Human carotid artery globular paraganglioma immortalized cell strain and application
Using retrovirus-mediated gene transformation technology, an immortalized cell line PGL-1120 for human carotid bulb paraganglioma was established, solving the problem of the lack of suitable cell lines in existing technologies and realizing efficient tumor research simulation and drug development.
Patent Information
- Application Number
- CN202610123032.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-03
AI Technical Summary
The lack of suitable carotid bulb paraganglioma cell lines in current technology limits basic research on tumor occurrence and development. Cells from non-paraganglioma sources lack specificity, primary cells grow slowly and are complex to extract, have long experimental cycles, low cell yields, and inconsistent genotypes.
Using retrovirus-mediated gene transformation technology, primary carotid bulb paraganglioma cells were immortalized using EF1α-SV40-IRES-puromycin lentivirus. The c.178_182delAAGGC mutation in the SDHD gene was screened and identified, and the human carotid bulb paraganglioma immortalized cell line PGL-1120 was established, amplified, and preserved.
The obtained cell lines can simulate the real phenotype of human SDHD gene mutation background, are suitable for large-scale culture and passage, simplify experimental requirements, shorten the experimental cycle, and provide genotype-consistent cells for basic research.
Smart Images

Figure CN121592604A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biology and relates to a cell line, specifically an immortalized human carotid bulb paraganglioma cell line and its uses. Background Technology
[0002] Current research on carotid glomus tumors is mainly limited to clinical studies, as the lack of suitable cell lines severely restricts basic research on tumor development and progression. Previous studies have primarily used cells from non-paraneuroma sources to silence SDHD or used primary tumor cells.
[0003] Disadvantages of existing technology:
[0004] (1) Cells from non-paraneuroma sources lack specificity and cannot actually simulate the true phenotype of carotid bulb paraganglioma.
[0005] (2) Primary tumor cells grow slowly and cannot be passaged. They are greatly affected by patients and clinical diagnosis, which affects the scope of application in actual research.
[0006] The extraction and culture of primary cells is quite complex, resulting in low cell yield, long experimental cycles, inconsistent cell genotype backgrounds, and the presence of a large number of non-tumor cells. Summary of the Invention
[0007] To address the aforementioned technical problems in the prior art, this invention provides an immortalized human carotid bulb paraganglioma cell line and its uses. This immortalized human carotid bulb paraganglioma cell line and its uses aim to solve the technical problem that the lack of suitable carotid bulb tumor cell lines in the prior art has greatly limited basic research on tumor occurrence and development.
[0008] This invention provides an immortalized cell line of human carotid bulb paraganglioma, in which the SDHD gene contains c.6A>A, 178_182delAAGGC.
[0009] This invention provides an immortalized cell line of human carotid bulb paraganglioma, with accession number CGMCC NO.45756, named PGL-1120; classified as: human carotid bulb paraganglioma immortalized cell line; accession date: December 19, 2024; deposited at the China General Microbiological Culture Collection Center (CGMCC), address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing.
[0010] The above-mentioned screening method for immortalized human carotid bulb paraganglioma cell lines includes the following steps:
[0011] (1) Screening of human carotid glomus tumor cells;
[0012] (2) Primary cells of carotid bulb paraganglioma were extracted and cultured and passaged;
[0013] (3) Immunofluorescence identification of cells;
[0014] (4) Vector construction and viral packaging of viral plasmids: SV40 overexpression lentivirus was used for vector construction.
[0015] (5) Plasmid transfection of immortalized primary tumor cells;
[0016] (6) Screening of transfected primary cells;
[0017] (7) Amplification and identification of immortalized cell lines.
[0018] The present invention also provides the use of the above-mentioned immortalized human carotid bulb paraganglioma cell line, selected from any one or more of the following:
[0019] a. Prepare a human carotid bulb paraganglioma cell model or prepare a human carotid bulb paraganglioma animal model;
[0020] b. Screening and / or evaluating / preparing drugs for the treatment of human carotid bulb paraganglioma;
[0021] c. Develop drug targets for human carotid bulb paraganglioma;
[0022] d. Preparation of diagnostic products for human carotid bulb paraganglioma;
[0023] e. Develop bioengineered products for detecting human carotid bulb paraganglioma.
[0024] The immortalized cell line of human carotid bulb paraganglioma of the present invention is obtained by using retrovirus-mediated gene transformation technology. The primary tumor cells were extracted and cultured from a 50-year-old female patient with a clinical and pathological diagnosis of right carotid bulb paraganglioma. The primary cells were immortalized using EF1α-SV40-IRES-puromycin lentivirus.
[0025] Immunohistochemistry and molecular biology techniques were used to identify that the immortalized tumor cell lines originated from carotid bulb accessory ganglion cells. At the same time, gene sequencing of the immortalized cell lines showed the presence of the SDHD gene mutation site (EO3 exon c.178_182delAAGGC, truncated mutation).
[0026] Animal experiments of this invention have shown that the cell line possesses tumorigenic properties in immunodeficient mice and nude mice. Experiments have confirmed that the established cell line retains many characteristics of the tumor itself. This tumor cell line is derived from human carotid bulb paraganglioma. This cell line will contribute to current basic research and drug treatment of carotid bulb paraganglioma.
[0027] Compared with existing technologies, the technical effects of this invention are positive and obvious.
[0028] (1) The presence of SDHD gene mutations can simulate the carotid bulb paraganglioma phenotype in the actual human SDHD gene mutation background.
[0029] (2) The cell line has been immortalized and can be cultured and passaged in large quantities. The culture requirements are relatively simple, and a large number of experimental cells can be obtained in a short time, with a short overall experimental cycle.
[0030] (3) The obtained cells have a consistent genotype background and are free of impurity cells, making them more suitable for basic experiments than primary cells and suitable for promotion. Attached Figure Description
[0031] Figure 1 A schematic diagram illustrating the identification of pathological point mutations in SDHD through gene sequencing.
[0032] Figure 2 The results of observation after 100x magnification of the isolated and cultured human carotid glomus tumor cells.
[0033] Figure 3 The results of immunofluorescence detection of isolated and cultured human carotid glomus tumor cells.
[0034] Figure 4 This is a structural diagram of a lentiviral vector overexpressing SV40.
[0035] Figure 5 The results are observed after transfection of isolated and cultured human carotid glomus tumor cells at a magnification of 100x.
[0036] Figure 6 The results of the expansion observation of immortalized human carotid glomus tumor cells isolated and cultured (50X).
[0037] Figure 7 The results of the expansion of immortalized human carotid glomus tumor cells isolated and cultured (left: 100X, right: 200X).
[0038] Figure 8 Nude mice inoculated with immortalized human carotid glomus tumor cells isolated and cultured according to the present invention showed tumor formation. Detailed Implementation
[0039] The equipment and reagents used in this invention are described below:
[0040] (1) Instruments
[0041] .
[0042] (2) Reagents and consumables
[0043] .
[0044] Example 1
[0045] 1. Screening and diagnosis of human carotid glomus tumor cells
[0046] (1) Preoperative screening of patients with a clear diagnosis of carotid glomus tumor: Patients were screened by intracranial MRI examination. Enhanced intracranial MRI showed significant enhancement of the right carotid foramen with mixed low signal, which was a manifestation of carotid glomus tumor.
[0047] (2) Intraoperative and postoperative pathological diagnosis of carotid bulb paraganglioma;
[0048] (3) Tumor tissue gene sequencing confirmed the presence of a pathologically significant point mutation in the SDHD gene (EO3 exon c.178_182delAAGGC).
[0049] The table below contains patient information. All experiments in this invention were conducted in accordance with hospital medical ethics regulations. Figure 1 A schematic diagram illustrating the identification of pathological point mutations in SDHD through gene sequencing.
[0050] Figure 1 The E03 exon mutation sequence is shown below:
[0051] AGAGATATGCCTTCAAAAACAGAGATAGCTTCTCTCAACTACTATTTTGATATTTTACTTCCTTTGTACTCAGAGTTATATCCTATATGTACACTGCCTGTCAGTTTGGGTTACTGTGTGGCATAGTTGAACATGAAAGATGTGTGTTTCTCACATCAACTTTTATGAATCTGGTCCTTTTTGTAGCTGGCTCCTGCGTCTCTCCACTGGACTAG AGAAAGGGTTGGCATTGTTTTGCTCCTGGGTCTGCTTCCCGCTGCTTATTTGAATCCTTGCTCTGCTATGGACTATTCCCTGGCTGCACCCCTCACTCTTCTTGGTCACTGGCAAGTATAGCAATTCCAAATATAATTGTCTGCTCAGTTTGTTTGCTGTGATCTTGTCTTATGTATTATATATGAGGGAGAAGAAAATTTGAAATGAAATGA (SEQ ID NO.1).
[0052] The exon nucleotide sequence of the SDHD gene is shown below (NM_003002.3) (SEQ ID NO.2).
[0053] Specifically:
[0054] E01:ATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTTGCGGTGCCCTAGGAGGCCGAG
[0055] E02:CTCTGTTGCTTCGAACTCCAGTGGTCAGACCTGCTCATATCTCAGCATTTCTTCAGGACCGACCTATCCCAGAATGGTGTGGAGTGCAGCACATACACTTGTCACCGAGCCACCATT
[0056] E03:CTGGCTCCAAGGCTGCATCTCTCCACTGGACTAGCGAGAGGGTTGTCAGTGTTTTGCTCCTGGGTCTGCTTCCGGCTGCTTATTTGAATCCTTGCTCTGCGATGGACTATTCCCTGGCTGCAGCCCTCACTCTTCATGGTCACTG
[0057] E04:GGGCCTTGGACAAGTTGTTACTGACTATGTTCATGGGGATGCCTTGCAGAAAGCTGCCAAGGCAGGGCTTTTGGCACTTTCAGCTTTAACCTTTGCTGGGCTTTGCTATTTCAACTATCACGATGTGGGCATCTGCAAAGCTGTTGCCATGCTGTGGAAGCTCTGA.
[0058] Currently, basic research on carotid bulb paragangliomas is extremely lacking, and there are no immortalized cell lines of this type of tumor available for experiments. This invention is the first to isolate and culture carotid bulb paragangliomas by sampling tissue, and sequencing revealed the presence of a pathological mutation in the SDHD gene, making it the first carotid bulb paraganglioma cell line with an SDHD gene mutation.
[0059] 2. Isolation and culture of human carotid glomus tumor cells, including the following steps:
[0060] 1) Place the tissue removed during surgery in sterile PBS buffer for low-temperature transport;
[0061] 2) Remove the tissue from the laminar flow hood, soak it in 75% alcohol for 2 minutes, and then place it in PBS solution containing P / S;
[0062] 3) Cut the tissue block into squares with a side length of about 0.1 cm, wash repeatedly and discard the supernatant, place in a petri dish containing complete culture medium, and incubate at 37°C for 30~60 min;
[0063] Culture conditions: DMEM / F12 medium + cell additive; DMEM / F12 medium was used as the basic tumor culture medium, and the pH was maintained at 7.70.
[0064] The cell culture additives include the following concentrations: 5 ng / ml recombinant human vascular endothelial growth factor, 5 ng / ml recombinant human epidermal growth factor, 5 ng / ml recombinant human basic fibroblast growth factor, 15 ng / ml recombinant human insulin-like growth factor, 1 ug / ml hydrocortisone monosuccinate, and 50 ug / ml vitamin C.
[0065] 4) Use tweezers to place it into the culture flask, invert it and incubate it in a 5% CO2 incubator for 2 hours;
[0066] 5) Add 2 ml of complete tumor cell culture medium to each tissue block, but do not allow the tissue block to float, and place it in a 5% CO2 cell culture incubator;
[0067] 6) Change the medium every 3 days. Once the cells growing around the tissue block have fused together, remove the tissue block, digest the cells with trypsin, and re-coat the bottle.
[0068] Cell culture images as shown Figure 2 As shown: The cells under the microscope are clear and intact, spindle-shaped, and have protrusions.
[0069] 3. Immunofluorescence identification
[0070] 3.1 Experimental Procedure
[0071] (1) Cell crawling slices
[0072] Place 3 glass slides into a 24-well plate, add 1 mL of culture medium to each well, and add 0.02 million cells / well obtained in Example 1. Incubate for 2 hours or overnight.
[0073] (2) Fixed
[0074] After cell culture, aspirate the culture medium, wash once with PBS, add 4% PFA and fix at 4°C for 30 min. Wash with PBS 3 times for 5 min each time. Alternatively, the PBS can be left on for the last wash and the cells can be incubated overnight at 4°C.
[0075] (3) Membrane rupture and sealing
[0076] Remove the moisture from the glass slide and place it on the petri dish support;
[0077] Glass slide blocking solution preparation: Mix 0.5% Trition X-100 with PBS at a 1:1 ratio, then add 10% serum.
[0078] Take 50 μL of membrane-breaking and sealing solution and drop it onto the waterproof membrane. Cover the glass slide with the side containing cells for 2 hours.
[0079] (4) Primary antibody incubation
[0080] Primary antibody preparation: Antibody (S100 (central nervous system specific protein), Chromagrain A (chromaffin A)). Synaptophysin (Syntoplasmin, Proteintech) diluted 1:100 (200) with PBS;
[0081] After the membrane is broken and sealed, take 50 μL of primary antibody onto the waterproof membrane (in a humidified chamber), cover it with a glass slide (with the cell side) and place it at 4°C (it can be stored for up to one week).
[0082] (5) Secondary antibody incubation
[0083] Incubate the secondary antibody (DAPI, Solarbio; Alexa Fluor® 488 Phalloidin, Recombinant Secondary Antibody, Alexa Fluor™ 647, Thermo) (secondary antibody:PBS=1:500) at room temperature in the dark for 2 hours, then wash with PBS 3 times for 5 minutes each time, stain with DAPI (DAPI:PBS=1:1000) for 5 minutes, and wash with PBS 3 times for 5 minutes each time.
[0084] (6) Embedding
[0085] Place one drop of Fluoromount-G (mounting agent) on each slide and cover the side with cells.
[0086] The cells were identified as P1 generation cells.
[0087] 3.2 Immunofluorescence identification results as follows Figure 3 As shown. The results showed that the cells under the microscope contained tumor-specific proteins S100 (central nervous system-specific protein) and Chromagrain A (chromaffin A). Synaptophysin (Syntoplasmin). Staining (green) is clearly positive.
[0088] Resequencing confirmed the presence of a pathologically significant point mutation in the SDHD gene (EO3 exon c.178_182delAAGGC).
[0089] 4. Transfection
[0090] 4.1 Basic Information on SV40 Overexpression Lentiviral
[0091] Vectors were constructed using SV40 overexpression lentivirus.
[0092] The basic information of the SV40 overexpression lentivirus is as follows:
[0093] SV40 overexpression lentivirus (from Vivegen Biosciences), vector EF1α-SV40-IRES-puromycin, carrying the Puromycin resistance gene marker. See the vector map below. Figure 4 Its sequence information is shown in SEQ ID NO.3.
[0094] The target sequence information of the vector is as follows:
[0095] gtggttcaaagtttttttcttccatttcaggtgtcgtgaggatctatttccggtgaattc atggataa agttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgcctgggggaatattcct ctgatgagaaaggcatatttaaaaaaatgcaaggagtttcatcctgataaaggaggagatgaagaaaaaatgaaga aaatgaatactctgtacaagaaaatggaagatggagtaaaatatgctcatcaacctgactttggaggcttctggga tgcaactgagattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaacctgttt tgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaacattctactcctccaaaaaagaaga gaaaggtagaagaccccaaggactttccttcagaattgctaagttttttgagtcatgctgtgtttagtaatagaac tcttgcttgctttgctatttacaccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattct gtaacctttataagtaggcataacagttataatcataacatactgttttttcttactccacacaggcatagagtgt ctgctattaataactatgctcaaaaattgtgtacctttagctttttaatttgtaaaggggttaataaggaatattt gatgtatagtgccttgactagagatccattttctgttattgaggaaagtttgccaggtgggttaaaggagcatgat tttaatccagaagaagcagaggaaactaaacaagtgtcctggaagcttgtaacagagtatgcaatggaaacaaaat gtgatgatgtgttgttattgcttgggatgtacttggaatttcagtacagttttgaaatgtgtttaaaatgtattaa aaaagaacagcccagccactataagtaccatgaaaagcattatgcaaatgctgctatatttgctgacagcaaaaac caaaaaaccatatgccaacaggctgttgatactgttttagctaaaaagcgggttgatagcctacaattaactagag aacaaatgttaacaaacagatttaatgatcttttggataggatggatataatgtttggttctacaggctctgctga catagaagaatggatggctggagttgcttggctacactgtttgttgcccaaaatggattcagtggtgtatgacttt ttaaaatgcatggtgtacaacattcctaaaaaaagatactggctgtttaaaggaccaattgatagtggtaaaacta cattagcagctgctttgcttgaattatgtggggggaaagctttaaatgttaatttgcccttggacaggctgaactt tgagctaggagtagctattgaccagtttttagtagtttttgaggatgtaaagggcactggaggggagtccagagat ttgccttcaggtcagggaattaataacctggacaatttaagggattatttggatggcagtgttaaggtaaacttag aaaagaaacacctaaataaaagaactcaaatatttccccctggaatagtcaccatgaatgagtacagtgtgcctaa aacactgcaggccagatttgtaaaacaaatagattttaggcccaaagattatttaaagcattgcctggaacgcagt gagtttttgttagaaaagagaataattcaaagtggcattgctttgcttcttatgttaatttggtacagacctgtgg ctgagtttgctcaaagtattcagagcagaattgtggagtggaaagagagattggacaaagagtttagtttgtcagt gtatcaaaaaatgaagtttaatgtggctatgggaattggagttttagattggctaagaaacagtgatgatgatgat gaagacagccaggaaaatgctgataaaaatgaagatggtggggagaagaacatggaagactcagggcatgaaacag gcattgattcacagtcccaaggctcatttcaggcccctcagtcctcacagtctgttcatgatcataatcagccata ccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacagagcaaaagctc atttctgaagaggacttgtaa tctagacacagtgcagcactctcaacgttcaaggacactacgcgtctggaacaatcaacc (SEQ ID NO.3)
[0096] The italicized, underlined region is the target sequence region.
[0097] 4.2 Transfection process
[0098] (1) The cells obtained in Example 1 were seeded into 6-well plates, with approximately 1 × 10⁶ cells per well. 5 indivual;
[0099] (2) On the second day, after the cells have adhered to the wall, change the medium;
[0100] (3) Add 1 mL of complete culture medium, and then add 20 μL of SV40 overexpressing lentivirus;
[0101] (4) Mix well and continue culturing;
[0102] (5) Observe the cell status after 12 hours and replace with fresh culture medium;
[0103] (6) Once the cells have filled the bottom of the plate, they are passaged into T25 culture flasks.
[0104] Cells were observed under a microscope after transfection; the results are shown below. Figure 5 Microscopic images after lentiviral transfection show clear and intact cell morphology.
[0105] 5. Filtering
[0106] 5.1 Determination of the kill curve
[0107] (1) Seed untransfected cells into 24-well plates at a density of 0.05 million per well and incubate overnight;
[0108] (2) On the second day, remove the old culture medium from the 24-well plate;
[0109] (3) Add fresh culture medium containing different concentrations of puromycin (1ug / mL, 2ug / mL, 3ug / mL, 4ug / mL, 5ug / mL, 6ug / mL, 7ug / mL) to a 24-well plate that has been coated with cells;
[0110] (4) Replace the screening medium with fresh medium every 2 days;
[0111] (5) Observe the cell survival rate daily;
[0112] (6) The minimum concentration of puromycin used is the lowest screening concentration that kills all cells within 1-4 days from the start of puromycin screening.
[0113] Results: The concentration of puromycin used was 1 ug / mL, and the treatment time was 2 days.
[0114] 5.2 Puromycin screening of transfected cells
[0115] (1) On the first day, the transfected cells were seeded into 24-well plates at a density of 0.05 million per well and incubated overnight.
[0116] (2) On the second day, remove the old culture medium from the 24-well plate.
[0117] (3) Add selection medium containing puromycin (1ug / mL), incubate,
[0118] (4) Replace the screening medium with fresh medium every 2 days.
[0119] (5) Observe the cell survival rate daily.
[0120] (6) Cells that survive at the same time point (2d) are considered successfully transfected cells.
[0121] (7) Expand the selected cells.
[0122] 6. Cell Expansion
[0123] The selected cells were then amplified to P1 generation, and amplification was continued for at least 12 generations.
[0124] The P1 generation cell line was preserved.
[0125] The cell line preservation information for this invention is as follows:
[0126] Cell line classification and nomenclature: Immortalized cell line of human carotid bulb paraganglioma;
[0127] Named: PGL-1120;
[0128] The accession number is: CGMCC NO.45756;
[0129] Deposit date: December 19, 2024;
[0130] Name of the depository: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures;
[0131] Abbreviation of depositary institution: CGMCC;
[0132] Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0133] Immortalized human carotid bulb paraganglioma cells were cultured in 100 μL of complete culture medium. The purified cell line (12th generation) was mixed with the complete culture medium and seeded into a 96-well plate. The cells were cultured in a constant temperature incubator at 37°C and 5% CO2 for 24-48 hours. After treatment with 10 μL of CCK8 (#CK04 Dojindo) for 1-2 hours, the absorbance was measured at 450 nm using a microplate reader. The cell proliferation activity rate was then calculated according to the CCK8 kit method.
[0134] The results are as follows:
[0135] .
[0136] Images of immortalized cells, such as Figure 6, 7 As shown, a carotid bulb paraneuroma cell line with stable growth and passage was obtained.
[0137] As shown in the table above, the immortalized cells exhibit high proliferative activity. Images of the 12th generation immortalized cells can be found [link to table]. Figure 7 The morphology of the immortalized cells after passage culture showed virtually no significant changes. Both 100x and 200x magnification observations indicated that the immortalized cells after expansion possessed high purity.
[0138] 7. Tumor formation characteristics experiment in nude mice
[0139] In vivo experiments were conducted to establish a xenograft model, using the aforementioned immortalized cells (2 × 10⁻⁶). 6 0.1 mL PBS was subcutaneously injected into the backs of three 4-week-old BALB / c nude mice. Tumors were allowed to grow for 14 days, and a final photograph was taken to measure the tumor diameter and volume (mm²). 3 The volume is calculated as follows by measuring the longest and shortest diameters of the tumor: Volume = (Shortest diameter) 2 × (longest diameter) × 0.5, mice were euthanized after inhaling 100% carbon dioxide, resulting in cervical dislocation.
[0140] like Figure 8 As shown, tumor cells from all three mice developed into tumors after implantation, with an average volume of approximately 48 mm². 3 .
[0141] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent variations made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and variations made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. An immortalized cell line of human carotid bulb paraganglioma, characterized in that, In its SDHD gene, c.6A>A, 178_182delAAGGC.
2. An immortalized cell line of human carotid bulb paraganglioma, with accession number CGMCC NO.45756.
3. The use of the immortalized human carotid bulb paraganglioma cell line according to claim 1 or 2, characterized in that... Choose from one or more of the following: a. Prepare a human carotid bulb paraganglioma cell model or prepare a human carotid bulb paraganglioma animal model; b. Screening and / or evaluating / preparing drugs for the treatment of human carotid bulb paraganglioma; c. Develop drug targets for human carotid bulb paraganglioma; d. Preparation of diagnostic products for human carotid bulb paraganglioma; e. Develop bioengineered products for detecting human carotid bulb paraganglioma.
Citation Information
Patent Citations
Human acoustic neuroma immortalized cell line, preparation method and application thereof
CN110904051A
Immortalized human jugular bulb paraganglioma cell line and applications thereof
CN111454990A
Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof
CN114807043A