KASP molecular marker linked to the stripe rust resistance locus YrYZW-6A in distant hybrids of wheat and icegrass and its application

Abstract

This invention relates to the fields of molecular biology and genetic breeding technology, and proposes stripe rust resistance loci in the offspring of distant hybrids of wheat and wheatgrass. YrYZW‑6A Linked KASP molecular markers and their applications, stripe rust resistance loci in wheat-wheat-ice grass distant hybrids YrYZW‑6A The nucleotide sequence of the linked KASP molecular marker is shown in SEQ ID NO:4, where M in the nucleotide sequence is C or T; resistance site. YrYZW‑6A Located at 440, 339, and 352 bp on chromosome TraesPB6A in the wheat reference genome Pubing 3504. This technical solution solves the problem of inaccurate screening for stripe rust resistance in wheat-wheat-wheatgrass distant hybrid progeny in related technologies.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, specifically to stripe rust resistance loci in distant hybrids of wheat and wheatgrass. YrYZW-6A Linked KASP molecular markers and their applications. Background Technology

[0002] wheat( Triticum aestivum *L.* is a monocotyledonous herbaceous plant belonging to the Poaceae family and is one of the most important food crops. Wheat stripe rust is caused by *Striga styracifolium*, a wheat-specific strain. Puccinia striiformis f. sp . tritici, Pst Wheat stripe rust is a common fungal disease caused by a strictly virulent fungus. Currently, the most widely adopted measure for controlling wheat stripe rust in my country is to cultivate disease-resistant varieties.

[0003] *Corydalis* is an important wild relative of wheat, belonging to the *Corydalis* complex, which consists of a single *P* genome. The *Corydalis* *P* genome contains a large number of genes highly beneficial for wheat genetic improvement. In terms of disease resistance, it exhibits resistance to many common wheat diseases, such as stripe rust, leaf rust, and powdery mildew. These superior characteristics undoubtedly make *Corydalis* a high-quality exogenous gene donor for wheat improvement. However, in distant hybrids, the identification of target traits usually relies on field inoculation or natural disease phenotypic identification. This method is greatly affected by environmental conditions, is time-consuming, labor-intensive, and cannot accurately screen in early generations.

[0004] Currently, using molecular marker-assisted selection (MMR) to aggregate superior disease-resistant genes is an effective strategy for breeding durable disease-resistant varieties. Compared with traditional phenotypic screening methods, molecular markers have the following significant advantages: they are numerous, widely distributed, and unaffected by environment and developmental stage; most markers are co-dominant, accurately distinguishing between heterozygous and homozygous genotypes; they exhibit high polymorphism and abundant allelic variations; and the detection process is rapid, simple, and accurate. However, current technologies have not yet developed or further explored molecular markers for stripe rust in wheat-ice grass distant hybrids.

[0005] Therefore, developing molecular markers for detecting stripe rust resistance in wheat-ice grass distant hybrids can provide an efficient and reliable identification tool for disease-resistant breeding, enabling early and precise screening of disease-resistant materials, thereby accelerating the utilization of disease-resistant genes and the process of new variety breeding, which is of great practical significance for improving the level of wheat stripe rust resistance breeding. Summary of the Invention

[0006] This invention proposes stripe rust resistance loci in the offspring of distant hybrids of wheat and wheatgrass. YrYZW-6A Linked KASP molecular markers and their applications have solved the problem of inaccurate screening for stripe rust resistance in wheat-ice grass distant hybrids in related technologies.

[0007] The technical solution of the present invention is as follows:

[0008] This invention proposes stripe rust resistance loci in the offspring of distant hybrids of wheat and wheatgrass. YrYZW-6A Linked KASP molecular markers, wherein the nucleotide sequence of the KASP molecular markers is shown in SEQ ID NO:4, and M in the nucleotide sequence is C or T.

[0009] As a further technical solution, the resistance site YrYZW-6A It is located at 440, 339, 352 bp on chromosome TraesPB6A in the wheat reference genome Pubing 3504.

[0010] As a further technical solution, the genotype of the KASP molecular marker in the genome of the wheat to be tested is detected, and wheat with the TT homozygous genotype has stripe rust resistance.

[0011] In this invention, plant varieties with the TT homozygous genotype indicate that wheat plants are resistant to stripe rust. This marker is highly linked to the target resistance locus, which can accurately track the resistance gene, significantly reducing the error and time cost of traditional phenotypic identification. At the same time, the use of wheat distant germplasm, ice grass, broadens the source of resistance genes, which is of great value for breeding against stripe rust.

[0012] As a further technical solution, the KASP molecular marker is determined by sequencing the target region and screening the differential frequencies of disease-resistant DNA pools and disease-susceptible DNA pools of wheat-ice grass distant hybrid offspring populations, and then verifying the genetic linkage and phenotypic results to identify the molecular markers that co-segregate with stripe rust resistance.

[0013] The present invention also proposes a primer set for amplifying the KASP molecular marker, including a forward specific primer F1, a forward specific primer F2, and a reverse universal primer;

[0014] The sequence of the forward specific primer F1 is shown in SEQ ID NO:1;

[0015] The sequence of the forward specific primer F2 is shown in SEQ ID NO:2;

[0016] The sequence of the reverse universal primer is shown in SEQ ID NO:3.

[0017] As a further technical solution, the 5' ends of the forward specific primer F1 and the forward specific primer F2 are each independently connected to different fluorescent reporter groups;

[0018] The sequence of the fluorescent reporter group attached to the 5' end of the forward specific primer F1 is shown in SEQ ID NO:5:

[0019] GAAGGTGACCAAGTTCATGCT;

[0020] The sequence of the fluorescent reporter group attached to the 5' end of the forward specific primer F2 is shown in SEQ ID NO:6:

[0021] GAAGGTCGGAGTCAACGGATT.

[0022] The present invention also proposes a kit containing the aforementioned primer set.

[0023] The present invention also proposes the application of the primer set or the kit described herein in any of the following A to C:

[0024] A. To identify or assist in the identification of wheat stripe rust resistance;

[0025] B. Identify or assist in identifying wheat as either stripe rust-resistant or stripe rust-susceptible;

[0026] C. Breed wheat varieties resistant to stripe rust.

[0027] This invention also proposes a method for identifying stripe rust resistance in wheat-wheat grass distant hybrids, comprising the following steps:

[0028] S1. Extract genomic DNA from the distant hybrid offspring of wheat and icewort to be tested;

[0029] S2. PCR amplification is performed using the primer set described above. The genotype is determined by fluorescence detection of the amplification results, and it is determined whether the genotype has stripe rust resistance.

[0030] In this invention, single nucleotide polymorphism (SNP) markers, due to their dense distribution and strong stability in the genome, have become an important basis for marker-assisted selection (MAS). Kompetitive allele-specific PCR (KASP) is a fluorescent signal-based SNP genotyping technique. This technique identifies the genotype of the target SNP site by connecting different fluorescent groups to the ends of specific primers and using the fluorescence signal at the PCR endpoint. Therefore, KASP technology has the advantages of high efficiency, low cost, simple operation, and high throughput. It can achieve rapid and accurate genotyping of specific SNPs in a large number of samples, significantly improving the efficiency of marker-assisted breeding and showing broad application prospects in crop genetic improvement.

[0031] As a further technical solution, the determination is based on the genotyping results to determine the stripe rust resistance of the wheat-ice grass distant hybrid offspring to be tested: if the genotype is TT homozygous, then the wheat-ice grass distant hybrid offspring to be tested has stripe rust resistance; if the genotype is CC homozygous, then the wheat-ice grass distant hybrid offspring to be tested has stripe rust susceptibility.

[0032] The present invention also proposes a method for breeding wheat resistant to stripe rust, comprising the following steps: extracting genomic DNA from wheat samples to be tested, performing PCR amplification using the primer set described above, determining the genotype by fluorescence detection using the amplification results, and retaining the wheat samples to be tested for breeding if the determined genotype is TT.

[0033] The working principle and beneficial effects of this invention are as follows:

[0034] In this invention, the developed molecular marker is associated with stripe rust resistance sites. YrYZW-6A This marker exhibits high linkage and can reliably predict the resistance level of wheat materials to stripe rust. It is characterized by high stability, ease of automated detection, and suitability for high-throughput screening, facilitating its application in breeding platforms and meeting the accuracy and stability requirements of molecular marker-assisted selection breeding. Based on a well-defined genomic location (TraesPB6A: 440, 339, 352 bp) and stable allele-phenotype correspondence, this marker enables reliable and early prediction of stripe rust resistance levels in wheat germplasm resources and breeding progeny materials. Validated in a large-scale recombinant inbred line population (F11, 1220 individual plants), the marker demonstrates highly significant phenotypic differentiation among different genotype groups, fully meeting the core requirements of molecular marker-assisted selection breeding for accuracy, stability, and practicality. It is suitable for high-throughput, automated screening and can significantly improve the efficiency of disease resistance breeding.

[0035] The molecular markers of this invention can be used to screen resistant individual plants at the seedling stage, greatly shortening the breeding cycle and transforming the traditional process of multi-generational field planting and identification into leaf DNA detection, which greatly saves time, manpower and land resources.

[0036] In addition, the molecular marker method of the present invention can not only reduce dependence on chemical pesticides, which is in line with the trend of green agriculture, but also reduce the risk of field disease outbreaks through precision breeding, thus ensuring food security. Attached Figure Description

[0037] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0038] Figure 1 This is the reactive form of wheat stripe rust fungus in wheat seedlings according to the present invention.

[0039] Figure 2This is a diagram showing the results of the TraesPB6A chromosome SNP-Indel based on exon pooling sequencing according to this invention.

[0040] Figure 3 This is a diagram showing the KASP typing results of progeny single plants using SNP molecular markers from this invention.

[0041] Figure 4 This is a graph showing the association between the genotypes of the SNP molecular markers of this invention and the stripe rust resistance phenotype.

[0042] Figure 5 This is a diagram showing the KASP typing results of the SNP molecular markers of this invention in other wheat materials. Detailed Implementation

[0043] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0044] Example 1

[0045] 1. Resistance loci to wheat stripe rust YrYZW-6A Obtaining linked KASP molecular markers

[0046] 1.1 Construction of F11 generation recombinant inbred line population

[0047] Using PB3504 as the male parent and Yecora Rojo as the female parent, a cross was conducted. Starting from the F2 generation, the single-seed passage method (SSD) was used for 11 consecutive generations of self-pollination to construct a population of 1220 genetically stable F11 recombinant inbred lines.

[0048] 1.2 Identification of disease resistance phenotype

[0049] In a greenhouse, stripe rust resistance was assessed in 1220 F11 generation recombinant inbred lines. Wheat seeds were sown in 7cm square pots filled with nutrient substrate and cultured under the following conditions: 16h light, 8h dark, and 17℃. When the wheat reached the one-heart-one-leaf stage, it was inoculated with the stripe rust physiological race CYR34. For inoculation, a 4mg / mL suspension of CYR34 stripe rust spores was prepared using electronic fluoride solution. After mixing by inverting the pot, 5μL was evenly applied to the upper surface of the wheat leaves from top to bottom. After inoculation, the leaves were sprayed with water and placed in a 10℃ dark humidified room for 24h (100% humidity). After humidification, the plants were cultured at 15℃ under the following conditions: 16h light, 8h dark. The first phenotypic assessment was conducted on day 15 after inoculation, and the second phenotypic assessment was conducted on day 18 after inoculation. The result with the most severe disease development was taken as the final phenotype.

[0050] Table 1 shows the reactivity and symptomatic characteristics of wheat stripe rust on wheat, and the reactivity of wheat stripe rust on wheat seedlings is shown in Table 2. Figure 1 As shown, the stripe rust resistance phenotype was identified by recording the leaf reaction patterns according to the 0-9 grade standard, where 0-6 grades indicate resistance and 7-9 grades indicate susceptibility.

[0051] Table 1. Reactivity patterns and symptomatic characteristics of wheat stripe rust on wheat.

[0052]

[0053] The results showed that under the infection conditions of the stripe rust physiological race CYR34, 594 out of 1220 materials (48.69%) showed resistance and 626 out of 1220 materials (51.31%) showed susceptibility.

[0054] 1.3 DNA Extraction

[0055] Using recombinant inbred lines (F11 generation, 1220 families) derived from distant hybridization of wheat and icegrass and their parents as materials, young leaf tissues were collected, and total genomic DNA was extracted using a modified CTAB method: 0.5g of fresh leaf tissue was weighed, flash-frozen in liquid nitrogen, and thoroughly ground; the ground powder was transferred to a centrifuge tube containing preheated CTAB buffer, and subjected to chloroform extraction, isopropanol precipitation, and ethanol washing at 65℃. After air drying, the powder was dissolved in 100μL ddH2O as the stock solution; the CTAB buffer contained 20g / L CTAB, 81.90g / L NaCl, 7.46g / L EDTA, 12.14g / L Tris-HCl, and 2g / L PVP, and the pH was adjusted to 8.0.

[0056] The concentration and purity of genomic DNA in the obtained mother liquor were quantitatively analyzed using a micro-spectrophotometer. When A260 / A280 was greater than 1.8 and A260 / A230 was greater than 1.8, it indicated that the purity of the extracted DNA met the standards. The DNA was then diluted to a working concentration of 100 ng / μL to ensure that it met the quality requirements for subsequent high-throughput genotyping.

[0057] 1.4 Construction of Extreme Mixed Pool

[0058] Based on the identification results of the disease resistance phenotype, 38 extremely resistant single plants and 47 extremely susceptible single plants were selected, and genomic DNA was extracted and mixed in equal amounts to construct a disease resistance DNA pool (R-pool) and a disease susceptibility DNA pool (S-pool).

[0059] 1.5 Key SNP Screening

[0060] Target region sequencing: Perform exon sequencing on qualified DNA samples from the two pools above, with a sequencing depth of 30×.

[0061] Association interval localization: Based on the principle of cluster separation analysis, the allele frequency difference (ΔSNP-index) at each SNP locus in the genome was calculated for the mixed pools of resistant and susceptible individuals, and a significance threshold of p<0.05 was used for screening. The results are as follows: Figure 2 As shown;

[0062] Figure 2 The results showed that the stripe rust resistance-related genetic locus was located on chromosome 6A. A continuous and significant peak signal was detected on chromosome 6A, covering a physical region of 300–500 Mb, indicating the presence of a major stripe rust resistance locus within this associated region. This locus has a strong effect and is an ideal target region for developing tightly linked molecular markers. Except for chromosome 6A, the ΔSNP-index values ​​on other chromosomes were randomly distributed near zero, indicating that these genomic regions were not significantly associated with stripe rust resistance.

[0063] Within the aforementioned correlation interval, further screening was conducted on SNP sites exhibiting highly significant differences in allele frequencies (ΔSNP-index > 0.8) between resistant and susceptible DNA pools and those displaying polymorphism. Ultimately, a key SNP site highly cosegregated with the resistance phenotype was identified, located at nucleotides 440, 339, and 352 on chromosome PB6A of the wheat reference genome, Pubing 3504. At this site, the resistant DNA pool and resistant parental line showed a fixed "T" base, while the susceptible DNA pool and susceptible parental line showed a fixed "C" base. The major stripe rust resistance gene linked to this SNP marker was named... YrYZW-6A .

[0064] 1.6 Development of KASP molecular markers

[0065] For the flanking sequences of the aforementioned SNP sites, KASP primers were designed based on the principle of competitive allele-specific PCR (KASP) to ensure the specificity and efficiency of genotyping. The sequence of the allele 1-forward specific primer (F1) is as follows:

[0066] 5'-GAAGGTGACCAAGTTCATGCTgcgacggacttggcacgacggcggc-3' (lowercase part is SEQ ID NO:1; uppercase part is the specific fluorescent tag sequence FAM, as shown in SEQ ID NO:5);

[0067] The sequence of the allele 2-forward specific primer (F2) is as follows:

[0068] 5'-GAAGGTCGGAGTCAACGGATTgcgacggacttggcacgacggcggt-3' (lowercase part is SEQ ID NO:2; uppercase part is the specific fluorescent tag sequence VIC, as shown in SEQ ID NO:6);

[0069] The sequence of the reverse universal primer (R) is as follows:

[0070] 5'-ctccaccacatcacccctgcctcgttctg-3' (SEQ ID NO: 3).

[0071] The nucleotide sequence of the synthesized KASP molecular marker is as follows:

[0072] 5'-GCGACGGACTTGGCACGACGGCGG M GATCCGATCGGGTCAGAACGAGGCAGGGGTGATGTGGTGGAG-3' (SEQ ID NO: 4, M is C or T).

[0073] 1.7 KASP Genotyping Experiment

[0074] Genotyping of genomic DNA using quantitative real-time PCR using this KASP molecular marker:

[0075] PCR reaction system: 10 μL total reaction volume, 30 ng template DNA, and the remaining volume is made up with ddH2O;

[0076] The total reaction system contained: 5 μL of 2×KASP Master Mix and 0.75 μL of 10 μM KASP primer mixture (the KASP primer mixture included specific primer F1, specific primer F2 and universal primer R in a volume ratio of 1:1:3).

[0077] PCR reaction program: 94°C hot start for 15 min, 94°C denaturation for 20 s, annealing / extension temperature starting from 61°C, 10 cycles, each cycle decreasing by 0.6°C to 55°C for 60 s, 94°C denaturation for 20 s, 55°C annealing / extension for 60 s, 38 cycles, incubation at 16°C.

[0078] Fluorescence signal detection and typing: After the PCR reaction, the instrument automatically collects two fluorescence signals, FAM and VIC. Using the accompanying analysis software, automatic typing is performed based on the cluster distribution of the fluorescence signals in a two-dimensional scatter plot. Some sample typing results are shown below. Figure 3 As shown;

[0079] Depend on Figure 3 It can be seen that the tested samples were clearly divided into three completely separate clusters: the disease-resistant cluster (T / T homozygous genotype), the disease-susceptible cluster (C / C homozygous genotype), and the mixed cluster of disease-resistant and disease-susceptible samples (C / T heterozygous genotype). The disease-resistant genotype (left cluster), heterozygous genotype (middle cluster), and disease-susceptible genotype (right cluster) correspond to the intensity differences on the X-axis (FAM fluorescence signal) and Y-axis (VIC fluorescence signal), respectively. After testing 1220 samples, 251 were found to be C / C homozygous genotype, 851 were T / T homozygous genotype, 22 were C / T heterozygous genotype, and 96 had unknown genotypes.

[0080] 2. Validation of the association between KASP molecular markers and phenotypes

[0081] Association analysis was performed on the KASP marker genotyping results and stripe rust resistance phenotypes (disease index). First, the disease index of each material and its corresponding KASP marker genotype (TT, CC, CT) were compiled into a structured data table; unknown genotypes were not subjected to association validation. For the continuous phenotypic data of the disease index, a t-test was used to compare the differences in phenotypic means among different genotype groups, and the statistical significance (P-value) was calculated. Finally, box plots were used to visualize the phenotypic distribution of different genotype groups, intuitively presenting the association strength between the marker and disease resistance; the distribution results of the disease index corresponding to different genotypes are shown below. Figure 4 As shown.

[0082] Depend on Figure 4 It was found that among the 851 T / T homozygous plants, 463 exhibited high resistance or immunity; among the 251 C / C homozygous plants, 177 exhibited high susceptibility; and among the 22 C / T heterozygous plants, phenotypic segregation occurred, ranging from moderately resistant to moderately susceptible. Statistical analysis further confirmed that the genotyping results of this SNP molecular marker were highly significantly correlated with stripe rust resistance (P=2.78E-15), indicating that it can be used for efficient and accurate screening in wheat stripe rust resistance breeding.

[0083] 3. SNP molecular marker typing in other wheat materials

[0084] KASP genotyping was performed on wheat-Isodon japonicus introgression lines (PB2022-1, PB03, PB06, PB4201, PB09, PB3504, PB298, PB300), Isodon japonicus Z559, and common wheat (Zhoumai 18, Fukoho, Zhoumai 36, Jagger, 924144-2, Yekaola, FC Dasui, Zhi 7730, CMH83605) using the molecular markers of this invention. The experimental procedures were the same as steps 1.6-1.7 above, and the analysis results are as follows. Figure 5 As shown.

[0085] Depend on Figure 5 It can be seen that, excluding the ddH2O, anti-pond, and susceptible-pond controls, the T / T homozygous single plants (10 plants) are PB2022-1, PB03, PB06, Zhoumai 18, Fukoho, PB4201, Zhoumai 36, Jagger, 924144-2, and Z559; and the C / C homozygous single plants (8 plants) are Yekaola, FC Dasui, PB09, PB3504, PB298, PB300, Zhi7730, and CMH83605.

[0086] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Used to amplify stripe rust resistance loci in distant hybrids of wheat and wheatgrass. YrYZW-6A Application of the linked KASP molecular marker primer set in any of the following A-B: A. To identify or assist in the identification of wheat stripe rust resistance; B. Breed wheat varieties resistant to stripe rust; The primer set includes forward specific primer F1, forward specific primer F2, and reverse universal primer; The sequence of the forward specific primer F1 is shown in SEQ ID NO:1; The sequence of the forward specific primer F2 is shown in SEQ ID NO:2; The sequence of the reverse universal primer is shown in SEQ ID NO:3; The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO:4, where M in the nucleotide sequence is C or T; If the genotype of the KASP molecular marker is TT homozygous, the offspring of the wheat-ice grass distant hybrid will be resistant to stripe rust. If the genotype of the KASP molecular marker is CC homozygous, the offspring of the wheat-ice grass distant hybrid will be susceptible to stripe rust.

2. Used to amplify stripe rust resistance loci in distant hybrids of wheat and wheatgrass. YrYZW-6A The application of the kit for linked KASP molecular markers in any of the following A~B: A. To identify or assist in the identification of wheat stripe rust resistance; B. Breed wheat varieties resistant to stripe rust; The kit contains a primer set; the primer set includes a forward-specific primer F1, a forward-specific primer F2, and a reverse universal primer; The sequence of the forward specific primer F1 is shown in SEQ ID NO:1; The sequence of the forward specific primer F2 is shown in SEQ ID NO:2; The sequence of the reverse universal primer is shown in SEQ ID NO:3; The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO:4, where M in the nucleotide sequence is C or T; If the genotype of the KASP molecular marker is TT homozygous, the offspring of the wheat-ice grass distant hybrid will be resistant to stripe rust. If the genotype of the KASP molecular marker is CC homozygous, the offspring of the wheat-ice grass distant hybrid will be susceptible to stripe rust.

3. The application according to claim 1 or 2, characterized in that, The resistance site YrYZW-6A It is located at 440, 339, 352 bp on chromosome TraesPB6A in the wheat reference genome Pubing 3504.

4. The application according to claim 1 or 2, characterized in that, The 5' ends of the forward specific primers F1 and F2 are each independently connected to different fluorescent reporter groups.

5. A method for identifying stripe rust resistance in wheat-wheat-ice grass distant hybrid progeny, characterized in that, Includes the following steps: S1. Extract genomic DNA from the distant hybrid offspring of wheat and icewort to be tested; S2. PCR amplification is performed using the primer set in claim 1, and the genotype is determined by fluorescence detection of the amplification results to determine whether the genotype is resistant to stripe rust. The determination is based on the genotyping results to determine the stripe rust resistance of the wheat-ice grass distant hybrid offspring to be tested: if the genotype is TT homozygous, the wheat-ice grass distant hybrid offspring to be tested has stripe rust resistance; if the genotype is CC homozygous, the wheat-ice grass distant hybrid offspring to be tested has stripe rust susceptibility.

6. A method for breeding wheat resistant to stripe rust, characterized in that, Includes the following steps: Genomic DNA was extracted from the wheat sample to be tested, and PCR amplification was performed using the primer set in claim 1. The genotype was determined by fluorescence detection of the amplification results. If the determined genotype was TT, the wheat sample to be tested was retained for breeding.

Images