Methane-oxidizing bacteria characterization and sorting method based on single-cell Raman spectrum

By combining single-cell Raman spectroscopy with stable isotope labeling, and utilizing the Raman peak shift of cytochrome c after assimilation by methanogenic bacteria, the accuracy problem of screening methanogenic bacteria in traditional methods has been solved, achieving efficient identification and sorting at the single-cell level.

CN121577600APending Publication Date: 2026-02-27QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511600874.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently screening and isolating methanogenic bacteria in soil. Traditional culture methods result in significant differences between strains and actual bacterial communities, molecular biology methods cannot accurately capture information about rare populations, and single-cell Raman spectroscopy has not been applied in the screening of methanogenic bacteria.

Method used

Single-cell Raman spectroscopy combined with stable isotope labeling was used to identify and sort methanotrophs by utilizing the Raman peak shift of cytochrome c after assimilation by methanogenic bacteria. The degree of Raman peak shift was used to quantify their functional activity.

Benefits of technology

It enables the identification and sorting of methanogenic bacteria at the single-cell level, is suitable for screening in complex environments, and is non-destructive and highly accurate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121577600A_ABST
    Figure CN121577600A_ABST
Patent Text Reader

Abstract

According to the invention, a single-cell Raman technology and a stable isotope labeling combined technology are established, the identification of methane-oxidizing bacteria at the single-cell level and the quantification of the functional activity of the methane-oxidizing bacteria are realized, and the functional microbial cells are sorted. Based on the technology, the invention develops a methane-oxidizing bacteria screening method based on a single-cell Raman spectrum technology and stable isotope labeling, and the methane-oxidizing bacteria are identified and sorted by taking a Raman peak which causes shift of cytochrome c after assimilation as a characteristic peak; and quantifying the functional activity of the methane-oxidizing bacteria according to the deviation degree of the Raman peak. The method has the characteristics of single cell level research, no dependence on culture and non-destructive detection, and is suitable for screening methane-oxidizing bacteria in complex environments such as soil.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganism screening and cultivation and environmental protection, and more particularly relates to a method for characterizing and sorting methane-oxidizing bacteria based on single-cell Raman spectroscopy. BACKGROUND

[0002] Methane is one of the important greenhouse gases affecting global climate, and soil is an important biological sink of atmospheric methane, which is mediated by a specific group of functional microorganisms, i.e. methane-oxidizing bacteria (MOB). Methane-oxidizing bacteria belong to Gram-negative bacteria and are a branch of methylotrophs, which mainly utilize methane as the sole carbon source and energy source for growth. As the sole carbon source and energy source for growth, methane-oxidizing bacteria widely exist in various ecological environments such as soil and water, and play a crucial role in maintaining atmospheric methane concentration balance, methane emission reduction, global carbon cycle, etc. Therefore, the development and utilization of methane-oxidizing bacteria strain resources are of great significance for mitigating the greenhouse effect and helping to achieve the "double carbon" goal.

[0003] At present, the research methods for soil methane-oxidizing bacteria mainly focus on traditional culture method and molecular biology technology. The traditional culture method uses methane as the sole carbon source for selective enrichment, and obtains cultivable strains through isolation and purification, but most of the microorganisms in the environment are not cultivable, and due to the slow growth of most soil methane-oxidizing bacteria, nutritional competition between strains, selective culture medium, etc., the difference between cultivable strains and actual flora is significant. The molecular biology method can analyze the composition and metabolic potential of flora, but also has problems such as insufficient specificity of probes and primers, and inability to accurately capture rare population information. In order to realize the resource mining of methane-oxidizing bacteria, it is necessary to develop new technologies for screening methane-oxidizing bacteria from environmental soil.

[0004] Single-cell Raman spectroscopy (SCRS) is an analytical method based on Raman scattering effect, which has the characteristics of single-cell level, non-destructive, independent of culture and high spatial resolution. Raman spectroscopy combined with stable isotopes (such as 、 , etc.) can directly study the activity and function of individual environmental microorganisms by using the shift of Raman spectral peaks of proteins, lipids, pigments, etc. caused by microbial assimilation of stable isotopes. This technology has great application potential in the study of environmental functional bacteria, but has not been used for the screening of methane-oxidizing bacteria. SUMMARY

[0005] The applicant found that pure culture methane-oxidizing bacteria generally contain cytochrome c, which not only has strong Raman spectral peaks, but also causes a shift in the Raman spectral peaks of proteins, lipids, pigments, etc. when methane-oxidizing bacteria assimilate Afterwards, the Raman peak of cytochrome c is obviously shifted. By using this shift, methanotrophs can be identified and the degree of shift can be used to quantify the functional activity of methanotrophs.

[0006] Based on the above findings, the present application provides a method for quantitatively characterizing methanotrophs, comprising the following steps:

[0007] S1: culturing the bacteria to be tested using a gas containing a labeled as the sole carbon source;

[0008] S2: detecting the shift of the characteristic Raman spectrum peak of cytochrome c of the bacteria to be tested after culturing, when the characteristic Raman spectrum peak of cytochrome c is shifted, the bacteria to be tested is a methanotroph, and the degree of shift of the peak position represents the ability of the bacteria to be tested to internalize methane.

[0009] In one specific embodiment, the Raman spectrum detected in S2 is a single-cell Raman spectrum.

[0010] In one specific embodiment, the labeled is In one specific embodiment,

[0011] In one specific embodiment, the characteristic Raman spectrum peak of cytochrome c is one or more combinations of the Raman spectrum peaks in the wave number region of 749 cm -1 (pyrrole breathing mode), 1129 cm -1 (v(C-N)), 1312 cm -1 (δ(C-H)), and 1589 cm -1 (v(C-C)).

[0012] The present application also provides a method for sorting methanotrophs from a mixed bacterial population, comprising the following steps:

[0013] 1) culturing the mixed bacterial population using a gas containing a labeled as the sole carbon source;

[0014] 2) performing single-cell Raman spectrum detection on the mixed bacterial population for cytochrome c;

[0015] 3) separating the bacterial cells whose Raman spectrum peak of cytochrome c is shifted, which are methanotrophs.

[0016] In one specific embodiment, the labeled is . ​​

[0017] In one embodiment, the characteristic Raman spectrum peak of cytochrome c is one or more of the peaks at 749 cm -1 (pyrrole breathing mode), 1129 cm -1 (v(C-N)), 1312 cm -1 (d(C-H)), 1589 cm -1 (v(C-C)) wavenumber region.

[0018] The present application establishes a single-cell Raman technique and stable isotope labeling combined technique, realizes the identification of methanotrophs and the quantification of their functional activity at the single-cell level, and sorts the functional microbial cells. Based on this technique, the present application develops a methanotroph screening method based on single-cell Raman spectrum technique and stable isotope labeling, to identify and sort methanotrophs by taking the Raman peak of cytochrome c that is caused to shift after assimilation as a characteristic peak, and to quantify the functional activity of methanotrophs by the degree of shift of the Raman peak. This method has the characteristics of single-cell level research, culture-independent, non-destructive detection, and is suitable for the screening of methanotrophs in complex environments such as soil. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Figure 1 is a single-cell Raman spectrum of pure culture strains Methylosinus trichosporium OB3b, Methylocystis parvus OBBP, Methylosinus sp. PRM1, Methylocystis sp. PRM2, Methylocystis bryophila H2s, Methylocella silvestris BL2 and E. coli K-12 DH5a.

[0020] Figure 2 Figure 2 is a single-cell Raman spectrum of Methylosinus trichosporium OB3b labeled with different concentrations of Figure 2a is a single-cell Raman spectrum of Methylosinus trichosporium OB3b labeled with different concentrations of Figure 2b is the shift of the Raman peak of cytochrome c of Methylosinus trichosporium OB3b induced by different concentrations of Figure 2c is a correlation analysis of the shift of the Raman peak of cytochrome c and the concentration of

[0021] Figure 3Figure 1. Single cell sorting image (a) and agarose gel electrophoresis image of sorted single cell PCR amplification products (b). DETAILED DESCRIPTION

[0022] The principles and features of the present application are described below in connection with examples, which are only used to explain the present application and not to limit the scope of the present application.

[0023] 1. Strain source

[0024] Pure culture strains of methanotrophs Methylosinus sp. PRM1 and Methylocystis sp. PRM2 were isolated from natural wetland reed root in the laboratory of the Institute of Soil Science, Chinese Academy of Sciences. Methylosinus trichosporium OB3b (NCIMB 11131), Methylocystis parvus OBBP (NCIMB 11129), Methylosinus sp. PRM1, Methylocystis sp. PRM2, Methylocystis bryophila H2s and Methylocella silvestris BL2 were purchased from NCIMB. E. coli K-12 DH5α and Saccharomyces cerevisiae were from the laboratory.

[0025] 2. Experimental methods

[0026] 2.1 Strain culture and sample preparation

[0027] 20 mL of inorganic nitrate medium (NMS, composition (g / L) as follows: 0.26; 0.72; 1.0; 1.0; anhydrous 0.2; Fe-EDTA 0.38; 0.26; 1 mL of trace element solution, wherein the trace element solution is prepared separately, and the composition is as follows (g / L): 0.2; 0.5; 0.4; 0.025; 0.5; EDTA-2Na 0.25; 0.02; 0.01) was added to a 60 mL serum bottle, inoculated with each strain of pure culture methanotrophs, the bottle mouth was sealed with a rubber plug, and 20% As the sole carbon source, E. coli K-12 DH5a was cultured in LB medium, Saccharomyces cerevisiae was cultured in YPD medium, both at 30°C and 220 rpm until the logarithmic phase. The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition.

[0028] 2.2 Isotope-labeled culture of pure methanotrophs and sample preparation

[0029] 20 mL of NMS medium was added to a 60 mL serum bottle, and the Methylosinus trichosporium OB3b strain was selected and inoculated into the medium. The bottle was sealed with a rubber plug, and 20% of the total volume of CH4 and CO2 mixed gas was filled with a sterile syringe. The final concentration of CH4 and CO2 was 50%, and the bottle was cultured at 30°C and 220 rpm until the logarithmic phase (4d). The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition. As the sole carbon source, different volumes of CH4 and CO2 mixed gas were filled with a sterile syringe, and the final concentration of CH4 and CO2 was 0%, 10%, 20%, 30%, 40%, and 50%, respectively. The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition. 12 CH4 and CO2 mixed gas, the final concentration of CH4 and CO2 was 50%, and the bottle was cultured at 30°C and 220 rpm until the logarithmic phase (4d). The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition. 13 CH4 and CO2 mixed gas, the final concentration of CH4 and CO2 was 50%, and the bottle was cultured at 30°C and 220 rpm until the logarithmic phase (4d). The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition. The different concentration gradients of CH4 and CO2 mixed gas were 0%, 10%, 20%, 30%, 40%, and 50%, and the bottle was cultured at 30°C and 220 rpm until the logarithmic phase (4d). The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition. The different concentration gradients of CH4 and CO2 mixed gas were 0%, 10%, 20%, 30%, 40%, and 50%, and the bottle was cultured at 30°C and 220 rpm until the logarithmic phase (4d). The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman spectrum acquisition.

[0030] 2.3 Construction of artificial mixed bacterial community sample

[0031] The mixed bacterial solution was mixed according to the ratio of Methylocystis parvus OBPP: E. coli K-12 DH5a: Saccharomyces cerevisiae = 1:2:2, and inoculated into NMS (0.1 g / L glucose) medium. 20% of the total volume of CH4 and CO2 mixed gas was filled with a sterile syringe, and the final concentration of CH4 and CO2 was 50%. The bottle was cultured at 30°C and 220 rpm for 4d. The bacterial cells were collected and washed with sterile deionized water for three times before single-cell Raman sorting.

[0032] 2.4 Single-cell Raman spectrum acquisition

[0033] The prepared sample was diluted with sterile deionized water to an appropriate concentration, and single-cell Raman spectrum acquisition was performed under a 50x objective lens using a 532 nm laser through a RACS-Seq instrument (Xing Sai Biological, Qingdao). The sample was injected into the RAGE chip, mineral oil was added to the oil reservoir, and the height of the sample holder was adjusted to balance the water and oil phases. Single-cell Raman spectrum acquisition was performed, target cells were identified according to the shift of Raman characteristic peaks, cells were captured using a 1064 nm laser, the water phase was blown by an ear ball to form droplets encapsulating single target cells, and the single-cell droplets were taken out with a pipette. ​

[0034] 2.5 Single-cell MDA amplification

[0035] After adding 1.5 μΐ of lysis buffer to the single cell sorted by RACS-Seq, repeated freezing and thawing three times, incubated at 65℃ for 15 min, then added 1.5 μΐ of stop solution and lysis buffer, followed by the addition of reaction buffer and DNA polymerase, the mixture was incubated at 30℃ for 8 h, and the MDA reaction was at a hot lid temperature of 70℃. In order to detect whether there is contamination, a blank control (without any cells) is set at the same time. Subsequently, the MDA amplification product was amplified by PCR using 16S primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT) and methanotrophic functional gene pmoA primers (A189F: GGNGACTGGGACTTCTGG; mb661r: CCGGMGCAACGTCYTTACC), and the amplification product was verified on a 1% agarose gel. Then the amplification product was subjected to high-throughput sequencing analysis.

[0036] 3. Experimental results

[0037] 3.1 Cytochrome c is a common spectral peak of pure culture methanotrophs

[0038] The Raman spectra of six selected pure culture methanotroph strains were collected. According to the Raman spectrum, these methanotrophs all have common Raman signals at 749 cm -1 (pyrrole breathing mode)、1129 cm -1 (ν(C−N))、1312 cm -1 (δ(C−H))、1589 cm -1 (ν(C−C)), Figure 1 which are almost the same as the reported Raman characteristic peaks of pure cytochrome c. This result shows that cytochrome c is a common spectral peak of Raman spectra of various pure culture methanotrophs.

[0039] 3.2 The Raman shift of induced cytochrome c can quantitatively characterize the function of methanotrophs

[0040] According to different concentrations The Raman spectrum of M. trichosporium OB3b after labeling culture shows that the four spectral peaks V1 (749 cm -1 ), V2 (1129 cm -1 ), V3 (1312 cm -1 ), and V4 (1589 cm -1All of them have shifted. Figure 2 a) and with With increasing concentration, the wavenumber shift of each peak of cytochrome c gradually increased. Comparing the 50% group and the 0% group, the peak shift of cytochrome c was V1 (749-740 cm⁻¹). -1 V2 (1129-1121 cm) -1 V3 (1312-1303cm) -1 V4 (1589-1566 cm) -1 )( Figure 2 b). For different concentrations Correlation analysis of the shift wavenumbers of the four spectral peaks of cytochrome c with those of cytochrome c (Figure 2c) revealed a linear relationship between the two for each peak position, with R0 representing the linear relationship. 2 The values ​​are V1 (0.99), V2 (0.99), V3 (0.99), and V4 (0.93), respectively. These results indicate that... 13 The Raman peak that causes a shift in cytochrome c after C assimilation can be used as a characteristic peak for identifying and sorting methanogenic bacteria, and the degree of shift of the Raman peak can be used to quantify the functional activity of methanogenic bacteria.

[0041] 3.3 Identification and sorting of methanogenic bacteria

[0042] by 13 The Raman peak indicating cytochrome c shift caused by C assimilation was used as a characteristic peak for the identification and sorting of methanogenic bacteria in mixed bacterial colonies. Target single cells exhibiting cytochrome c shift were then sorted from the mixed bacterial colonies. Figure 3 a) Sorted single cells were subjected to MDA amplification, and the amplification products were further amplified with 16S and the pmoA functional gene of methanogenic bacteria. The amplification products were then validated by gel electrophoresis. Figure 3 (b) Then, high-throughput sequencing was performed on the amplified products to determine the strain information. Sequence alignment revealed that the single cells sorted by cytochrome c shift belonged to *Methylocystis parvus* OBBP. These results indicate that this method can accurately identify and sort methanogenic bacteria and is applicable to screening methanogenic bacteria in complex environments such as soil.

[0043] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for quantitatively characterizing methanogenic bacteria, characterized in that, Includes the following steps: S1: Use those containing the marked symbols of The test bacteria were cultured using gas as the sole carbon source. S2: Detect the peak position shift of the characteristic Raman spectral peak of cytochrome c of the cultured test bacteria. When the characteristic Raman spectral peak of cytochrome c shifts, the test bacteria are methanogenic bacteria. The degree of peak position shift characterizes the ability of the test bacteria to internalize methane.

2. The method according to claim 1, characterized in that, The Raman spectrum detected in S2 is a single-cell Raman spectrum.

3. The method according to claim 1, characterized in that, The marked for 13 CH4.

4. The method according to claim 1, characterized in that, The characteristic Raman spectral peak of cytochrome c is originally located at 749 cm⁻¹. -1 1129 cm -1 1312 cm -1 1589 cm -1 One or more combinations of Raman spectral peaks in the wavenumber region.

5. A method for sorting methanogenic bacteria from a mixed bacterial community, characterized in that, Includes the following steps: 1) Use products containing markings of The mixed bacterial community was cultured using gas as the sole carbon source. 2) The mixed bacterial community was subjected to single-cell Raman spectroscopy detection targeting cytochrome c; 3) Bacterial cells in which the characteristic Raman spectral peak of cytochrome c is shifted are methanogenic bacteria.

6. The method according to claim 5, characterized in that, The marked for .

7. The method according to claim 5, characterized in that, The characteristic Raman spectral peak of cytochrome c is located at 749 cm⁻¹. -1 1129 cm -1 1312 cm -1 1589 cm -1 One or more combinations of Raman spectral peaks in the wavenumber region.