Duck adenovirus B2 strain with genome large fragment deletion and application of duck adenovirus B2 strain

By isolating and constructing the duck adenovirus B2 strain DAdV-B2/ΔORF55-ORF19 with a large deletion in its genome, and inserting a foreign gene into its genome deletion region using the CRISPR/Cas9-HMEJ system, the problem of the lack of duck adenovirus B2 vaccine was solved, and a recombinant virus with stable expression of foreign gene was achieved, which promoted the research and development of waterfowl vaccines and the control of multiple pathogens.

CN121574944AActive Publication Date: 2026-02-27INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI

Patent Information

Application Number
CN202511733430.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-24
Publication Date
2026-02-27
Estimated Expiration
2045-11-24

AI Technical Summary

Technical Problem

The lack of safe and effective duck adenovirus B2 vaccines and drugs on the market has led to the continuous spread of the virus in duck flocks and the emergence of new variants. Furthermore, there is no research or application of existing technologies regarding duck adenovirus B2 genome-wide deletion strains.

Method used

Multiple prevalent DAdV-B2 strains were isolated and sequenced. A duck adenovirus B2 strain with a large genomic deletion, DAdV-B2/ΔORF55-ORF19, was discovered and preserved. Foreign genes were inserted into the deletion region of the strain using the CRISPR/Cas9-HMEJ system to construct recombinant viruses. Recombinant viruses were constructed by inserting foreign genes such as GFP and SBDSV VP3 using the CRISPR/Cas9 system combined with the HMEJ strategy.

Benefits of technology

A recombinant virus that stably expresses exogenous genes was successfully constructed, demonstrating efficient replication ability and genetic stability. This provides a research and development platform for duck adenovirus vector vaccines and promotes the progress of waterfowl disease control from single pathogens to multi-pathogen synergistic prevention and control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574944A_ABST
    Figure CN121574944A_ABST
Patent Text Reader

Abstract

The invention relates to a genome large fragment deleted duck adenovirus B2 strain and application thereof, the duck adenovirus B2 strain is duck adenovirus B2 DAdV-B2 / delta ORF55-ORF19, and is preserved in China Center for Type Culture Collection on September 26, 2025, and the preservation number is CCTCC NO: V202568. Compared with the duck adenovirus B2 strain BGMH, the duck adenovirus B2 strain has a deletion region between ORF20 and ORF53 genes, and the duck adenovirus B2 strain is deleted by 7422 bp. According to the invention, the duck adenovirus B2 strain with the genome deleted in large fragment is found for the first time, and the deletion region of the virus is a good site for inserting an exogenous gene, so that the duck adenovirus B2 DAdV-B2 / delta ORF55-ORF19 can be used as a good virus vector to construct a recombinant virus, and the constructed recombinant virus can be stably inherited; the method can be applied to waterfowl novel recombinant virus vector vaccine research and development, waterfowl basic scientific research, gene virus vector delivery and the like, and has wide application prospect and value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a duck adenovirus B2 strain with a large deletion in its genome and its applications. Background Technology

[0002] Duck aviadenovirus B2 (DAdV-B2) is a newly emerging pathogen that has become widespread in duck farms in my country in recent years. It primarily causes acute hepatitis in ducklings, characterized by pale, swollen, and hemorrhagic livers, commonly known as "white liver disease." This disease mainly affects Muscovy ducklings aged 10 to 40 days, resulting in a morbidity rate of 20%-50% and a mortality rate of 10%-50%, causing severe economic losses to the waterfowl farming industry. Duck aviadenovirus B includes two genotypes: DAdV-B1 (represented by the DAdV-2 GR strain isolated in France in the 1980s) and DAdV-B2 (represented by the DAdV-3 strain isolated in my country in recent years). DAdV-B2 is a member of the genus Avian adenovirus in the family Adenoviridae. Its genome is a linear double-stranded DNA, approximately 43 kb in length, encoding various structural proteins (such as hexagonal, pentaagonal basement, and spike proteins) and non-structural proteins. Currently, there is a lack of safe and effective commercial vaccines or specific drugs to control this disease, which has led to the continued spread of the virus among duck flocks and the emergence of new variants.

[0003] Adenoviruses, due to their advantages such as stable viral particles, high replication titers, well-defined host range, ease of gene manipulation, and large capacity for carrying exogenous genes, have become a highly valuable viral vector platform for gene therapy, vaccine development, and basic scientific research. In the human medical field, vaccines based on human adenovirus vectors (such as those against Ebola virus and SARS-CoV-2) have been successfully marketed, validating the maturity and effectiveness of this technology. In the veterinary field, significant progress has also been made in vaccine research using avian adenoviruses (such as FAdV-1, FAdV-4, and FAdV-9) as vectors. Studies have shown that the non-essential replication regions at both ends of the FAdV-4 genome (such as non-structural protein coding regions), the Fiber2 gene region, and large genomic deletion regions are ideal sites for exogenous gene insertion, which can be used to develop multivalent or combination vaccines. Furthermore, viruses with these large genomic deletion regions typically exhibit better genetic stability and higher safety due to the deletion of gene regions not essential for viral replication, making them ideal tools for constructing efficient viral vectors. However, research on duck adenovirus B2 of waterfowl origin is currently lacking. There are no reports in this field on duck adenovirus B2 strains with large deletions in the genome, let alone reports on the application of such strains.

[0004] Therefore, there is an urgent need in this field to obtain a duck adenovirus B2 with a large deletion in its genome, and to systematically modify the DAdV-B2 strain with a large deletion in its genome to construct a safe, efficient, and dedicated duck adenovirus vector platform suitable for the prevention and control of waterfowl diseases. This is of great significance for promoting the development of novel genetically engineered vaccines for important waterfowl diseases. Summary of the Invention

[0005] The purpose of this invention is to provide a duck adenovirus B2 strain with a large deletion in its genome and its applications.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] A duck adenovirus B2 strain with a large deletion in its genome, namely duck adenovirus B2DAdV-B2 / ΔORF55-ORF19, was deposited on September 26, 2025 at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:V202568, located at Wuhan University, Wuhan, China.

[0008] The inventors of this invention isolated and sequenced multiple prevalent DAdV-B2 strains, discovering genomic diversity, including ORF67 gene mutations, small genomic fragment insertions or deletions, and a particularly unique strain with a large fragment deletion. The cell-adapted strain after passage in MDEF cells was named duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, and deposited for future research.

[0009] Compared with the duck adenovirus B2 strains BGMH and CH-GD-12-2014 (GenBank accession numbers MN539540.1 and KR135164.1), the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 has a deletion region between the ORF20 and ORF53 genes. The deleted sequence is mainly in the ORF55 and ORF19 genes, and the deletion is 7422 bp.

[0010] The present invention also provides the application of the duck adenovirus B2 strain, wherein different exogenous genes (such as protective antigen gene fragments of different waterfowl viruses) are inserted into the gene deletion region of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 to construct corresponding recombinant viruses, wherein the gene deletion region of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 is located between the ORF20 and ORF53 genes.

[0011] In the aforementioned application, a recombinant virus was constructed using the CRISPR / Cas9 system combined with the homology-mediated end joining (HMEJ) strategy (CRISPR / Cas9-HMEJ). The construction method was as follows: an sgRNA targeting the ORF20-ORF53 genes was designed and cloned into the pX458 vector; using seamless cloning technology, the target exogenous gene was inserted into the pUC19 plasmid to construct an expression cassette donor plasmid expressing the exogenous gene, which contained left and right homologous arms (HAL and HAR) homologous to the target site and the sgRNA target sequence on both sides; after co-transfecting LMH cells with the sgRNA plasmid and the expression cassette donor plasmid, the cells were infected with duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, and the recombinant virus was obtained by fluorescence selection and plaque purification.

[0012] The application of the duck adenovirus B2 strain involves passage culture of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 to obtain an attenuated strain of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19. A stable gene deletion also exists in the attenuated strain between the ORF20 and ORF53 genes. Different exogenous genes (such as protective antigen gene fragments of different waterfowl viruses) are inserted into this gene deletion region of the attenuated strain to construct corresponding recombinant viruses, which are then used to prepare live vector vaccines. The gene deletion region is located between the ORF20 and ORF53 genes.

[0013] Compared with the prior art, the advantages of the present invention are as follows:

[0014] (1) This invention is the first to discover a duck adenovirus B2 strain with a large deletion in its genome. Sequencing revealed that compared with duck adenovirus B2 strains BGMH and CH-GD-12-2014 (GenBank accession numbers for the whole genome sequences are MN539540.1 and KR135164.1), this strain has a deletion of 7422 bp. The deleted sequences are mainly in the ORF55 and ORF19 genes, with the deletion region located between the ORF20 and ORF53 genes. This deletion region is a good site for inserting foreign genes, making duck adenovirus B2DAdV-B2 / ΔORF55-ORF19 a good viral vector for constructing recombinant viruses. The constructed recombinant viruses can be stably inherited and can be applied to the development of novel recombinant viral vector vaccines for waterfowl, basic scientific research in waterfowl, and gene viral vector delivery, etc., with broad application prospects and value.

[0015] (2) This invention successfully constructed recombinant viruses by precisely inserting green fluorescent protein (GFP) and the duck short-beaked dwarf syndrome virus VP3 gene (SBDSV VP3) into duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 virus and attenuated strain BG18cm20 using the CRISPR / Cas9-HMEJ system. These recombinant viruses replicated efficiently in vitro and stably expressed the exogenous gene, providing a powerful platform for the development of duck adenovirus vector vaccines. The obtained recombinant viruses, especially BG18cm20-SBDSV-VP3 expressing SBDSV VP3, demonstrated efficient replication ability, excellent genetic stability, and high-level expression of the exogenous protein. The VP3 protein expressed by BG18cm20-SBDSV-VP3 can self-assemble into virus-like particles (VLPs), demonstrating its potential as a bivalent vaccine against DAdV-B2 and SBDSV. Based on duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 and attenuated strain BG18cm20 duck adenovirus vector, future research can incorporate protective antigens of other important waterfowl viruses, such as the HA protein of avian influenza virus, the sigma C / B protein of duck reovirus, and the E protein of avian Tembusu virus, laying the foundation for the development of duck adenovirus vector vaccines and promoting the shift of waterfowl disease control from single pathogen to multi-pathogen synergistic prevention and control. Attached Figure Description

[0016] Figure 1 This is an identification diagram of the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain with a large deletion in its genome, as described in this invention. Figure 1 A: PCR identification results of DAdV-B2 strains with large genomic deletions; B: Sanger sequencing identification of DAdV-B2 strains with large genomic deletions.

[0017] Figure 2 This is a schematic diagram of the donor plasmid and targeting strategy for inserting the GFP reporter gene between the ORF20-ORF53 genes in the genome.

[0018] Figure 3 The recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP expresses GFP fluorescent protein on LMH cells.

[0019] Figure 4 The GFP gene was identified by PCR after continuous passage of the recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP.

[0020] Figure 5 The recombinant virus BG18cm20-GFP expresses GFP fluorescent protein on MDEF cells.

[0021] Figure 6 The GFP gene sequence was identified by PCR after continuous passage of the recombinant virus BG18cm20-GFP.

[0022] Figure 7 The recombinant virus BG18cm20-SBDSV-VP3 expresses the SBDSV VP3 antigen on MDEF cells.

[0023] Figure 8 The VP3 gene was inserted into the recombinant virus BG18cm20-SBDSV-VP3 after continuous passage and PCR identification.

[0024] Figure 9 This is an image of SBDSV virus-like particles formed by the VP3 protein expressed by recombinant BG18cm20-SBDSV-VP3. The red arrows indicate SBDSV virus-like particles, and the white arrows indicate duck adenovirus particles.

[0025] Figure 10 This is a large genomic deletion region between duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 and the BGMH strain gene sequence. The fluorescent text part is the 7422 bp gene sequence deletion of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19.

[0026] Figure 11 This is a comparison diagram of the deleted sequence region of the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain with that of the non-deleted strain. Detailed Implementation

[0027] The present invention will now be described in detail with reference to the accompanying drawings and embodiments:

[0028] 1. Materials and Methods 1.1 Cells and Viruses Leghorn Male Hepatoma cellline (LMH) was purchased from the American Test and Computation Center for Biological Standards (ATCC). Primary Muscovy duck embryo fibroblast cells (MDEF) were prepared from 11-day-old Muscovy duck embryos. Both LMH and MDEF cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. The duck adenovirus B2 strain BGMH was previously isolated and preserved by the corresponding laboratory at the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences (Chen S, Lin F, Jiang B, et al. Transbound Emerg Dis. 2022), and its complete genome sequence is available in GenBank under accession number MN539540.1. Duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 was isolated from Muscovy duck "white liver disease" samples from a Muscovy duck farm in Fujian. The cell-adapted strain, after passage in MDEF cells, was deposited at the China Center for Type Culture Collection on September 26, 2025 (accession number: CCTCC NO: V202568). BG18cm20 is an attenuated strain of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 after 120 passages in MDEF cells. The Short Beak and Dwarfism Syndrome Virus (SBDSV) M15 strain (GenBank accession number OR777281.1) was preserved by the corresponding laboratory at the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0029] 1.2 Isolation of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19

[0030] Pathological samples from clinically diagnosed duck adenovirus infections were collected, and multiple duck adenovirus B2 strains were isolated from these samples. The isolated strains were then sequenced using a viral whole-genome sequencing platform. Among these, a strain with a large deletion in the genome was discovered in Muscovy duck "white liver disease" samples from a Muscovy duck farm in Fujian Province through virus isolation and sequencing. After passage and adaptation in MDEF cells, a corresponding cell-adapted strain was obtained. This strain was deposited at the China Center for Type Culture Collection on September 26, 2025, with accession number CCTCC NO:V202568, and named Duck Adenovirus B2 DAdV-B2 / ΔORF55-ORF19. Virus isolation and MDEF cell passage adaptation are routine procedures in this field and will not be elaborated upon here. Sequencing revealed that this virus, compared to duck adenovirus B2 strains BGMH and CH-GD-12-2014 (GenBank accession numbers MN539540.1 and KR135164.1), has a deletion of 7422 bp. The deleted sequences are mainly in the ORF55 and ORF19 genes, with the deleted region located between the ORF20 and ORF53 genes, as shown in the attached figure. Figure 10 and Figure 11 As shown.

[0031] To identify the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain with a large deletion in its genome, the inventors conducted an identification of the DAdV-B2 genome-wide deletion strain (i.e., duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19), and the specific method is shown in 1.3.

[0032] 1.3 Identification of DAdV-B2 strains with large genomic deletions

[0033] Genomic DNA was extracted from duck adenovirus B2 strain BGMH (without large genomic deletions) and duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain using Novizan Virus DNA / RNA Extraction Kit 2.0 (catalog number: RM401-04). Identification primers ORF20-F and ORF53-R were designed at both ends of the deletion region of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19. Primer sequences are shown in Table 1. PCR amplification was performed on the extracted genomic DNA of duck adenovirus B2 strain BGMH and duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain using the identification primer pairs according to the Novizan 2 × Phanta Max Master Mix (Dye Plus) (catalog number: P525-01) PCR reagent instructions. The PCR amplification products of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain were recovered by gel excision, and the cloning vector was ligated using a 5 min TA / Blunt-Zero Cloning Kit (Catalog No.: C601-01) from Novizan. The samples were then sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing to identify large deletion regions in the genome of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain.

[0034] Duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 has a large deletion region between the ORF20 and ORF53 genes, which allows for the insertion of foreign genes into this deletion region to construct recombinant viruses and develop viral vectors for expressing foreign genes.

[0035] 1.4 Constructing Recombinant Viruses

[0036] 1.4.1 Construction of sgRNA plasmid and donor plasmid

[0037] sgRNA plasmid construction: sgRNA targeting the ORF20-ORF53 intergenic region of the large deletion region in the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain genome was designed using the guide RNA online design tool (https: / / chopchop.cbu.uib.no / ). sgRNA cloning primers containing BbsI restriction enzyme sites were designed and synthesized (primer sequences are shown in Table 1). After annealing the primers, the sgRNA was ligated into the BbsI-digested CRISPR / Cas9 vector pX458 using T4 DNA ligase to construct the pX458-sgRNA plasmid.

[0038] Construction of donor plasmid pUC19-sgRNA-GFP: The pUC19 plasmid was double-digested with EcoRI and HindIII restriction endonucleases, and the linearized plasmid fragments were recovered by gel digestion. Using primer pairs HAL-F / HAL-R and HAR-F / HAR-R (primer sequences are shown in Table 1), the left and right homologous arms (approximately 1000 bp each) were amplified by PCR using genomic DNA of the DAdV-B2 / ΔORF55-ORF19 strain as a template, and the DNA fragments were recovered by gel digestion. The GFP expression cassette (CMV-GFP-SV40 poly(A)) was amplified from pEGFP-N1 using primers CMV-GFP-F / CMV-GFP-R (primer sequences are shown in Table 1), and the DNA fragments were recovered by gel digestion. The pUC19-sgRNA-GFP donor plasmid was constructed by homologous recombination of left and right homologous arm DNA, GFP expression cassette DNA and pUC19 digested with EcoRI and HindIII using the ClonExpress Ultra One Step Cloning Kit V3 Seamless Cloning Kit (Catalog No.: C117-01) from Novizan.

[0039] Construction of donor plasmid pUC19-sgRNA-SBDSV-VP3: pUC19-sgRNA-GFP was double-digested with SalI and NotI to remove the GFP sequence. The VP3 sequence was amplified from the genomic DNA of SBDSV M15 strain using primers VP3-F / VP3-R (primer sequences are shown in Table 1), and then inserted into the digested plasmid through seamless cloning to obtain the pUC19-sgRNA-SBDSV-VP3 donor plasmid.

[0040] Table 1. Primer sequences for identifying large genomic fragment deletions, sgRNA cloning, donor plasmid construction, and VP3 identification.

[0041] Primer name Primer sequences (5'–3') ORF20-F TGCTGATTGGTAAGTGTTAGG ORF53-R AGTACAGCACCATCTAGTGG sgRNA-F CACCGACTGCTCCAGAGACTGATGA sgRNA-R AAACTCATCAGTCTCTGGAGCAGTC HAL-F TTGTAAAACGACGGCCAGTGGCCATCATCAGTCTCTGGAGCAGTACAGCTCCTCGTGGC HAL-R TTACCGTAAGTTATGTAAACGTGATGATGGCTGCTTTAATT CMV-GFP-F AATTAAAGCAGCCATCATCACGTTACATAACTTACGGTAA CMV-GFP-R CACAGGTACTGCTCCAGAGACTAAGATACATTGATGAGTTTGG HAR-F CCAAACTCATCAATGTATCTTAGTCTCTGGAGCAGTACCTGTG HAR-R TATGACCATGATTACGCCAGCCATCATCAGTCTCTGGAGCAGTAAAGGCTCCATTGGTG VP3-F CTCAAGCTTCGAATTCTGCAGGCCACCATGGCAGAGGGAGGAGGC VP3-R CTGATTATGATCTAGAGTCGCGTTACAGATTTTGAGTTAG qVP3-F GAGGTAGACAGCAACAGAAA qVP3-R GCTCGTCCGTGACCATA

[0042] 1.4.2 Construction and purification of recombinant viruses

[0043] 1.4.2.1 Construction and purification of recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP

[0044] LMH cells were seeded in 12-well cell culture plates and transfected the next day when the cells reached approximately 80% confluence. Following the instructions of the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific), 1 μg of sgRNA plasmid pX458-sgRNA and 1 μg of donor plasmid pUC19-sgRNA-GFP were co-transfected into LMH cells. Eight hours post-transfection, the cell culture medium was replaced with DMEM containing 2% fetal bovine serum, followed by infection with duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain at an MOI of 0.01. A second transfection was performed 24 hours post-infection. Seventy-two hours post-infection, the cell culture plates were placed at -80°C and subjected to three freeze-thaw cycles. The supernatant was collected by centrifugation, yielding the viral fluid, which contained recombinant virus and the parental strain.

[0045] To purify the recombinant virus expressing green fluorescent protein (GFP), the virus mixture in the supernatant was serially diluted 10-fold (10... -1 Up to 10 -7 Virus dilution 10 -3 Up to 10 -7 Two 96-well cell culture plates containing approximately 80% LMH cell confluence were seeded with 100 μL / well. After the virus adsorbed for 2 hours in a 37°C cell culture incubator, the cells were gently washed three times with PBS, and then covered with pre-warmed (40–50°C) DMEM maintenance medium (supplemented with 1% fetal bovine serum and 1% low-melting-point agarose). The medium solidified at room temperature for approximately 30 minutes, and the plates were inverted and cultured in a 37°C, 5% CO2 cell culture incubator for 4 days. To observe viral plaques, a second covering was performed with DMEM maintenance medium containing 0.005% neutral red, and the plates were inverted and cultured for another 24–48 hours for further observation of viral plaques. GFP fluorescent viral plaques in the 96-well plates were observed using a fluorescence microscope. GFP fluorescent monoclonal viral plaques were selected, and after three rounds of viral plaque purification, the recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP was obtained.

[0046] Referring to the method described in 1.4.2.1, other exogenous genes (such as the VP3 gene of SBDSV or genes from other avian viruses) can be inserted into the deletion region of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 for the construction of corresponding recombinant viruses. For example, the construction of the recombinant virus DAdV-B2 / ΔORF55-ORF19 / SBDSV-VP3 is roughly as follows: sgRNA plasmid pX458-sgRNA and donor plasmid pUC19-sgRNA-SBDSV-VP3 are co-transfected into LMH cells to infect the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain. The supernatant is collected by centrifugation, and the viral fluid contains both the recombinant virus and the parental strain. After purification and verification, the recombinant virus DAdV-B2 / ΔORF55-ORF19 / SBDSV-VP3 is obtained. During purification and verification, the primers used are specific primers corresponding to the exogenous gene.

[0047] The recombinant virus constructed using the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 obtained in this invention as a vector for exogenous genes can be used to prepare recombinant multivalent vaccines.

[0048] 1.4.2.2 Passage attenuation and identification of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain

[0049] To better utilize the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain with large genomic fragment deletions in novel viral vector vaccines for waterfowl, this invention attenuated the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain through continuous passage on MDEF, naming the strain after 120 passages BG18cm20. Infecting 3-day-old Muscovy ducks with BG18cm20 showed no significant pathogenicity within 21 days of infection observation. However, infection with the virulent strain (duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19) showed significant pathogenicity, exhibiting typical duck adenovirus infection characteristics such as lethargy, pale and hemorrhagic liver upon necropsy, splenomegaly, and renal hemorrhage. This indicates that the passaged strain BG18cm20 was completely attenuated and has good safety. The BG18cm20 strain was amplified by PCR and sequenced using primers ORF20-F and ORF53-R. The sequencing results were consistent with the original genome large-fragment deletion strain duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, which also had a 7422 bp deletion between the ORF20 and ORF53 genes, as well as deletions of the ORF55 and ORF19 genes. Stable deletions were found in this region in both attenuated and virulent strains.

[0050] 1.4.2.3 Construction and purification of recombinant virus BG18cm20-GFP

[0051] Following the method described in 1.4.2.1, sgRNA plasmid pX458-sgRNA and donor plasmid pUC19-sgRNA-GFP were co-transfected into LMH cells, which were then infected with duck adenovirus B2 attenuated strain BG18cm20. Viral fluid containing recombinant virus and parental strain was collected, and recombinant virus with GFP fluorescence was purified using limiting dilution and viral plaque purification. After three rounds of viral plaque purification, recombinant virus BG18cm20-GFP was obtained.

[0052] 1.4.2.4 Construction and purification of recombinant virus BG18cm20-SBDSV-VP3:

[0053] Following the method described in 1.4.2.1, sgRNA plasmid pX458-sgRNA and donor plasmid pUC19-sgRNA-SBDSV-VP3 were co-transfected into LMH cells, which were then infected with duck adenovirus B2 attenuated strain BG18cm20. Virus fluid containing both recombinant virus and parental strain was collected. The supernatant virus mixture was serially diluted 10-fold (10... -1 Up to 10 -7 The cells were seeded onto LMH cells in 96-well plates. Seven days post-infection, the cell culture supernatant at the highest dilution showing cytopathic effects was collected. Viral DNA in the supernatant was detected by real-time PCR using VP3-specific primers (qVP3-F / qVP3-R, primer sequences shown in Table 1) and the ChamQ Universal SYBR qPCR MasterMix kit from Novizan. The supernatant from wells with high Cq values ​​was selected for viral plaque purification and qPCR verification. After three rounds of viral plaque purification, recombinant virus BG18cm20-SBDSV-VP3 was obtained.

[0054] 1.4.3 Identification of GFP Fluorescent Protein Expression by Recombinant Virus LMH cells were seeded in 12-well cell culture plates. Viral infection was performed the day after infection when cell confluence reached approximately 80%. The cell culture medium was discarded using a pipette, and the cells were gently washed once with PBS. LMH cells were infected with the recombinant strain DAdV-B2 / ΔORF55-ORF19-GFP and the original strain DAdV-B2 / ΔORF55-ORF19 (i.e., duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19) at an MOI of 1. Uninfected cells were used as a negative control. Two hours after virus adsorption, the virus solution was discarded, the cells were gently washed once with PBS, and DMEM medium containing 2% fetal bovine serum was added for further culture. Forty-eight hours post-infection, the expression of GFP fluorescent protein in the recombinant strain was observed using a fluorescence microscope.

[0055] We used a similar method to identify the expression of GFP protein in recombinant virus BG18cm20-GFP on MDEF cells.

[0056] 1.4.4 Indirect immunofluorescence assay to identify VP3 protein expression in recombinant virus BG18cm20-SBDSV-VP3

[0057] To determine whether the recombinant virus BG18cm20-SBDSV-VP3 could express the functional SBDSV VP3 protein, MDEF cells were infected with BG18cm20-SBDSV-VP3 or the control virus BG18cm20 at an MOI of 0.5, with uninfected cells used as a negative control. Forty-eight hours post-infection, cells were fixed with pre-chilled 100% methanol, permeabilized with 0.2% Triton X-100, blocked with 1% BSA, and then incubated with mouse anti-SBDSV VP3 monoclonal antibody, followed by incubation with FITC-labeled goat anti-mouse IgG (H+L) secondary antibody (showing green fluorescence). VP3 protein expression was observed and identified under a fluorescence microscope.

[0058] 1.4.5 Genetic stability of the recombinant viral inserted gene: The recombinant viruses DADV-B2 / ΔORF55-ORF19-GFP, BG18cm20-GFP, or BG18cm20-SBDSV-VP3 were passaged continuously in MDEF cells for 15 generations. Viral genomic DNA was extracted from the fifth generation (P5), P10, and P15 of the passaged recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP, as well as from the original strain DAdV-B2 / ΔORF55-ORF19 (duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19) using the Virus DNA / RNA Extraction Kit 2.0 (catalog number: RM401-04) from Novizan. The extracted viral genomic DNA was amplified by PCR using identification primers (ORF20-F and ORF53-R, primer sequences are shown in Table 1) according to the Novizan 2 × Phanta Max Master Mix (Dye Plus) (catalog number: P525-01) PCR reagent instructions. The genetic stability of the inserted gene fragment was then assessed by gel electrophoresis. The genetic stability of the 5th generation (P5), P10, and P15 of the recombinant viruses BG18cm20-GFP and BG18cm20-SBDSV-VP3 with viral insertion of GFP and VP3 expression cassettes was determined using the same method.

[0059] 2 Results

[0060] 2.1 Identification of DAdV-B2 strains with large genomic deletions

[0061] PCR identification results showed that duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 had the expected 436bp band, while the BGMH strain had a complete 7858bp band. Figure 1 A), further sequencing analysis of the PCR product of the deleted strain (duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19) showed that a large deletion did indeed exist between the ORF20 and ORF53 genes. Figure 1 B), the results showed that the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain had a 7422 bp deletion between the ORF20 and ORF53 genes, and the ORF55 and ORF19 genes were also deleted.

[0062] 2.2 Construction strategy of recombinant viruses

[0063] Such large-fragment deletion strains typically exhibit better genetic stability and higher safety due to the deletion of gene regions not essential for viral replication, making them ideal tools for constructing efficient viral vectors. To develop this deletion strain, duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, into a viral vector for exogenous gene expression, the inventors selected a large-fragment deletion region in the genome of this deletion strain, located between the ORF20 and ORF53 genes, as a potential insertion site for exogenous genes. Figure 2 The inventors used the CRISPR / Cas9 system combined with a homology-mediated end joining (HMEJ) strategy (CRISPR / Cas9-HMEJ) to insert the reporter gene GFP expression cassette into the DAdV-B2 / ΔORF55-ORF19 genome. Figure 2 ). Designed sgRNA targeting the ORF20-ORF53 genes and cloned it into the pX458 vector. A donor plasmid containing a GFP expression cassette was constructed using seamless cloning technology, flanking the cassette with left and right homologous arms (HAL and HAR) identical to the target site, and the sgRNA target sequence (…). Figure 2 LMH cells were co-transfected with sgRNA plasmid and donor plasmid, infected with duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, and a GFP reporter gene was inserted using the CRISPR / Cas9 system combined with the HMEJ strategy. The recombinant virus DAdV-B2 / ΔORF55-ORF19 was obtained through fluorescent selection and plaque purification. A schematic diagram of the recombinant virus construction strategy is shown below. Figure 2 As shown.

[0064] 2.3 Identification of GFP fluorescent protein expressed by recombinant virus

[0065] To identify the expression of GFP fluorescent protein by the recombinant virus, LMH cells were infected with the recombinant strain DAdV-B2 / ΔORF55-ORF19-GFP and the original strain duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, respectively. Forty-eight hours post-infection, the expression of GFP fluorescent protein by the recombinant strain was observed using a fluorescence microscope. The results are as follows: Figure 3 As shown, the recombinant strain DAdV-B2 / ΔORF55-ORF19-GFP expressed GFP green fluorescent protein after infecting LMH cells, while the original strain duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 did not show GFP fluorescence in infected cells or in control cells. The results indicate that the recombinant virus expressing the GFP gene was efficiently constructed using the CRISPR / Cas9-HMEJ system, and the deletion site (ORF20-ORF53 intergenic region) of the large-fragment deletion strain DAdV-B2 duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 can be used as an effective insertion site for exogenous gene expression.

[0066] 2.4 Genetic stability of the recombinant viral DAdV-B2 / ΔORF55-ORF19-GFP insertion gene

[0067] To assess the genetic stability of the exogenous GFP expression cassette inserted into the recombinant virus DAdV-B2 / ΔORF55-ORF19-GFP, the recombinant virus was passaged sequentially in MDEF cells. Genomic DNA was extracted from the recombinant virus at passages 5 (P5), 10 (P10), and 15 (P15), as well as from the original strain DAdV-B2 / ΔORF55-ORF19, and PCR amplification was performed using primers ORF20-F and ORF53-R flanking the inserted gene. The results are as follows: Figure 4As shown, a distinct 2018 bp band was observed in all passages (P5, P10, and P15) of DAdV-B2 / ΔORF55-ORF19-GFP, while the original strain produced the expected 436 bp fragment. This size difference confirms the precise integration of the inserted exogenous gene GFP expression cassette into the intergenic locus of ORF20-ORF53 in the DAdV-B2 / ΔORF55-ORF19 genome, and the GFP expression cassette inserted in the recombinant strain remained stably inherited during 15 consecutive passages in vitro. In summary, these results indicate that the deletion site (between ORF20 and ORF53) of the duck adenovirus B2 genome-wide deletion strain, duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, is an excellent site for inserting and expressing exogenous genes. The strategy of constructing recombinant viruses by inserting exogenous genes into the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 strain using the CRISPR / Cas9 system combined with the HMEJ method is efficient and precise. The duck adenovirus B2 genome-wide deletion strain, duck adenovirus B2DAdV-B2 / ΔORF55-ORF19, is an excellent viral vector. The constructed recombinant virus can be stably inherited and can be applied to the development of novel recombinant viral vector vaccines for waterfowl, basic scientific research in waterfowl, and gene-virus vector delivery, showing broad application prospects and value.

[0068] 2.5 Construction and GFP Expression Identification of Recombinant Virus BG18cm20-GFP

[0069] To determine whether the attenuated strain BG18cm20 of the large-fragment deletion duck adenovirus B2DAdV-B2 / ΔORF55-ORF19 could also insert and express a foreign gene, the inventors used the passaged attenuated strain BG18cm20 of the large-fragment deletion duck adenovirus B2DAdV-B2 / ΔORF55-ORF19 as a backbone and inserted a GFP gene expression cassette between the ORF20-ORF53 genes using a similar recombinant virus construction strategy to construct the recombinant virus BG18cm20-GFP. To verify the expression of GFP fluorescent protein by the recombinant virus, MDEF cells were infected with BG18cm20-GFP, and the results were observed under a fluorescence microscope. As shown in Figure 5, BG18cm20-GFP successfully expressed GFP fluorescent protein in infected MDEF cells.

[0070] 2.6 Genetic stability of recombinant virus BG18cm20-GFP inserted into the GFP gene

[0071] To assess the genetic stability of the GFP expression cassette inserted into the recombinant virus BG18cm20-GFP, the recombinant virus was continuously passaged in MDEF cells. PCR amplification using ORF20-F and ORF53-R primers was performed to detect the inserted GFP expression cassette sequence in different passages. The results are as follows: Figure 6 As shown, a clear 2018 bp band was observed in all passages (P5, P10, and P15) of BG18cm20-GFP, while a 436 bp band was detected in the parental strain BG18cm20. These results indicate that the inserted GFP expression cassette remained stably integrated during 15 consecutive passages.

[0072] 2.7 Construction and VP3 expression identification of recombinant virus BG18cm20-SBDSV-VP3

[0073] The previous results confirmed that the deletion region (between the ORF20 and ORF53 genes) of the large-fragment deletion strain duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 can effectively insert and express the exogenous reporter gene GFP, and can be stably inherited. This prompted the inventors to investigate whether this platform could be used as a vaccine vector to express protective antigens of other viruses. Using the passaged attenuated strain BG18cm20 of the large-fragment deletion strain duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 as a backbone, the inventors used a similar recombinant virus construction strategy to insert the duck short-beaked dwarf syndrome virus (SBDSV) VP3 gene expression cassette between the ORF20 and ORF53 genes to construct the recombinant virus BG18cm20-SBDSV-VP3.

[0074] To verify that the recombinant virus BG18cm20-SBDSV-VP3 expresses functional VP3 protein, MDEF cells were infected with BG18cm20-SBDSV-VP3, and the expression was detected using the SBDSV VP3-specific monoclonal antibody E16 48 hours post-infection. Results are as follows: Figure 7 As shown, BG18cm20-SBDSV-VP3 successfully expressed the VP3 antigen in infected MDEF cells, indicating that we successfully constructed the recombinant virus BG18cm20-SBDSV-VP3 expressing the SBDSV VP3 antigen, verifying that the duck adenovirus B2 genome large fragment deletion strain can be used as a vaccine vector for expressing exogenous protective antigens.

[0075] 2.8 Genetic stability of recombinant virus BG18cm20-SBDSV-VP3 inserted into the VP3 gene

[0076] To assess the genetic stability of the VP3 expression cassette inserted into the recombinant virus BG18cm20-SBDSV-VP3, the recombinant virus was passaged sequentially in MDEF cells. Genomic DNA was extracted from the 5th (P5), 10th (P10), and 15th (P15) generations of the recombinant virus BG18cm20-SBDSV-VP3, as well as from the parental strain BG18cm20. PCR amplification was performed using ORF20-F and ORF53-R primers. The results are shown below. Figure 8 As shown, a clear 2864 bp band was observed in all passages (P5, P10, and P15) of BG18cm20-SBDSV-VP3, while a 436 bp band was detected in the parental strain BG18cm20. These results indicate that the inserted VP3 expression cassette remained stably integrated throughout 15 consecutive passages.

[0077] As shown in section 1.4.2.2, pathogenicity assessment confirmed that BG18cm20 is non-pathogenic to Muscovy ducklings, verifying its safety as a viral vector backbone. Using CRISPR / Cas9-assisted homology-mediated end joining (HMEJ) technology, the GFP reporter gene or the SBDSV VP3 gene was inserted into the genomic locus (ORF20-ORF53) of BG18cm20, successfully constructing recombinant viruses BG18cm20-GFP and BG18cm20-SBDSV-VP3. In vitro characterization analysis showed that the recombinant virus could replicate effectively and maintained stable expression of the inserted gene throughout 15 consecutive passages. Notably, transmission electron microscopy observation showed (e.g.) Figure 9 As shown in the figure, the VP3 protein expressed by BG18cm20-SBDSV-VP3 can self-assemble into SBDSV virus-like particles, which is a key feature for inducing protective immunity against SBDSV and demonstrates its potential as a bivalent vaccine against DAdV-B2 and SBDSV.

[0078] The method for analyzing BG18cm20-SBDSV-VP3 viral particles using transmission electron microscopy (TEM) was as follows: MDEF cells were infected with BG18cm20-SBDSV-VP3 at an MOI of 1. 72 hours post-infection, cells were lysed through three freeze-thaw cycles, and the supernatant was collected by centrifugation. Viral particles were concentrated and purified using PEG precipitation and analyzed by TEM. Figure 9 The white arrows indicate BG18cm20-SBDSV-VP3 viral particles, and the red arrows indicate SBDSV VLPs that are self-assembled from SBDSV VP3. Scale bar = 100 nm.

[0079] Additionally, it should be noted that the GFP reporter gene and SBDSV VP3 gene described above are only partial examples of expressing exogenous genes. Other exogenous genes, such as those of some common waterfowl viruses, can be inserted into the deletion region (between the ORF20 and ORF53 genes) of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 virus or its attenuated strain BG18cm20 to obtain corresponding recombinant viruses for the preparation of corresponding vaccines.

[0080] In this invention, we successfully generated recombinant viruses by precisely inserting the GFP and SBDSV VP3 genes into virulent and attenuated strains of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, namely strain BG18cm20, using the CRISPR / Cas9-HMEJ system. These recombinant viruses replicated efficiently in vitro and stably expressed the foreign gene, providing a powerful platform for the development of duck adenovirus vector vaccines. Selecting a suitable insertion site is crucial for ensuring the stability of the recombinant and optimal expression of the foreign gene. An ideal site must avoid disrupting genes essential for viral replication while enabling stable inheritance and high-level expression of the inserted gene. Genomic analysis of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 and its attenuated strain BG18cm20 identified a suitable insertion region between ORF20 and ORF53. This intergenic region is a promising genetic insertion site because it lacks the coding sequences for ORF55 and ORF19. The resulting recombinant viruses, such as DAdV-B2 / ΔORF55-ORF19-GFP, BG18cm20-GFP, and BG18cm20-SBDSV-VP3, maintained stable expression of the exogenous gene during 15 consecutive generations of passage.

[0081] In summary, this invention successfully developed a highly efficient viral vector platform based on duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 or the attenuated duck adenovirus strain BG18cm20. Using the CRISPR / Cas9-HMEJ system, the inventors precisely inserted exogenous genes (GFP and SBDSV VP3) at specific genomic sites in duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 and BG18cm20. The resulting recombinant viruses, particularly BG18cm20-SBDSV-VP3 expressing SBDSV VP3, exhibited high replication efficiency, excellent genetic stability, and high-level expression of exogenous proteins. The VP3 protein expressed in BG18cm20-SBDSV-VP3 could self-assemble into virus-like particles, demonstrating its potential as a bivalent vaccine against DAdV-B and SBDSV. Based on the aforementioned duck adenovirus vector platform, future research can incorporate protective antigens of other important waterfowl viruses, such as the HA protein of avian influenza virus, the sigmaC / B protein of duck reovirus, and the E protein of avian Tembusu virus, laying the foundation for the development of duck adenovirus vector vaccines.

Claims

1. A duck adenovirus B2 strain with a large deletion in its genome, characterized in that: The duck adenovirus B2 strain is duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19, which was deposited at the China Center for Type Culture Collection on September 26, 2025, with accession number CCTCC NO:V202568, and deposit address: Wuhan University, Wuhan, China.

2. The duck adenovirus B2 strain according to claim 1, characterized in that: Compared with the duck adenovirus B2 strain BGMH with GenBank accession number MN539540.1, the duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 has a deletion region located between the ORF20 and ORF53 genes, with a deletion of 7422 bp.

3. The application of the duck adenovirus B2 strain as described in claim 1, characterized in that: Different exogenous genes were inserted into the gene deletion region of duck adenovirus B2DAdV-B2 / ΔORF55-ORF19 to construct corresponding recombinant viruses. The gene deletion region of duck adenovirus B2DAdV-B2 / ΔORF55-ORF19 is located between the ORF20 and ORF53 genes.

4. The application according to claim 3, characterized in that: The recombinant virus was constructed by inserting a foreign gene expression cassette into the gene deletion region between the ORF20 and ORF53 genes in the DAdV-B2 / ΔORF55-ORF19 genome using a CRISPR / Cas9 system, and then obtaining the recombinant virus through fluorescence screening and plaque purification.

5. The application of the duck adenovirus B2 strain as described in claim 1, characterized in that: Duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19 was passaged to obtain an attenuated strain of duck adenovirus B2 DAdV-B2 / ΔORF55-ORF19. The attenuated strain also has a stable gene deletion between the ORF20 and ORF53 genes. Different exogenous genes were inserted into this gene deletion region of the attenuated strain to construct corresponding recombinant viruses, which were used to prepare live vector vaccines.

Citation Information

Patent Citations

  • Novel cairna moschata adenovirus strain, novel cairna moschata adenovirus inactivated vaccine, and preparation method for inactivated vaccine

    CN110564699A

  • Recombinant fowl adenovirus type 4 live vector vaccine strain for expressing vvIBDV-VP2 protein as well as construction method and application of recombinant fowl adenovirus type 4 live vector vaccine strain

    CN114107226A

  • Construction and application of Marek's disease virus ultra-high virulent strain and gene deletion virulent strain of Marek's disease virus ultra-high virulent strain

    CN114717200A

  • Canine adenovirus vectors for the transfer of genes in targeted cells

    EP1118670A1

Cited By

  • Recombinant cosmid of duck adenovirus B2 reverse genetic operating system and application of recombinant cosmid

    CN121575015A