to the KE2 step in the AOP stage. Among the three known cell signaling pathways that can be activated by sensitizers, namely Keap1 / Nrf2 / ARE / EpRE, ARNT / AhR / XRE, and Nrf1 / MTF / MRE, only Keap1 / Nrf2 / ARE / EpRE has been developed into a standardized sensitizer screening mechanism, namely the skin sensitization test ARE-Nrf2 luciferase assay, which can cover more than 80% of sensitizers. This method uses human keratinocyte cell lines containing the ARE luciferase reporter gene. The cells cultured in the test solution are lysed, and luciferase expression is detected according to the requirements of the luciferase reporter gene detection kit. The limitation of this method is its limited specificity. ARE is a downstream of the antioxidant pathway, and many antioxidants can activate ARE, but this does not mean that they are sensitizing.

[0005] Furthermore, the aforementioned in vitro skin sensitization assay for cosmetics, based on the ARE-Nrf2 luciferase assay, primarily relies on signaling pathways that regulate cellular antioxidant function, thus having certain limitations. A few sensitizing agents did not participate in this pathway during the assay, but instead triggered other currently unknown toxicological pathways. Conversely, many antioxidant skincare ingredients can activate ARE without causing sensitization. Therefore, it is necessary to research and develop other pathways as alternative or supplementary methods.

[0006] (2) Another type of in vitro alternative detection method is the various detection methods developed by OECD TG 442E for KE3 in AOP, including the human cell line activation test (h-CLAT) method for detecting CD86 and CD54, and U-SENS. TM These two methods, one for detecting CD86 and the other for detecting CD54, involve exposing human cells to the test substance and then quantitatively detecting changes in CD86 and CD54 expression using flow cytometry. A positive sensitization result is defined as an expression level exceeding a threshold (e.g., CD86 ≥ 150% or CD54 ≥ 200%). The other method involves staining cells cultured with the test substance with fluorescent antibodies and detecting the expression of cell surface molecules CD86 and CD54 by measuring the fluorescence intensity. However, the sensitivity of this method is limited by the sensitivity of the flow cytometer itself; the same batch of samples is highly susceptible to false negatives in lower-specification flow cytometers.

[0007] Furthermore, the h-CLAT method detects CD86 and CD54, and U-SENS. TMWhile the CD86 assay performs well in terms of standardization and sensitivity, it still has key limitations in practical applications for cosmetic testing: 1) Risk of fluorescence interference and signal misinterpretation: Cosmetic raw materials or finished products often contain self-fluorescent components (such as plant extracts, pigments, fragrances, etc.), which may cross-interfere with fluorescent antibodies in flow cytometry, leading to false positive or false negative results; 2) High technical requirements: Flow cytometry has extremely high requirements for instruments and experimental operations, especially when detecting weak allergens or complex formulations, making it difficult to guarantee repeatability and consistency; 3) Low throughput and efficiency: Flow cytometry can quickly process single samples, but multiple batches of samples still need to be processed tube by tube, and the sample preparation process is cumbersome, limiting the overall throughput; at the same time, the high cost of antibodies and instruments makes large-scale application difficult.

[0008] It is evident that the two methods described above not only have limitations in evaluating the sensitization potential of cosmetics, but also fail to reflect other health risks such as endocrine disruption, chronic inflammation, and cumulative toxicity. Referring to the Johnson & Johnson baby powder incident in the United States, several women who used the product on their private parts for many years developed cervical cancer years later. This form of toxicity is very similar to persistent toxic pollutants such as dioxins, meaning that toxicity develops after years of continuous exposure. Current cosmetic safety evaluation methods cannot indicate chronic toxicity; therefore, there is an urgent need to establish a rapid evaluation method for the chronic toxicity of cosmetics based on humanized skin cells, referencing methods used for persistent toxic pollutants. Summary of the Invention

[0009] The problem the invention aims to solve

[0010] As mentioned earlier, existing methods are insufficient to meet the testing needs of the vast cosmetics market, and existing experimental methods have certain limitations. For example, the mechanisms underlying sensitization tests for cosmetics are limited, necessitating the development of effective detection methods based on other sensitization mechanisms. Furthermore, existing detection methods primarily target substances with clearly defined adverse reactions, such as phototoxicity, skin irritation, skin corrosion, and skin sensitization. Given that humans are subject to repeated and prolonged exposure to cosmetics, the screening for chronic toxicity in cosmetics cannot be ignored. For instance, some substances have potential endocrine-disrupting effects, posing health risks with long-term exposure.

[0011] Solution for solving the problem

[0012] [1]. A cell sensor comprising skin cells containing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP);

[0013] The reporter gene is expressed or activated when the AhR signaling pathway in the skin cells is activated, generating a detectable signal.

[0014] [2]. According to the cell sensor described in [1], wherein the skin cells are derived from mammalian skin cells;

[0015] Preferably, the skin cells are human, mouse, or monkey-derived skin cells.

[0016] More preferably, the skin cells include keratinocytes.

[0017] More preferably, the skin cells comprise the immortalized keratinocyte line HaCaT.

[0018] [3]. The cell sensor according to [1] or [2], wherein the exogenous chemical reaction element comprises a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:1.

[0019] [4]. The cell sensor according to any one of [1]-[3], wherein the minimum promoter comprises a nucleotide sequence as shown in SEQ ID NO:2, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:2.

[0020] [5]. A cell sensor according to any one of [1]-[4], wherein the reporter gene comprises a nucleic acid molecule encoding a luciferase or a fluorescent protein.

[0021] [6]. A cell sensor according to any one of [1]-[5], wherein the reporter gene operatively linked to the exogenous chemical response element and the minimum promoter is integrated into the genome of the skin cell;

[0022] Preferably, the reporter gene, operatively linked to the exogenous chemical reaction element and the minimum promoter, is integrated into the genome of the skin cells via a DNA transposon system.

[0023] More preferably, the DNA transposon system is the PiggyBac transposon system.

[0024] [7]. A method for constructing a cell sensor according to any one of [1]-[6], wherein the method includes the step of introducing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP) into skin cells.

[0025] [8]. According to the construction method described in [7], the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP) is introduced into skin cells via a vector carrying the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP).

[0026] [9]. The construction method according to [8], wherein the vector is a vector based on a DNA transposon system,

[0027] Preferably, the carrier is a carrier based on the PiggyBac transposon system.

[0028]

[10] . The construction method according to any one of [7]-[9], wherein the vector further comprises a resistance gene;

[0029] Optionally, the resistance gene comprises a nucleotide sequence as shown in SEQ ID NO:6, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:6.

[0030]

[11] . The construction method according to any one of [7]-

[10] , wherein the vector comprises a nucleotide sequence as shown in SEQ ID NO:7, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:7.

[0031]

[12] . A detection method, wherein the method includes the step of performing detection using a cell sensor according to any one of [1]-[6] or using a cell sensor constructed according to any one of [7]-

[11] .

[0032]

[13] . According to the detection method described in

[12] , the method further includes adding the sample to be tested into the cell sensor, incubating them together, and then detecting the expression or activity level of the reporter gene of the cell sensor.

[0033]

[14] . According to the detection method described in

[13] , the incubation time is between 6 hours and 96 hours.

[0034] Preferably, the incubation time is between 12 and 48 hours.

[0035] More preferably, the incubation time is between 18 and 40 hours.

[0036]

[15] . The cell sensor according to any one of [1]-[6] or the cell sensor constructed using any one of the construction methods according to [7]-

[11] , for any of the following uses:

[0037] (1) Use in detecting the skin sensitization risk of the reagent or product;

[0038] (2) Uses in detecting pollutants;

[0039] (3) Use in screening AhR agonists or antagonists;

[0040] (4) Use in the preparation of test reagents or kits.

[0041]

[16] . According to the use described in

[15] , wherein the detection reagent or kit further comprises cell culture reagent and / or reporter gene detection reagent.

[0042]

[17] . According to the use described in

[15] , wherein the reagent or product is selected from cosmetics and / or cosmetic ingredients.

[0043]

[18] . According to the use described in

[15] , wherein the contaminant is selected from at least one of contaminants from environmental samples, food samples, drug samples or cosmetic and / or cosmetic ingredients.

[0044] The effects of the invention

[0045] This invention constructs cell sensors, such as cell sensors based on skin cells (specifically, human keratinocytes HaCaT), for screening potential health risks from substances that come into direct contact with the skin, such as cosmetics.

[0046] The cell sensor constructed in this invention can sensitively and rapidly indicate the degree to which the analyte activates the AhR pathway. It can be used for cosmetic screening to indicate potential risks such as sensitization, inflammation, and endocrine disruption associated with cosmetics.

[0047] This invention constructs a HaCaT stably transfected cell line based on the AhR / XRE signaling pathway and uses a luciferase gene detection method to screen cosmetics with potential chronic toxicity. It realizes the development of a cosmetic sensitization experimental method based on a novel sensitization pathway, which can be used for rapid screening of health risks from cosmetics, indicating the health risks from long-term exposure to various chemicals and commercial products. It is expected to provide a significant supplement to existing methods and offer technical means and data support for improving related detection methods.

[0048] The cell sensor detection method developed in this invention is simple and can quickly indicate the toxicity of environmental pollutants and compounds. Attached Figure Description

[0049] Figure 1A The image shows the plasmid pattern of the PB511B-1 vector.

[0050] Figure 1BThe plasmid map of the PB511B-1 vector after deleting EF1α-GFP-PuroP.

[0051] Figure 2 This is a diagram showing the comparison of different drug administration times.

[0052] Figure 3 This is a diagram comparing different transfection methods.

[0053] Figure 4 A schematic diagram showing the effect of 2, 3, 7, 8-TCDD on cells at different passages.

[0054] Figure 5 This is a schematic diagram showing the effect of FICZ on cells at different passages.

[0055] Figure 6 This is a schematic diagram showing the test results for three different essences.

[0056] Figure 7 This is a schematic diagram showing the test results of three different serums with different effects.

[0057] Figure 8 For U-SENS TM A schematic diagram of the results of a skin sensitization test.

[0058] Figure 9 This is a schematic diagram of the BaP pollutant detection results.

[0059] Figure 10 and Figure 11 A schematic diagram illustrating the results of optimizing seeding density for stable transfected cells.

[0060] Figure 12 A schematic diagram illustrating the results of optimizing drug delivery time for stable transfected cells.

[0061] Figure 13 Schematic diagram of the response results of different types of skin cell lines to the AHR pathway. Detailed Implementation

[0062] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" as used herein means "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0063] Furthermore, to better illustrate the present invention, numerous specific details are set forth in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In other instances, methods, means, apparatus, and steps well known to those skilled in the art have not been described in detail in order to highlight the spirit of the present invention.

[0064] Unless otherwise stated, all units used in this specification are international standard units, and all numerical values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0065] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0066] In this specification, references to "some specific / preferred embodiments / methods," "other specific / preferred embodiments / methods," or "implementation / method" refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment / method that are included in at least one embodiment / method described herein, and may or may not exist in other embodiments / methods. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments / methods.

[0067] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0068] In this specification, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to an amino acid polymer of any length. The polymer may be linear or branched, may contain modified amino acids, and may be separated by non-amino acid segments. The term also includes amino acid polymers that have been modified (e.g., through disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with labeled components).

[0069] In this art, “G,” “C,” “A,” “T,” and “U” typically represent bases containing guanine, cytosine, adenine, thymine, and uracil, respectively. However, it is also generally known in the art that each of “G,” “C,” “A,” “T,” and “U” typically also represents a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively. This is a common practice in representing deoxyribonucleic acid (DNA) sequences and / or ribonucleic acid (RNA) sequences. Therefore, in the context of this invention, the meanings of “G,” “C,” “A,” “T,” and “U” include all of the above-mentioned possible cases. However, it should be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide (as further detailed below) or an alternative substitution. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other parts without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide having such a substitution).

[0070] In this specification, the terms "sequence identity" or "percentage of identity" in comparisons of two nucleic acids or peptides refer to the percentage of identical sequences or identical sequences when compared and aligned using nucleotide or amino acid residue sequence comparison algorithms or by visual inspection to achieve the highest possible correspondence. In other words, the identity of a nucleotide or amino acid sequence can be defined using a ratio that represents the proportion of identical nucleotides or amino acids in the total number of nucleotides or amino acids in the aligned portion, assuming the maximum number of identical nucleotides or amino acids and omitting gaps as needed.

[0071] In this specification, the term "expression" includes any step involved in polypeptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0072] In this specification, the terms "vector" and "expression vector" refer to a DNA construct containing a DNA sequence operatively linked to a suitable control sequence for expressing a target gene in a suitable host. "Recombinant expression vector" refers to a DNA structure containing a polynucleotide encoding, for example, a desired exogenous polypeptide. Recombinant expression vectors may include, for example, a set of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence transcribed into mRNA and translated into a protein; and iii) a transcriptional subunit containing appropriate transcription and translation initiation and termination sequences. Recombinant expression vectors are constructed in any suitable manner. The nature of the vector is not important, and any vector, including plasmids, viruses, bacteriophages, and transposons, may be used. Possible vectors used in this invention include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, bacteriophage DNA, yeast plasmids, and vectors derived from combinations of plasmids and bacteriophage DNA, and DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0073] In this specification, the terms "isolated" and "purified" are used to refer to molecules (e.g., isolated nucleic acids, polypeptides, etc.) or other components removed from at least one other component with which they are naturally associated. The term "purified" does not require absolute purity, but is intended to be defined relatively.

[0074] In this specification, the term "cell sensor" refers to an analytical device that uses living cells (animal, plant, or microbial cells) as sensing elements. It qualitatively or quantitatively acquires information about a target substance by detecting the various response signals produced by the cells after sensing external stimuli (such as chemical substances, physical signals, or biomolecules).

[0075] In this specification, the term "transfection" refers to the delivery of a vector, nucleotide, or recombinant vector into a target cell, such that the vector, nucleotide, or recombinant vector is expressed or has a biological function in the cell.

[0076] In this specification, the term "transient transfection" refers to a method in which the nucleic acid introduced into the cell does not integrate into the cell's genomic or chromosomal DNA. It is actually maintained in the cell as an extrachromosomal element (e.g., as an episome). The transcription of the episome's nucleic acid is unaffected and, for example, produces proteins encoded by the episome's nucleic acid. Transient transfection produces "transiently transfected" cells.

[0077] In this specification, the terms "stable transformation" and "stable transfection" refer to the heritable and stable integration of exogenous nucleic acids into the host cell genome / chromosome. Stably transfected cells are obtained after a cell selection process under selective growth conditions (i.e., in the presence of one or more selection markers).

[0078] In this specification, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned relative to the coding sequence of a polynucleotide, such that the regulatory sequence directs the expression of the coding sequence. Exemplarily, the regulatory sequence may be selected from sequences encoded by promoters and / or enhancers, or from exogenous chemical reaction elements (XREs) and minimal promoters (minPs), but is not limited thereto.

[0079] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0080] The cell sensor provided by this invention is based on the aryl hydrocarbon receptor (AhR) signaling pathway. AhR is a major receptor for pollutants such as dioxins, polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and micro / nano particles. Furthermore, AhR regulates multiple pathways (such as ER, NF-κB, and Nrf2). In normal skin, the activation level of AhR should be maintained within a stable range. Abnormal AhR activation suggests the potential for chronic cumulative toxicity similar to the aforementioned pollutants, and may also affect pathways such as ER, NF-κB, and Nrf2 through the AhR pathway, thereby causing potential health problems such as endocrine disruption, irritation, and oxidative damage. The cell sensor constructed in this invention can sensitively and rapidly indicate the degree of AhR pathway activation by the analyte, and can be used for cosmetic screening to indicate potential risks such as sensitization, irritation, and endocrine disruption associated with cosmetics.

[0081] <First Aspect>

[0082] A first aspect of the present invention provides a cell sensor comprising skin cells, the skin cells comprising an exogenous chemical response element (XRE) and a reporter gene operably linked to a minimal promoter (minP).

[0083] In some embodiments, the reporter gene is expressed or activated when the AhR signaling pathway in the skin cells is activated, generating a detectable signal.

[0084] (skin cells)

[0085] In this specification, the term "skin cell" refers to epidermal cells, which are a layer of skin cells. The epidermal cells of the skin can be divided into five layers from the basal layer to the surface: the basal layer, the spinous layer, the granular layer, the stratum lucidum, and the stratum corneum. In some specific embodiments, the skin cells described in this invention include stratum corneum cells.

[0086] In some embodiments, the skin cells are derived from mammalian skin cells.

[0087] In some preferred embodiments, the skin cells are human, mouse, or monkey skin cells.

[0088] In some embodiments, the cells may be mammalian skin cells that stably or naturally express the aryl hydrocarbon receptor (AhR), wherein the reporter gene is expressed or activated when the AhR signaling pathway is activated, thereby generating a detectable signal.

[0089] In some embodiments, the skin cells may be epidermal cells, such as keratinocytes, such as immortalized cell lines HaCaT, PAM212, and A431.

[0090] In some embodiments, the skin cells may be dermal cells, such as fibroblasts, for example, the dermal fibroblast line HFF-1.

[0091] In some preferred embodiments, the skin cells are keratinocytes, such as keratinocyte lines.

[0092] In some further preferred embodiments, the skin cells comprise the immortalized keratinocyte line HaCaT.

[0093] (Exogenous chemical reaction elements)

[0094] In this specification, the AhR signaling pathway refers to the aryl hydrocarbon receptor signaling pathway, also known as the AhR pathway, ARNT / AhR / XRE, or AhR / XRE signaling pathway. Normally, AhR forms a complex in the cytoplasm with heat shock protein 90 (Hsp90), AIP (AHR Interacting Protein), and chaperone protein p23. In the presence of contaminants, AhR is activated and transported to the nucleus, where it binds to the aryl hydrocarbon receptor nuclear translocator (ARNT) to form a heterodimer. Once formed, the heterodimer binds to xenobiotic response elements (XREs) on DNA, activating XRE-controlled gene expression and further reflecting the degree of AhR pathway activation.

[0095] In some specific embodiments, in the cell sensor provided by the present invention, the reporter gene is expressed or activated when the AhR signaling pathway is activated.

[0096] In some embodiments, the exogenous chemical reaction element comprises a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:1.

[0097] SEQ ID NO:1:

[0098] CTGGCCGGTACCTGAGCTCTGAGTTCTCACGCTAGCAGATTGAGTTCTCACGCTAGCAGATTGAGTTCTCACGCTAGCAGATCTCGAGGATATCAAGAT

[0099] (Minimum starter)

[0100] In this specification, "Minimal Promoter (minP)" refers to a basic promoter that can only drive very weak (or even undetectable) gene transcription. It contains the core sequences (such as the TATA box) necessary for RNA polymerase to bind and initiate transcription.

[0101] In some specific embodiments, the minimum promoter comprises a nucleotide sequence as shown in SEQ ID NO:2, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:2.

[0102] SEQ ID NO:2:

[0103] TAGAGGGTATATAATGGAAGCTCGACTTCCAG

[0104] In some specific implementations, the exogenous chemical reaction element is located upstream of the minimum promoter.

[0105] In some specific implementations, the exogenous chemical reaction element and the minimal promoter are located upstream of the reporter gene.

[0106] In some specific implementations, when the AhR complex binds to the upstream XRE, it recruits other coactivators, greatly enhancing the activity of the minimal promoter and thus strongly initiating the transcription of downstream genes (such as reporter genes). This design minimizes background noise, resulting in a very high signal-to-background ratio.

[0107] (Reporter genes)

[0108] In some embodiments, the reporter gene may be a bioluminescent reporter gene or a fluorescent protein reporter gene.

[0109] In some embodiments, the bioluminescent reporter gene includes a nucleic acid molecule encoding luciferase.

[0110] This specification does not impose any particular restrictions on the source of luciferase, such as firefly luciferase or Renilla luciferase, but is not limited to these.

[0111] In some embodiments, the fluorescent protein reporter gene comprises a nucleic acid molecule encoding a fluorescent protein.

[0112] In some embodiments, the fluorescent protein may be green fluorescent protein or a derivative thereof, such as GFP (green), EGFP (enhanced green), YFP (yellow), CFP (cyan), etc.

[0113] In some embodiments, the fluorescent protein may be a red fluorescent protein or a derivative thereof, such as RFP (red), DsRed, mCherry, tdTomato, etc.

[0114] In some exemplary embodiments, the reporter gene is a luciferase reporter gene.

[0115] The luciferase reporter gene detection method selected in this invention has strong luminescence signal and rapid detection, making it suitable for high-throughput analysis. At the same time, its detection range can reach 7 orders of magnitude, making it suitable for detecting subtle expression differences, especially for detecting cosmetic sensitization.

[0116] In some preferred embodiments, the nucleic acid molecule encoding luciferase (luc2) comprises a nucleotide sequence as shown in SEQ ID NO:3, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:3.

[0117] SEQ ID NO:3:

[0118]

[0119] In some alternative implementations, the reporter gene may also include a PEST sequence.

[0120] In some specific implementations, the PEST sequence is derived from a human PEST sequence (i.e., a human-derived PEST sequence, or hPEST for short).

[0121] The hPEST used in this invention further promotes the response of reporter genes, such as luciferase.

[0122] In some preferred embodiments, the hPEST comprises a nucleotide sequence as shown in SEQ ID NO:4, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:4.

[0123] SEQ ID NO:4:

[0124] TTCTCACGGCTTCCCTCCCGAGGTGGAGGAGCAGGCCGCCGGCACCCTGCCCATGAGCTGCGCCCAGGAGAGCGGCATGGATAGACACCCTGCTGCTTGCGCCAGCGCCAGGATCAACGTCTAAGGCCGCGAC

[0125] In some embodiments, the reporter gene sequence includes a luciferase gene sequence, or a combination of a luciferase gene sequence (luc2) and an hPEST sequence (i.e., luc2P).

[0126] In some exemplary embodiments, the reporter gene sequence comprises a combination of a luciferase gene sequence (luc2) and an hPEST sequence (i.e., luc2P).

[0127] In some preferred embodiments, the reporter gene (luc2P) comprises a nucleotide sequence as shown in SEQ ID NO:5, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:5.

[0128] SEQ ID NO:5:

[0129]

[0130] In some exemplary embodiments, the luciferase reporter gene of the present invention characterizes the degree to which the analyte in a cell sensor activates the AhR pathway through biofluorescence signals.

[0131] In some implementations, the biofluorescence signal of the luciferase reporter gene can be detected using an enzyme-linked immunosorbent assay (ELISA) reader.

[0132] In some embodiments, the reporter gene, which is operatively linked to an exogenous chemical reaction element and a minimum promoter, is integrated into the genome of the skin cells.

[0133] In some preferred embodiments, the reporter gene, which is operatively linked to an exogenous chemical reaction element and a minimal promoter, is integrated into the genome of the skin cells via a DNA transposon system.

[0134] In some preferred embodiments, the DNA transposon system is the PiggyBac transposon system.

[0135] In this specification, the term "DNA transposon system" typically consists of two parts: a vector encoding a transposase gene and a substrate vector containing a target gene fragment. After the system is introduced into a cell, the encoded transposase cleaves the DNA fragment containing the target fragment from the vector, and then transposes it onto the genome. Transposon systems can be used to stably integrate foreign genes into the host cell genome.

[0136] In this specification, the term "PiggyBac transposon system" refers to a eukaryotic transposon derived from lepidopteran insects that moves through the genome via a "cut-and-paste" mechanism. Its core structure contains two inverted terminal repeat (ITR) sequences and an open reading frame (ORF) encoding a transposase, enabling specific integration at the TTAA site.

[0137] In some specific embodiments, the reporter gene operatively linked to the exogenous chemical reaction element and the minimum promoter comprises a nucleotide sequence as shown in SEQ ID NO:8, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO:8.

[0138] SEQ ID NO:8 (XRE-Minimal Promoter-luc2-hPEST):

[0139]

[0140] <Second aspect>

[0141] A second aspect of the present invention provides a method for constructing a cell sensor according to the first aspect of the present invention.

[0142] In some embodiments, the method includes the step of introducing a reporter gene operatively linked to an exogenous chemical reaction element (XRE) and a minimum promoter (minP) into skin cells.

[0143] In some embodiments, the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP) is introduced into skin cells via a vector carrying the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP).

[0144] In some embodiments, the vector also contains an resistance gene.

[0145] In some specific embodiments, the resistance gene is a puromycin resistance gene.

[0146] In some specific embodiments, the resistance gene comprises a nucleotide sequence as shown in SEQ ID NO: 6, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 6.

[0147] SEQ ID NO: 6:

[0148] Atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactacccggccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaa gaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggt tcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcg gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctcccctctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga

[0149] In some embodiments, the nucleotide sequence of the resistance gene and the reporter gene operably linked with the exogenous chemical response element (XRE) and the minimum promoter (minP) is as shown in SEQ ID NO: 7, or has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 7.

[0150] In some exemplary embodiments, the vector can be constructed by operatively linking coding sequences of exogenous chemical reaction elements, reporter genes, etc., using genetic engineering techniques.

[0151] In some optional embodiments, the vector of the present invention includes additional expression regulatory elements (e.g., promoters, terminators, enhancers, polyadenylated tails, etc.) and other regulatory elements (e.g., replication sites, selection marker genes, fluorescent tags, etc.).

[0152] In some exemplary embodiments, the vector of the present invention comprises a reporter gene and an resistance gene operatively linked to an exogenous chemical reaction element (XRE) and a minimum promoter (minP).

[0153] In this invention, there are no particular restrictions on the type of vector. Preferred vectors are those that can integrate genes into the genome, such as viral vectors (retroviruses / lentiviruses), DNA transposon systems, and artificial chromosomes, but are not limited to these.

[0154] In some preferred embodiments, the vector is a vector based on a DNA transposon system.

[0155] In some preferred embodiments, the vector is a vector for the PiggyBac transposon system.

[0156] The aforementioned carriers can be obtained commercially by those skilled in the art.

[0157] In some exemplary embodiments, the vector can use plasmid mapping such as... Figure 1B The carrier shown.

[0158] In some preferred embodiments, a nucleotide sequence as shown in SEQ ID NO: 7, or having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 7, can be operatively ligated to a plasmid map such as... Figure 1B In the vector shown (e.g., through the multiple cloning site (MCS) therein).

[0159] The present invention does not limit the method of introducing the reporter gene or vector operatively linked to the exogenous chemical reaction element (XRE) and the minimum promoter (minP) into skin cells.

[0160] In some implementations, the reporter gene or vector operatively linked to the exogenous chemical response element (XRE) and minimum promoter (minP) can be introduced into skin cells using methods such as electrostimulation, microinjection, liposome transfection, calcium phosphate coprecipitation, and virus-mediated transfection.

[0161] In some exemplary embodiments, the reporter gene or vector described above, which is operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP), can be introduced into skin cells using an electrical stimulation method.

[0162] In some embodiments, the construction method further includes the step of introducing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP) into skin cells, followed by screening of the cells to obtain skin cells containing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP).

[0163] In some preferred embodiments, the construction method further includes introducing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP) into skin cells, followed by screening of the cells to obtain stably transfected skin cells containing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP) (i.e., integrating the reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP) into the genome of the skin cells).

[0164] In some exemplary embodiments, the screening may employ antibiotic resistance screening of cells. It is understood that the antibiotic may be the antibiotic corresponding to the resistance gene mentioned above.

[0165] This invention utilizes a DNA transposon system for stable transfection, which can facilitate the long-term, stable integration and expression of exogenous genes in the host genome.

[0166] In some specific embodiments, the present invention involves co-transfection of a vector containing a transposase (e.g., PB210PA-1 plasmid) and a vector carrying the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP). The transposase integrates the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP) into the skin cell genome.

[0167] In some embodiments, the vector containing transposase and the vector carrying the reporter gene operatively linked to the exogenous chemical reaction element (XRE) and the minimum promoter (minP) are co-transfected, and the mass ratio of the two can be (1~5):(5~1). Preferably, the mass ratio of the plasmids can be (1~3):(3~1).

[0168] In some exemplary embodiments, the mass ratio of the vector containing transposase and the vector carrying the reporter gene operatively linked to the exogenous chemical reaction element (XRE) and the minimum promoter (minP) is 1:1.

[0169] In some embodiments, the total concentration of the transfection plasmid is between 5-50 μg / mL, preferably between 10-30 μg / mL, for example: 10 μg / mL, 15 μg / mL, 20 μg / mL, 25 μg / mL, 30 μg / mL, etc.

[0170] In some embodiments, the concentration of the transposase-containing vector (e.g., PB210PA-1 plasmid) of the present invention is between 2-25 μg / mL. Preferably, the concentration of the transposase-containing vector (e.g., PB210PA-1 plasmid) plasmid is between 5-20 μg / mL, for example: 5 μg / mL, 10 μg / mL, 15 μg / mL, 20 μg / mL, etc.

[0171] In some embodiments, the concentration of the vector transfection plasmid carrying the reporter gene operably linked to the exogenous chemical response element (XRE) and the minimum promoter (minP) is between 2 and 25 μg / mL. Preferably, the concentration of the vector transfection plasmid containing the reporter gene operably linked to the exogenous chemical response element (XRE) and the minimum promoter (minP) is between 5 and 20 μg / mL, for example: 5 μg / mL, 10 μg / mL, 15 μg / mL, 20 μg / mL, etc.

[0172] In some exemplary embodiments, the total concentration of the transfection plasmid is 20 μg / mL.

[0173] In some exemplary embodiments, the concentration of the transposase-containing vector (e.g., PB210PA-1 plasmid) of the present invention is 10 μg / mL; the concentration of the vector transfection plasmid carrying the reporter gene operatively linked to the exogenous chemical reaction element (XRE) and the minimum promoter (minP) is 10 μg / mL.

[0174] In some exemplary embodiments, the present invention uses cationic liposome transfection for transient transfection.

[0175] In some specific embodiments, the stable transfected cell lines prepared by the method of the present invention have a higher response to the test substance and more stable data, and their effect is better than that of transiently transfected cells.

[0176] In some specific embodiments, the stable transfected cell lines prepared by the method of the present invention at different generations showed no significant difference in their response to the test substance.

[0177] <Third aspect>

[0178] A third aspect of the present invention provides a detection method comprising a cell sensor constructed using the cell sensor described in the first aspect or the construction method described in the second aspect.

[0179] In some embodiments, the method further includes adding the test sample (prepared as a solution) to the culture medium of the cell sensor, co-incubating, and then detecting the expression or activity level of the reporter gene.

[0180] In some implementations, the co-incubation period is between 6 hours and 96 hours.

[0181] In some preferred embodiments, the co-incubation time is between 12 and 48 hours.

[0182] In some preferred embodiments, the co-incubation time is between 18 and 40 hours.

[0183] In some exemplary embodiments, the co-incubation time is between 20 and 30 hours, such as 20 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 28 hours, 30 hours, etc.

[0184] In some preferred embodiments, the co-incubation time is 24 hours.

[0185] In some exemplary embodiments, the ARH agonist is prepared into a gradient dilution solution and added to the culture medium of the cell sensor described in the first aspect of the present invention. After co-incubation for 24 hours, the expression or activity level of the XRE reporter gene is detected.

[0186] In some embodiments, the cell sensor described in this invention can be applied to high-throughput detection (such as 384-well or 96-well plates).

[0187] In some embodiments, the density of the cell sensor of the present invention can be 0.5 × 10⁻⁶. 5 Cells / mL ~5×10 5 Cells / mL.

[0188] In some specific embodiments, the density of the cell sensor described in this invention can be 1×10⁻⁶. 5 cells / mL, 2×10 5 cells / mL, 3×10 5 cells / mL, 4×10 5 Cells / mL.

[0189] In some preferred embodiments, the density of the cell sensor of the present invention can be 3 × 10⁻⁶. 5 Cells / mL.

[0190] In some specific implementations, the luciferase reporter gene exhibits the strongest biofluorescence signal after 24 hours of co-incubation, which is superior to that after 12 hours and 48 hours of co-incubation.

[0191] In some implementations, the biofluorescence signal of the luciferase reporter gene can be detected using an enzyme-linked immunosorbent assay (ELISA) reader.

[0192] <Fourth Aspect>

[0193] A fourth aspect of the present invention provides a cell sensor constructed according to the construction method of the first aspect or a cell sensor according to the second aspect for any of the following uses:

[0194] (1) Use in detecting the skin sensitization risk of the reagent or product;

[0195] (2) Uses in detecting pollutants;

[0196] (3) Use in screening AhR agonists or antagonists;

[0197] (4) Use in the preparation of diagnostic reagents and / or kits.

[0198] In some embodiments, the reagents or products used for detection are selected from cosmetics and / or cosmetic ingredients.

[0199] In this manual, the term "cosmetics" refers to any chemical industrial product or fine chemical product that is applied to any part of the human body surface, such as skin, hair, nails, lips, teeth, etc., by means of smearing, spraying or other similar methods, for the purpose of cleaning, maintaining, beautifying, modifying and altering appearance, or correcting body odor and maintaining a good condition.

[0200] In this manual, the term "cosmetic raw materials" refers to the raw materials used in the cosmetic manufacturing process, including cosmetic base raw materials such as oily raw materials, surfactants, solvents, powdery raw materials, polymers and other additives; cosmetic auxiliary raw materials such as fragrances, colorants, pearlescent agents, preservatives, bactericides, antioxidants and complexing agents; and special-purpose raw materials such as depilatory agents, hair dyes, perming agents, astringents, antiperspirants, deodorants, spot removers, sunscreens, etc.

[0201] In some embodiments, the detection reagents and / or kits further comprise cell culture reagents and / or reporter gene detection reagents.

[0202] In some specific embodiments, the aforementioned cosmetics and / or cosmetic ingredients are added to a cell sensor. By detecting the expression of luciferase in the cells, the AhR pathway is monitored to see if it is activated by skin sensitizers. This can then be used to assess whether the cosmetics and / or cosmetic ingredients have a potential risk of causing skin sensitization.

[0203] In some specific implementations, compared with the existing technology U-SENS TM Compared with other detection methods, the cell sensor constructed in this invention has higher sensitivity for screening sensitizing ingredients in cosmetics. Furthermore, it can effectively supplement existing standard detection methods for skin sensitization.

[0204] In some implementations, the contaminant to be detected is selected from at least one of environmental samples, food samples, or drug samples.

[0205] In some specific implementations, the contaminant to be detected is added to a cell sensor, and the expression of luciferase in the cells is detected to monitor whether the AhR pathway is activated by the contaminant, which can then be used to assess the potential risk of the contaminant to be detected.

[0206] In some specific embodiments, benzo[a]pyrene (BaP) environmental pollutants are added to the cell sensor, and the cell sensor prepared by the present invention has a significant response by detecting the expression of luciferase in the cells.

[0207] In some implementations, by adding an agonist or antagonist to a cell sensor, the activation or inhibition of the AhR pathway can be monitored by detecting the expression of luciferase in the cells, which can then be used to evaluate or screen agonists or antagonists targeting AhR.

[0208] In some implementations, the potential risk of the contaminant to be detected and / or the potential risk of skin sensitization of the reagent or product can be detected using the above-described detection reagents and / or kits.

[0209] Example

[0210] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0211] Example 1: Construction of pPB-XRE vector

[0212] 1. Obtain the target gene

[0213] Using the commercial plasmid pGL4.43[luc2P / XRE / Hygro] Vector (Promega E4121) as a template, the XRE-Minimal Promoter-luc2P-hPEST gene fragment was amplified using the primers (R-BamHI) described below. This fragment was then ligated with a purine resistance gene to construct the target gene, the sequence of which is as follows:

[0214] Target gene sequence (purine resistance gene + XRE-Minimal Promoter-luc2-hPEST gene fragment) (SEQ ID NO:7):

[0215]

[0216]

[0217]

[0218] (In this context, a single underline indicates a purine resistance gene; a wavy line indicates a minimal promoter gene; bold text indicates an XRE gene fragment; double underlines indicate the luc2 gene; and dotted underlines indicate hPEST.)

[0219] PCR amplification primer sequences (including restriction enzyme sites):

[0220] Forward primer (SEQ ID NO:9): F-BstBI 5'-CGTTCGAAATGACCGAGTACAAGCCCACGGTG-3'

[0221] Reverse primer (SEQ ID NO:10): R-BamHI 5'-CGCGGATCCGTCGCGGCCTTAGACGTTGATCCTG-3'

[0222] 2. PCR amplification of the target gene fragment

[0223] (1) The PCR reaction system is as follows:

[0224]

[0225] (2) The PCR reaction procedure is as follows:

[0226]

[0227] Configure the above PCR reaction system, set the PCR reaction program, and perform the reaction on a real-time quantitative PCR instrument.

[0228] 3. Enzyme digestion system

[0229] The PCR product obtained in step 2 above is: 2 μg; BstbI (10 U / μL): 1.5 μL; BamHI (10 U / μL): 1.5 μL; enzyme buffer 10× buffer (such as NE Buffer) TM 2.1): 5 μL; add ddH2O to 50 μL; place the prepared enzyme digestion system on a metal bath and react at 37°C for 3 h, then inactivate at 65°C for 20 min after the reaction; use NanoDrop to determine the DNA concentration, which is generally between 50-100 ng / µl; the purified DNA can be stored at 4°C for a short period and at -20°C for long-term storage.

[0230] 4. Obtain the linearized vector PB511B-1 by double enzyme digestion.

[0231] (1) Plasmid

[0232] PB511B-1 vector plasmid ( Figure 1A The EF1α-GFP-PuroP portion of the plasmid (as shown) has been deleted before use (the plasmid map after deletion is shown in the image). Figure 1B ), Figure 1B The restriction enzyme sites are BstbI and BamHI on the multiple cloning site.

[0233] (2) Enzyme digestion system

[0234] Plasmid PB511B-1: 2 μg; BstbI (10 U / μL): 1.5 μL; BamHI (10 U / μL): 1.5 μL; Enzyme buffer 10× buffer: 5 μL; ddH2O to bring the total to 50 μL.

[0235] (3) Enzyme digestion

[0236] The prepared enzyme digestion system was placed in a metal bath and reacted at 37°C for 3 hours to obtain a linear vector. After the reaction, the vector was inactivated at 65°C for 20 minutes, and then the DNA concentration was measured.

[0237] 5. Enzyme ligation to obtain the pPB-XRE vector

[0238] (1) Enzyme ligation system (μL)

[0239] The enzyme digestion fragments obtained in step 3 (i.e., the enzyme digestion fragments containing the target gene) are compared with the linearized vector obtained in step 4: 3 μL: 1 μL; T4 ligase (5 U / μL): 1 μL; 2× ligation buffer: 5 μL; ddH2O is added to make up to 20 μL.

[0240] (2) Enzyme ligation: Place the prepared enzyme ligation system on a metal bath at 16°C overnight.

[0241] 6. Agarose gel electrophoresis to verify the recombinant vector sequence

[0242] (1) Gel preparation

[0243] Weigh 1g of agarose and add it to 100mL of 1× TAE / TBE buffer. Heat to dissolve. After cooling the solution to 50-60 °C, add dyes such as EB / SYBR Safe and pour into an electrophoresis tank to solidify.

[0244] (2) Electrophoresis

[0245] Take 5-10 µL of enzyme ligation product, plasmid empty vector and 1 µL of 6× Loading Dye, mix well and load the sample, set the voltage to 120V and run for 20-30 min (adjust according to fragment size).

[0246] (3) Gel recovery

[0247] Observe the gel, cut out the target band, and avoid prolonged exposure of DNA to UV light; recover the DNA using a DNA purification kit (such as QIAquick Gel Extraction Kit), and determine the DNA concentration using NanoDrop (ideal concentration ≥50 ng / µL).

[0248] 7. pPB-XRE plasmid amplification

[0249] 10 μL of the enzyme-linked immunosorbent assay (ELISA) mixture was transformed into 100 μL of competent E. coli (DH5α) cells. Transformants were grown on LB agar plates containing Amp, and single clones were selected and preserved. Positive clones were selected using colony PCR and agarose gel electrophoresis, and the positive clones were sequenced for verification. The successfully verified pPB-XRE positive clones were preserved and plasmids were extracted.

[0250] Example 2: Culture of HaCaT-transfected human immortalized keratinocyte cell line

[0251] Preparation before the experiment: Turn on the UV sterilization lamp 30 minutes in advance to irradiate the biosafety cabinet, and at the same time, put the MEM complete culture medium (containing 10% FBS and 1% P / S) into a 37℃ water bath for preheating.

[0252] Experiment Preparation: Wash hands and arms with hand sanitizer, dry them, put on back gloves, and spray gloves with 75% medical alcohol. Turn off the UV lamp of the biosafety cabinet, turn on the fan and lighting switches on the control panel, raise the glass window of the biosafety cabinet to the designated safe height, spray alcohol onto the work surface, and wipe the work surface clean with tissue paper. Transfer the preheated experimental reagents and consumables used in this experiment into the biosafety cabinet.

[0253] 1. Cell thawing: Remove the cryovial containing the human immortalized keratinocyte cell line HaCaT from the liquid nitrogen storage container and place it in a 37°C water bath to thaw for 1-2 minutes until it is completely dissolved. During this process, shake the cryovial continuously to thaw the cells quickly.

[0254] After thawing, wipe the cryovials with an alcohol swab and then transfer them to the biosafety cabinet. Each cryovial contains 0.5 mL of cells and has a cell count of 1 × 10⁻⁶. 5 For each cell, use a 1mL pipette to transfer the cell suspension from the cryopreservation tube to a 10cm (diameter) cell culture dish. Then, use a 10mL pipette to transfer 10mL of cell culture medium into the culture dish. Gently shake the culture dish to mix the liquids, and label it (cell name, thawing time, operator's name) before placing it in an incubator for culture.

[0255] 24 hours after cell resuscitation, remove the culture dish, discard the culture medium, add 10 mL of fresh culture medium, and return it to the incubator for continued culture. (Check the cell condition during medium change to confirm whether the cells are adherent and whether they are contaminated).

[0256] 2. Cell passage

[0257] After 48 hours of cell resuscitation and culture, the cell density in the culture dish reaches 80-90%. At this point, the culture dish is removed and the cell state and density are observed under a microscope.

[0258] Transfer the culture dish to a biosafety cabinet to remove the culture medium. Using a 10 mL pipette, draw 10 mL of PBS and add it to the dish along the side wall. Cover the dish and gently shake it clockwise to wash the cells. Do not shake too vigorously to avoid spilling the liquid. Return the used pipette to its original packaging for reuse.

[0259] Remove the PBS from the culture dish, add 1 mL of trypsin solution using a 1 mL pipette, and gently shake the dish to ensure the trypsin covers the entire bottom. Then transfer the culture dish to a 37°C incubator and incubate for 5-7 minutes for cell digestion.

[0260] After the digestion time is up, remove the culture dish from the incubator, gently tap the bottom of the dish with your hand, and quickly move it to the microscope for observation. At this time, cells can be seen moving in sheets.

[0261] Quickly transfer the culture dish into the biosafety cabinet, add 5 mL of culture medium to the digested culture dish, gently pipette with a 1 mL pipette to disperse the cells into single cells, and then transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 3 min.

[0262] Discard the supernatant, add 10 mL of culture medium to resuspend the cells, and mix thoroughly. Take a new culture dish, add 8 mL of culture medium to the new culture dish, then add 2 mL of cell suspension to the new culture medium, and gently shake the culture dish to mix the cell suspension with the culture medium thoroughly, thus completing the cell passage.

[0263] Label the new culture dish lid with the cell name, culturer's name, number of passages, and passage ratio, and then transfer the culture dish into the incubator.

[0264] 3. Cell cryopreservation

[0265] Cell cryopreservation is performed after two passages of newly thawed cells. Each time a new cell line is opened, cryopreservation is required. The number of cryopreservations and the quantity depend on individual preservation needs. Usually, cells in one culture dish can preserve cells from four cryopreservation tubes.

[0266] Cell cryopreservation solution should be prepared fresh for each use. The formula is: serum and DMSO solution mixed in a 9:1 ratio. The total amount of cryopreservation solution depends on the number of cells to be cryopreserved at one time.

[0267] Cell collection: The method is the same as cell passage; please refer to the cell passage procedure. After digestion, add 5 mL of culture medium, pipette to mix the cells evenly, and then transfer the cell suspension to a 15 mL centrifuge tube.

[0268] Cell counting: Cell density and total cell count were calculated using a cell counter. The cell density should be between 1 and 1.2 × 10⁻⁶ cells / year for cryopreservation. 6 Cells per tube (if the density of frozen cells is too low, they will be difficult to survive during thawing), and the volume of the cryopreservation tube should be between 0.5-1 mL.

[0269] After counting, the cell suspension was centrifuged at room temperature for 3 minutes at 1000 rpm. After centrifugation, the centrifuge tube was removed, the supernatant was removed, and the cell pellet was retained.

[0270] Based on the technical results before centrifugation, add appropriate cryopreservation solution to resuspend the cells according to the number of cells to be cryopreserved. After repeatedly pipetting 8-10 times, dispense the cryopreservation solution into cryovials and mark the tubes with the following information: cryopreservation time, density, cell name, and operator's name.

[0271] Place the labeled cell cryovials into a programmed cooling box (cryopreservation box), store them in a -80°C freezer, and after 24 hours, transfer the cryovials from the -80°C freezer into a liquid nitrogen tank for long-term preservation.

[0272] Example 3: Construction of a human immortalized keratinocyte cell line transfected with HaCaT

[0273] 1. Construction of a stable HaCaT transfection cell line for immortalized human keratinocytes

[0274] 1.1. Electroporation (pPB-XRE+PB210PA-1)

[0275] The electroporation instrument used was a 4D-Nucleofector (Lonza). HaCaT cells in logarithmic growth phase (from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection) were harvested, trypsin-digested, and then resuspended and diluted in MEM complete medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. The cells were centrifuged at 1000 r / min, and the supernatant was discarded. The cells were resuspended in electroporation buffer, and plasmids were added to bring the cell count to 1.5 × 10⁶ cells / year. 6 The plasmid concentration was 20 μg / mL (plasmid ratio 1:1). The cells were gently mixed by pipetting, and 400 μL was added to an electroporation cuvette for electroporation.

[0276] pPB-XRE is a plasmid obtained in Example 1. Using PB210PA-1, the pPB-XRE plasmid was integrated into the cellular genomic DNA via the transposase expressed by PB210PA-1.

[0277] 1.2. Cell Culture and Screening

[0278] After electroporation, the cells were incubated at room temperature for 10 min. The cell suspension was then added to a 60 mm culture dish, along with 4 mL of MEM medium preheated to 37 °C with 10% fetal bovine serum. The cells were then cultured in a 37 °C, 5% CO2 incubator. 24 h after transfection, the original medium was discarded, and complete medium containing 3 μg / mL puromycin was added for cell death treatment. Cell status was observed, ensuring that all cells in the negative control group died. Subsequent passages and cryopreservation were then performed.

[0279] 1.3. Optimization of vaccination density

[0280] At the time of seeding, the cells were at a rate of 1×10⁻⁶. 4 2×10 4 3×10 4 4×10 4 One cell per well (corresponding to) Figure 11 1×10 5 -4×10 5 Cells were seeded at a rate of (cells / mL) and detected by single-luciferase reporter gene assay. Results are as follows: Figure 10 and Figure 11 As shown, with 3×10 4 When seeding cells / wells at different densities, 2,3,7,8-TCDD showed the strongest luciferase activation effect compared to the control group at different concentrations. Therefore, this invention used a concentration of 3 × 10⁻⁶ cells / wells. 4The cell count per well is used as the final seeding density.

[0281] 1.4. Optimization of drug dosing time

[0282] Cells were exposed to 2,3,7,8-TCDD standard curve solutions for 4 h, 8 h, 12 h, 24 h, and 48 h, respectively.

[0283] The results are as follows Figure 12 As shown, by reading the luminescence values ​​and plotting a standard curve, this invention found that the cells responded most strongly after 24 hours of exposure. Therefore, this invention defines 24 hours of exposure as the optimal incubation time.

[0284] 2. Instantaneous transfection and optimization:

[0285] Pre-optimized inoculation density: 2×10 4 One cell per well, without using Plus TM The reagents were: plasmid pGL4.43[luc2P / XRE / Hygro] Vector (Promega E4121) : pGL4.74 [hRluc / TK] Vector (Promega E6921) at a mass ratio of 10:1. The transfection time was 8 h and the drug administration time was 24 h.

[0286] 2.1 Optimization of inoculation density

[0287] At the time of seeding, the cells were at a rate of 1×10⁻⁶. 4 2×10 4 3×10 4 4×10 4 Cells were seeded at a specific number per well, and detection was performed using a dual-luciferase reporter gene assay (pGL4.43 [luc2P / XRE / Hygro] Vector as the reporter gene and pGL4.74 [hRluc / TK] Vector as the internal control gene). It was found that a optimal seeding density of 3 × 10⁻⁶ cells per well was achieved. 4 At the optimal cell / well seeding density, 2,3,7,8-TCDD showed the strongest luciferase activation effect compared to the control group; therefore, a density of 3 × 10⁶ cells / well was used. 4 The cell count per well is used as the final seeding density.

[0288] 2.2 Optimization of Transfection Reagents

[0289] The transient transfection method chosen was cationic liposome transfection, using Lipofectamine. TM LTX and Plus TM (Thermo Fisher, catalog number 15338100) Transfection was performed according to the kit's operating procedure, using Plus... TMThe reagent can enhance Lipofectamine TM Transfection performance of LTX reagent in HaCaT cells. When using the reagent, dispense 0 μL, 0.1 μL, 0.3 μL, and 0.5 μL of Plus solution, respectively. TM The reagent volume was added, and the results were detected by dual-luciferase reporter gene assay. It was found that 0.1 μL of Plus... TM When reagents were added to each well, 2,3,7,8-TCDD showed the strongest luciferase activation effect compared to the control group; therefore, 0.1 μL of Plus was used per well. TM The reagent volume is used as the final reagent dosage.

[0290] 2.3 Optimization of plasmid ratio

[0291] When adding plasmids, the mass ratios of pGL4.43[luc2P / XRE / Hygro] Vector (Promega E4121) and pGL4.74[hRluc / TK] Vector (Promega E6921) were 10:1, 50:3, and 50:1, respectively. Dual-luciferase reporter gene assays revealed that the 2,3,7,8-TCDD showed the strongest luciferase activation effect compared to the control group when added at a 10:1 ratio. Therefore, a 10:1 plasmid ratio was adopted as the final experimental ratio.

[0292] 2.4 Optimization of Transfection Time

[0293] The study involved transient transfection of cells with plasmids. Cells were treated for 4 h, 8 h, 12 h, 16 h, 20 h, and 24 h. By reading luminescence values ​​and plotting a standard curve, it was found that the cells responded most strongly after transient transfection for 12 h. Therefore, 12 h of transient transfection was determined to be the optimal transfection time.

[0294] Test Example 1: Biological Detection of Transfection Method

[0295] (I) Biological detection steps:

[0296] The bioassay procedure consists of three parts: cell seeding, cell drug administration, and instrumental detection, with a completion cycle of 48 hours. The cell culture passaging cycle, controlled by the number of passages, is also 48 hours. Therefore, cell culture and bioassay can be combined through the cell digestion step in cell passaging. The cell detection method is as follows:

[0297] 1. Seeding of stably transfected cells

[0298] During cell passage, digested cells were added to 10 mL of culture medium, and the cells were repeatedly pipetted to obtain a cell suspension. After cell counting, an appropriate amount of culture medium was added to adjust the cell suspension concentration to 3 × 10⁻⁶. 5At this cell density, cells / mL were inoculated.

[0299] Cells were seeded into 96-well transparent white plates. Since the plates needed to be cultured in an incubator for 48 hours, in order to eliminate the influence of the edge effect on the volume of the wells, 60 wells in the middle of the 96-well plate were selected for seeding, and the same volume of PBS was added around them.

[0300] The cell seeding density is 3 × 10⁻⁶ 5 Cells / mL, with a single-well seeding volume of 100 μL. Pour the cell suspension into the sample well and use a pipette to evenly seed the cell suspension into the 96-well plate. Add an equal volume of PBS around the seeded cells to ensure uniform humidity in the wells. Cap the 96-well plate and label the edge of the cap with the operator's name, date, and well number. After labeling, transfer the plate to an incubator for overnight incubation.

[0301] 2. Transient transfection cell seeding

[0302] (1) Optimization of the pre-transfection method: using 2×10 4 The cell / well ratio was used as the seeding density. The mass ratio of plasmid pGL4.43[luc2P / XRE / Hygro] Vector to pGL4.74[hRluc / TK] Vector was 10:1. The transfection was performed by cationic liposome transfection for 8 h, and the cells were drugged for 24 h.

[0303] (2) Optimized transfection method: using 3×10 4 The cell / well ratio was used as the seeding density. The plasmid pGL4.43 [luc2P / XRE / Hygro] and vector pGL4.74 [hRluc / TK] were used at a mass ratio of 10:1, with 0.1 μL of Plus per well. TM and Lipofectamine TM LTX was used for cationic liposome transfection, with transient transfection for 12 h and cell drug administration for 24 h.

[0304] 3. Cell-based drug delivery

[0305] Cells transiently transfected for 12 hours and stably transfected for 24 hours were removed from the incubator. The condition of cells in all wells was checked under a microscope, and any wells with abnormal cell conditions were recorded. The culture medium in each well was aspirated, and then the corresponding culture medium containing the drug was immediately added. After adding the entire plate, a figure-eight pattern was made four times to mix the cells. The plate was then incubated for 24 hours.

[0306] 3. On-machine testing

[0307] Remove the 96-well plate from the incubator, remove the liquid from the wells, and then add 100 μL / well PBS to wash the cells in the wells (shake the plate after adding the liquid). Remove the PBS from the wells and attach a white film to the bottom of the plate.

[0308] Add 100 mL of cell lysis buffer to the wells and place the bottom plate on a microplate mixer and shake for 20 min to allow the cells to fully lyse.

[0309] Within 20 minutes of cell lysis, preheat the microplate reader (Promega, GloMax Multi+) (including program setup, rinsing, and system activation). Then, place the bottom plate into the microplate reader, select a substrate injection volume of 50 μL / well, and measure luciferase activity, reading the RLU. After use, copy the data, clean the instrument, turn it off, and complete data processing.

[0310] (II) Experimental Results

[0311] Using the same agonist 2,3,7,8-TCDD (2,3,7,8-Tetrachlorodibenzo-p-dioxin at a concentration of 10... -4 Dissolved in DMSO at mol / L, 2,3,7,8-TCDD (selected from Wellington Pharmaceuticals, catalog number: DD 48D 0512) was used to stimulate the optimized transiently transfected HaCaT cells and the optimized stable HaCaT cell lines constructed in Example 3. Figure 3 The results showed that stable cells responded more strongly to 2,3,7,8-TCDD and the data were more stable.

[0312] Test Example 2: Bioassay of Cell Exposure Time

[0313] The stable cells constructed in Example 3 were exposed using a 2,3,7,8-TCDD standard curve solution. The testing method was the same as the bioassay procedure in Example 1. Cells were treated for 12, 24, and 48 hours after drug administration. By reading the luminescence values ​​and plotting the standard curve, this invention found that the cells responded most strongly after 24 hours of exposure (e.g., ...). Figure 2 (As shown). Therefore, the present invention defines 24 hours of drug exposure as the optimal time for drug administration.

[0314] Test Example 3: Stability Test of HaCaT Stable Cell Lines

[0315] To test the stability of the cell line, the response curves of standard substances to cells need to be continuously accumulated during the experiment. This invention first cultured the optimized stable cell line constructed in Example 3. From cell resuscitation onwards, cell seeding was performed at each passage, and cells were exposed using standard curve concentrations of 2,3,7,8-TCDD and FICZ (Wellington, 513CS6) (2,3,7,8-TCDD and FICZ dosage range: 10). -7 -10 -12 (mol / L), collect the response curves of the 6th and 16th generation cells to the standard substance, and perform the test as in the biological detection procedure of Test Example 1, and analyze them.

[0316] The study examined the cellular response to two typical agonists of the AhR pathway: 2,3,7,8-TCDD (a potent exogenous environmental toxin) and FICZ (an endogenous tryptophan metabolite). Figure 4 and Figure 5 The results showed that there was no significant difference in the response of cells to 2,3,7,8-TCDD and FICZ within 15 generations. The signal response values ​​generated by cells under stimulation with the same concentration of agonists did not change significantly, and there was little difference between different generations. Moreover, the dose-response curves of cells in each generation showed the same trend for the two agonists.

[0317] This indicates that the gene vector in the stable cell line of the present invention has been stably integrated into the cell genome and inherited, and the stable cell line obtained by the present invention has excellent passage stability, which can ensure consistent and reliable data in experiments at different times and in different batches, greatly enhancing its practical value in fields such as sensitization screening and environmental monitoring.

[0318] Application Example 1: Screening of Functional Serums

[0319] The AhR signaling pathway is closely related to skin barrier protection, immune response, and inflammatory response. Six commercially available functional serums were selected for testing using a stable cell line constructed in Example 2. The testing method was the same as the biological detection procedure in Example 1. Results were obtained at concentrations without cytotoxicity (no significant difference in CCK8 assay results). Figure 6 and Figure 7 As shown in the image.

[0320] The results showed that Figure 6 and Figure 7 Among the six types of functional essences, three have AhR activity, suggesting that these three types of cosmetics may have the risk of causing sensitization or chronic toxicity.

[0321] Comparative Example 1, U-SENS TM Methods for detecting skin sensitization

[0322] Skin sensitization test (U-SENS) was performed on three serums with AhR activity. TM (Law). U-SENS TM This method assesses the likelihood of a test substance inducing a skin allergic reaction by detecting changes in the expression of the surface marker CD86 on cultured human histiocytic lymphoma cells. Upon contact with the skin, dendritic cells differentiate and mature during migration to lymphatic organs, upregulating the expression of a series of surface molecules. Apinic acid (AA) at a concentration of 50 μg / L was used as a positive control, and lactic acid (LA) as a negative control.

[0323] In vitro culture of dendritic cells: Human histiocytic lymphoma cells were co-exposed to the test substance for 48 h. The cell surface molecule CD86 was stained with a fluorescent antibody dye and analyzed by flow cytometry to evaluate the sensitization potential of the test substance. At least two independent CD86 expression assays were performed for each test substance. For each test substance expression assay, if the CD86 SI was higher than 150% only at the highest non-cytotoxic concentration, it could not be determined in the first assay. For each expression assay, if the CD86 SI was lower than 150% at all non-cytotoxic concentrations and there were no interferences (solubility, color, cytotoxicity), the CD86 expression was considered negative; if the CD86 SI was higher than 150%, regardless of dose-response and / or interference, the CD86 expression was considered positive. If the CD86 expression results were consistent between two assays, the sensitization potential of the test substance could be determined; if the CD86 expression results were inconsistent between two assays, a third assay was required. If the first assay could not determine the sensitization potential, and the second and third assays were inconsistent, a fourth assay was required. The final prediction will be based on a combined assessment of the results of three or four separate runs.

[0324] Figure 8 Test results showed that SkinCeuticals serum with a high AhR effect was sensitizing, while no sensitizing effect was detected in Nivea serum and Theordinary serum.

[0325] To address the bottleneck in sensitization testing of high-concentration essence mixtures (typically >1 mg / ml), the U937 cells (suspension growth, sensitivity window <0.2 mg / ml) used in Comparative Example 1 are unsuitable due to insufficient tolerance. Furthermore, U-SENS... TMThe previous method also failed to show a sensitizing effect within its limited sensitivity window. However, the HaCaT stable cell line constructed in this invention can tolerate serum concentrations up to 10 mg / ml and effectively detect sensitizing signals under different concentration conditions. Therefore, the HaCaT stable cell line constructed in this invention significantly improves the reliability and applicability of sensitization detection. Compared with the results of Application Example 1, the HaCaT stable cell line constructed in this invention has higher sensitivity for screening sensitizing ingredients in cosmetics and can effectively supplement existing standard methods for detecting skin sensitization.

[0326] Comparative Example 2: Detection of the effects of the AHR pathway

[0327] The present invention also selects three other different types of skin cell lines: A431 (human epidermal cancer cells), HFF-1 (human skin fibroblasts), and U937 (human mononuclear cell line). The corresponding transient transfection cell lines of A431 (human epidermal cancer cells), HFF-1 (human skin fibroblasts), and U937 (human mononuclear cell line) are constructed using the transient transfection cell line construction method optimized in step 2 of test example 1. The HaCaT cell line, which was constructed after optimization in the aforementioned example 3, is also selected.

[0328] Compare the expression levels of AHR (aromatic hydrocarbon receptor) and its downstream target gene CYP1A1 in the above cell lines under ligand stimulation.

[0329] Figure 13 The results showed that although AHR expression was relatively high in HFF-1 cells, the expression level of its downstream CYP1A1 was significantly lower than that in HaCaT cells after ligand stimulation, suggesting a weaker AHR signaling pathway activation capacity. In contrast, HaCaT cells not only exhibited stable AHR expression but also showed a significant increase in CYP1A1 expression under stimulation conditions, demonstrating good AHR pathway responsiveness. U937 cells, derived from human histiocytic lymphoma and belonging to the immune system, have a significantly different physiological background from skin keratinocytes or fibroblasts and cannot simulate the local AHR microenvironment of the skin. A431 cells, being cancer cells, also cannot fully reflect the physiological state of normal skin cells.

[0330] Therefore, compared with other cell lines, the AHR-stable HaCaT cell line constructed in this invention has good application prospects and experimental stability as an in vitro model for screening AHR-activating or inhibiting active ingredients in cosmetics.

[0331] Application Example 2: Screening of Pollutants

[0332] Benzo[a]pyrene (BaP) is the most representative environmental pollutant among polycyclic aromatic hydrocarbons (PAHs). It is widely found in tobacco smoke, automobile exhaust, industrial waste gas, smoked and grilled foods, and fine particulate matter (PM2.5). It has clear toxicity, including carcinogenicity, teratogenicity, and mutagenicity. It is classified as a Group 1 human carcinogen by the International Agency for Research on Cancer (IARC). It can activate the aromatic hydrocarbon receptor (AhR) signaling pathway through direct skin contact, thereby causing multiple damages to skin health, such as inflammation, oxidative stress, and photoaging.

[0333] BaP standards were prepared into solutions of different concentrations, and the BaP detection response of the stable cell lines constructed in Example 2 to representative environmental pollutants was measured.

[0334] Figure 9 The results showed that the stable cell line constructed in Example 2 had a significant response to BaP, suggesting that this cell model is not only a powerful tool for laboratory research on the skin toxicology mechanism of AhR, but can also be extended to a multi-scenario platform for environmental health risk monitoring, cosmetic safety assessment, and public health early warning.

[0335] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.

[0336] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A cell sensor, characterized in that, The cell sensor comprises skin cells containing a reporter gene operatively linked to an exogenous chemical response element (XRE) and a minimum promoter (minP); The reporter gene is expressed or activated when the AhR signaling pathway in the skin cells is activated, generating a detectable signal.

2. The cell sensor according to claim 1, characterized in that, The skin cells are derived from mammalian skin cells; Preferably, the skin cells are human, mouse, or monkey skin cells. More preferably, the skin cells include keratinocytes. More preferably, the skin cells comprise the immortalized keratinocyte line HaCaT.

3. The cell sensor according to claim 1 or 2, characterized in that, The exogenous chemical reaction element comprises a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:

1.

4. The cell sensor according to any one of claims 1-3, characterized in that, The minimum promoter comprises a nucleotide sequence as shown in SEQ ID NO:2, or a nucleotide sequence that has at least 80% identity with the nucleotide sequence shown in SEQ ID NO:

2.

5. The cell sensor according to any one of claims 1-4, characterized in that, The reporter gene includes a nucleic acid molecule encoding a luciferase or a fluorescent protein.

6. The cell sensor according to any one of claims 1-5, characterized in that, The reporter gene, which is operatively linked to an exogenous chemical reaction element and a minimum promoter, is integrated into the genome of the skin cells; Preferably, the reporter gene, operatively linked to the exogenous chemical reaction element and the minimum promoter, is integrated into the genome of the skin cells via a DNA transposon system. More preferably, the DNA transposon system is the PiggyBac transposon system.

7. The method for constructing a cell sensor according to any one of claims 1-6, characterized in that, The method includes the step of introducing a reporter gene operatively linked to an exogenous chemical reaction element (XRE) and a minimum promoter (minP) into skin cells.

8. The construction method according to claim 7, characterized in that, The reporter gene, which is operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP), is introduced into skin cells via a vector carrying the reporter gene operatively linked to the exogenous chemical response element (XRE) and the minimum promoter (minP).

9. The construction method according to claim 8, characterized in that, The vector is based on the DNA transposon system. Preferably, the carrier is a carrier based on the PiggyBac transposon system.

10. The construction method according to any one of claims 7-9, characterized in that, The vector also contains a resistance gene; Optionally, the resistance gene comprises a nucleotide sequence as shown in SEQ ID NO:6, or a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in SEQ ID NO:

6.

11. The construction method according to any one of claims 7-10, characterized in that, The vector contains a nucleotide sequence as shown in SEQ ID NO:7, or a nucleotide sequence that has at least 80% identity with the nucleotide sequence shown in SEQ ID NO:

7.

12. A detection method, characterized in that, The method includes the step of detection using a cell sensor according to any one of claims 1-6 or a cell sensor constructed using the construction method according to any one of claims 7-11.

13. The detection method according to claim 12, characterized in that, The method further includes adding the sample to be tested into the cell sensor, incubating them together, and then detecting the expression or activity level of the reporter gene of the cell sensor.

14. The detection method according to claim 13, characterized in that, Incubation time ranges from 6 to 96 hours. Preferably, the incubation time is between 12 and 48 hours. More preferably, the incubation time is between 18 and 40 hours.

15. The cell sensor according to any one of claims 1-6 or the cell sensor constructed using the construction method according to any one of claims 7-11, for any of the following uses: (1) Use in detecting the skin sensitization risk of the reagent or product; (2) Uses in detecting pollutants; (3) Use in screening AhR agonists or antagonists; (4) Use in the preparation of test reagents or kits.

16. The use according to claim 15, characterized in that, The detection reagent or kit may also include cell culture reagents and / or reporter gene detection reagents.

17. The use according to claim 15, characterized in that, The reagents or products are selected from cosmetics and / or cosmetic ingredients.

18. The use according to claim 15, characterized in that, The contaminant is selected from at least one of the contaminants from environmental samples, food samples, drug samples, or cosmetics and / or cosmetic ingredients.

Images