Acetaldehyde dehydrogenase as well as coding gene and application thereof

Abstract

The invention belongs to the technical field of genetic engineering and microorganisms, particularly relates to acetaldehyde dehydrogenase and a coding gene thereof, and further discloses application of the acetaldehyde dehydrogenase in the field of fermentation production of malonic acid. The invention discloses acetaldehyde dehydrogenase capable of efficiently catalyzing dehydrogenation of malonic semialdehyde to generate malonic acid and a production process of the acetaldehyde dehydrogenase applied to the malonic acid. According to the present invention, the acetaldehyde dehydrogenase derived from Bacillus licheniformis ATCC 14580 is screened, the activity of the acetaldehyde dehydrogenase for catalytic production of malonic acid is verified to be significantly higher than the activity of the aldehyde dehydrogenase derived from other sources, the DhaS derived from the Bacillus licheniformis ATCC 14580 is further used to construct the engineering bacteria for fermentation production of malonic acid, the metabolic bottleneck of biosynthesis of malonic acid can be removed, and the malonic acid synthesis effect is effectively improved.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial technology, specifically relating to an acetaldehyde dehydrogenase and its encoding gene, and further disclosing its application in the fermentation production of malonic acid. Background Technology

[0002] Malic acid, also known as malic acid, is a very important organic dicarboxylic acid that exists in nature as a calcium salt in beetroots. Due to the activation of the two methylene groups by the carboxyl groups in its molecule, malonic acid can participate in various types of chemical reactions, leading to its wide range of applications in multiple fields. For example, in the pharmaceutical field, malonic acid serves as an important intermediate in the synthesis of barbiturates, vitamin B1, and vitamin B2; in agriculture, it is used as an intermediate in plant growth regulators to improve crop yield and quality; in the chemical industry, it is used as an aluminum surface treatment agent, as its decomposition upon heating produces only water and carbon dioxide, offering environmental advantages; and in the food industry, it is used as a food additive to enhance food flavor. Therefore, the production of malonic acid has always attracted widespread attention.

[0003] Currently, malonic acid is commonly prepared industrially through the hydrolysis of cyanoacetic acid or diethyl malonate, or by using acetic acid as a raw material. However, these synthetic methods suffer from drawbacks such as complex reaction processes, the use of numerous reagents, and high production costs. In recent years, microbial fermentation for malonic acid synthesis has gradually attracted researchers' attention due to its higher theoretical yield and simpler waste treatment process. Currently, the most studied metabolic pathway is glucose → β-alanine → malonyl half-aldehyde → malonic acid. However, the lack of efficient malonyl half-aldehyde dehydrogenase results in typically low malonic acid yields and the production of large amounts of β-alanine as a byproduct of fermentation. Therefore, screening for efficient malonyl half-aldehyde dehydrogenase is crucial to overcoming the metabolic bottleneck in malonic acid synthesis and thus increasing malonic acid fermentation yield. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide an acetaldehyde dehydrogenase and its encoding gene, wherein the acetaldehyde dehydrogenase breaks through the metabolic bottleneck of efficient synthesis of malonic acid and can efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid.

[0005] The second technical problem to be solved by the present invention is to provide the application of the above-mentioned acetaldehyde dehydrogenase and its encoding gene in the field of catalytic dehydrogenation of malonic acid hemialdehyde to prepare malonic acid;

[0006] The second technical problem to be solved by the present invention is to provide a method for preparing malonic acid by enzyme-catalyzed dehydrogenation of malonic acid hemialdehyde.

[0007] To address the aforementioned technical problems, this invention screened aldehyde dehydrogenases from different bacterial genera with significant evolutionary differences. Among them, the aldehyde dehydrogenase from Bacillus licheniformis ATCC 14580 exhibited the best catalytic effect. Furthermore, the DhaS gene of aldehyde dehydrogenase from B. licheniformis ATCC 14580 was used to construct a recombinant engineered bacterium for fermentation production of malonic acid. This can overcome the metabolic bottleneck in the biosynthesis of malonic acid and efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid.

[0008] In a first aspect, the present invention provides an aldehyde dehydrogenase encoding gene dhaS, wherein the aldehyde dehydrogenase encoding gene dhaS is derived from Bacillus licheniformis ATCC 14580, and the aldehyde dehydrogenase encoding gene dhaS has at least one of the following characteristics:

[0009] (1) The acetaldehyde dehydrogenase encoding gene dhaS has the nucleotide sequence shown in SEQ ID No. 7;

[0010] (2) The acetaldehyde dehydrogenase encoding gene dhaS has a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID No. 7, and has the same or similar function as the nucleotide sequence shown in SEQ ID No. 7;

[0011] (3) The acetaldehyde dehydrogenase encoding gene dhaS has a nucleotide sequence that is at least 80% homologous to the nucleotide sequence shown in SEQ ID No. 7.

[0012] In a second aspect, the present invention provides an acetaldehyde dehydrogenase encoded by the acetaldehyde dehydrogenase encoding gene dhaS.

[0013] The acetaldehyde dehydrogenase is derived from Bacillus licheniformis ATCC 14580 and can efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid.

[0014] Thirdly, the present invention provides a recombinant expression vector carrying the acetaldehyde dehydrogenase encoding gene dhaS.

[0015] In some embodiments, the recombinant expression vector comprises the recombinant plasmid pACYC-Ptrc-dhaS.

[0016] In some specific embodiments of the present invention, the recombinant expression vector further includes at least one of the following (1)-(4):

[0017] (1) Strong promoters and / or strong RBS;

[0018] (2) Derived from the panD gene of Bacillus subtilis W168;

[0019] (3) The pa0132 gene derived from Pseudomonas aeruginosa PAO1;

[0020] (4) Increased the copy number of sthA and / or ppc genes.

[0021] In some embodiments, the recombinant expression vector comprises the recombinant plasmid pRSF-Ptrc-ppc-panD-pa0132-sthA-dhaS.

[0022] Fourthly, the present invention provides a recombinant host that expresses the acetaldehyde dehydrogenase encoding gene dhaS or the recombinant expression vector.

[0023] In some implementations, the recombinant host further includes a second recombinant expression vector;

[0024] Specifically, the second recombinant expression vector includes at least one of the following (1)-(4):

[0025] (1) Strong promoters and / or strong RBS;

[0026] (2) Derived from the panD gene of Bacillus subtilis W168;

[0027] (3) The pa0132 gene derived from Pseudomonas aeruginosa PAO1;

[0028] (4) Increased the copy number of sthA and / or ppc genes.

[0029] In some embodiments, the second recombinant expression vector includes pRSF-Ptrc-ppc-panD-pa0132-sthA.

[0030] In some implementations, the recombinant host includes a recombinant host cell or a recombinant host bacterium.

[0031] Fifthly, the present invention provides a method for constructing the recombinant host, comprising the step of transfecting or transforming the recombinant expression vector into the host.

[0032] As a preferred embodiment, the method for constructing the recombinant host further includes the step of transfecting or transforming the second recombinant expression vector into the host.

[0033] As some feasible options, the host includes Escherichia coli; preferably, the host includes Escherichia coli K12; more preferably, the host includes Escherichia coli K12 W3110 strain.

[0034] In a sixth aspect, the present invention provides the application of the acetaldehyde dehydrogenase encoding gene dhaS, the acetaldehyde dehydrogenase, the recombinant expression vector, and the recombinant host in the field of malonic acid production.

[0035] In a seventh aspect, the present invention provides a method for preparing malonic acid, comprising the step of inducing fermentation with the recombinant host.

[0036] As one feasible approach, the method for preparing malonic acid includes an induced fermentation step in a fermentation medium containing malonyl hemialdehyde as a substrate.

[0037] As a preferred embodiment, the induced fermentation step includes inoculating the recombinant host into the fermentation medium for fermentation for 3-40 hours, adding an inducer for further fermentation for 0.5-30 hours, and adding malondialdehyde as a substrate for further fermentation.

[0038] As an feasible approach, in the method for preparing malonic acid:

[0039] The fermentation medium includes a carbon source, a nitrogen source, inorganic ions, antibiotics, and nutrient factors; and / or,

[0040] The initial pH of the fermentation medium is 5-8; and / or,

[0041] The inducer includes at least one of IPTG, lactose, or allolactose; and / or,

[0042] The amount of the inducer added is 0.01-1 mmol; and / or,

[0043] The temperature for the induced fermentation step is 25-45℃; and / or,

[0044] The induction fermentation step takes 5-48 hours.

[0045] Eighthly, the present invention also provides a method for preparing a catalytic enzyme system containing acetaldehyde dehydrogenase, wherein the catalytic enzyme system can be used to catalyze the production of malonic acid from malondialdehyde as a substrate.

[0046] Specifically, the preparation method of the catalytic enzyme system containing acetaldehyde dehydrogenase may include at least one of the following methods:

[0047] The acetaldehyde dehydrogenase encoding gene dhaS is ligated into an expression vector to construct a recombinant expression vector; the recombinant expression vector is then transformed into a host cell for culture and expression, and the desired acetaldehyde dehydrogenase is isolated from the resulting culture; or...

[0048] The recombinant expression vector is transferred into a host cell for culture and expression, and the desired acetaldehyde dehydrogenase is isolated from the resulting culture; or...

[0049] The recombinant host was induced and cultured, and the desired acetaldehyde dehydrogenase was isolated from the resulting culture.

[0050] This invention discloses an acetaldehyde dehydrogenase that can efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid and its application in the production process of malonic acid. This invention screened an acetaldehyde dehydrogenase derived from Bacillus licheniformis ATCC 14580 and verified that its activity in catalyzing the production of malonic acid is significantly higher than that of aldehyde dehydrogenases from other sources. Furthermore, an engineered strain for fermentation production of malonic acid was constructed using DhaS derived from B. licheniformis ATCC 14580, which can overcome the metabolic bottleneck in the biosynthesis of malonic acid and effectively improve the efficiency of malonic acid synthesis.

[0051] The enzyme-catalyzed synthesis of malonic acid described in this invention utilizes recombinant engineered bacteria. Compared with the highly polluting chemical method for producing malonic acid, it has advantages such as renewable raw materials and easy treatment and resource utilization of waste residue, wastewater, and waste gas. Therefore, it can be used in practice for the industrial production of malonic acid and has important application value. Detailed Implementation

[0052] The following embodiments of the present invention specifically disclose the application of screened acetaldehyde dehydrogenase and its encoding gene in the fermentation production of malonic acid. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit, and scope of the present invention to realize and apply the technology of the present invention.

[0053] In the following embodiments of the present invention, aldehyde dehydrogenases from different bacterial genera with significant evolutionary differences were screened to further screen enzyme systems that can efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid. Screening and induction experiments confirmed that the aldehyde dehydrogenase from *Bacillus licheniformis* ATCC 14580 exhibited the best catalytic effect. Furthermore, the DhaS gene of the aldehyde dehydrogenase from *B. licheniformis* ATCC 14580 was used to construct a recombinant engineered bacterium for fermentation production of malonic acid. This can overcome the metabolic bottleneck in the biosynthesis of malonic acid and efficiently catalyze the dehydrogenation of malonic acid hemialdehyde to produce malonic acid.

[0054] In the following embodiments of the present invention, the screened aldehyde dehydrogenases are: glutarate hemialdehyde dehydrogenase BSn5_13560 from Bacillus subtilis BSn5, lactaldehyde dehydrogenase HR38_17865 from Klebsiella michiganensis M1, 2,5-dioxovalerate dehydrogenase ABAZ39_21335 from Azospirillumbrasilense Az39, benzaldehyde dehydrogenase PP_1948 from Pseudomonas putida KT2440, phenylacetaldehyde dehydrogenase PADK2_03960 from Pseudomonas aeruginosa DK2, and acetaldehyde dehydrogenase PADK2_03960 from Escherichia coli. The following bacteria are listed: formaldehyde dehydrogenase FrmA (from Bacillus licheniformis ATCC 14580), acetaldehyde dehydrogenase DhaS (from Bacillus cereus ATCC 14579), glyceraldehyde-3-phosphate dehydrogenase BC0868 (from Bacillus cereus ATCC 14579), vanillin dehydrogenase LigV (from Sphingobium sp. SYK-6), succinate semialdehyde dehydrogenase Pput_0228 (from Pseudomonas putida F1), salicylaldehyde dehydrogenase A458_06710 (from Pseudomonas monasstutzeri CCUG 29243), and glycolaldehyde dehydrogenase AldA (from Cronobacter erturicensis).

[0055] In the following embodiments of the present invention, for screening highly efficient aldehyde dehydrogenases, the pACYCDuet-1 plasmid was used to express the above-mentioned 12 different types of aldehyde dehydrogenases from different sources. The pACYCDuet-1 plasmid is a low-copy plasmid; using this plasmid for enzyme screening avoids the weakening of the catalytic performance differences between different enzymes due to the large-scale expression of the target gene, thus making the comparison results more rigorous.

[0056] In the following embodiments of the present invention, for screening highly efficient aldehyde dehydrogenases, 12 recombinant plasmids were constructed by ligating the above 12 gene sequences into the pACYCDuet-1 plasmid, all of which used the trc promoter for expression regulation. The plasmid vectors used in this invention can be pDuet-1 series vectors, such as pRSFDuet-1, pETDuet-1, pCDFDuet-1, etc.; or they can be pET series vectors or other E. coli expression vectors. Furthermore, the promoters of this invention can be tac, trp, lac promoters, etc.

[0057] In the following embodiments of the present invention, the above-mentioned recombinant plasmid was further transformed into *Escherichia coli* K12W3110 to obtain a whole-cell catalytic engineered bacterium. Typically, the trc-target gene and the vector are constructed through homologous recombination. The recombinant plasmid can be transformed into host cells using conventional methods in molecular biology experiments, such as calcium chloride chemical transformation or electroporation transformation, to obtain engineered bacteria suitable for whole-cell catalysis.

[0058] In the following embodiments of the present invention, a whole-cell catalysis method can be used to screen for highly efficient aldehyde dehydrogenases. In the whole-cell catalysis process of the present invention, bacterial cells are first cultured in a liquid culture medium, and aldehyde dehydrogenase expression is induced at an appropriate time. The culture medium used for the growth of engineered bacteria can be a rich medium or an inorganic salt medium.

[0059] In one feasible manner, the culture medium comprises a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutrient factors. As a carbon source, sugars such as glucose, lactose, and galactose can be used; alcohols such as glycerol and mannitol can also be used; and organic acids such as gluconic acid, citric acid, and succinic acid can also be used. As an inorganic nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used; and organic nitrogen sources such as corn steep liquor, soybean meal hydrolysate, hair powder, yeast extract, and peptone can also be used. Inorganic ions include one or more of the following: iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium. Other nutrient factors include vitamins such as vitamin B1, pyridoxal, and biotin.

[0060] As a feasible approach, the cultivation process is preferably carried out under aerobic conditions for approximately 548 hours, with the cultivation temperature typically controlled between 25-45℃ and the pH between 5-8. During the induction culture, it is preferable to add at least one inducer selected from IPTG, lactose, and allolactose starting after 3-40 hours of cultivation. The inducer can be added once, intermittently, or continuously, with the amount added being 0.01-1 mmol. Then, 0.5-30 hours after adding the inducer, the substrate malondialdehyde is added in a single dose, and fermentation continues until the endpoint.

[0061] As a feasible approach, during the dehydrogenation of malondialdehyde to produce malonic acid, the pH of the catalyst solution continuously decreases. Therefore, an alkali needs to be added to maintain the pH within a range favorable for whole-cell catalysis, typically above 5.0, preferably above 6.0, more preferably above 6.5, and typically below 8.0, preferably below 7.5, more preferably below 7.0. The alkali used here is ammonia or sodium hydroxide; it can be added intermittently or continuously to maintain the pH within the above range, or it can be added based on feedback from the pH electrode signal in the fermenter to maintain a constant pH value.

[0062] As a possible implementation method, the temperature of the entire induced catalytic reaction is typically between 25°C and 60°C, preferably between 30°C and 45°C. The temperature during the catalytic process can be set to a fixed value within the above range, or it can be a value that varies from low to high.

[0063] In the following embodiments of the present invention, the highly efficient aldehyde dehydrogenase selected through screening is further applied to construct malonic acid producing bacteria, which can effectively relieve the metabolic bottleneck in the biosynthesis of malonic acid.

[0064] As an implementable method, the *E. coli* strain used in the fermentation process for producing malonic acid according to the present invention overexpresses the *E. coli*-derived *ppc* gene to increase the supply of the upstream precursor oxaloacetate; overexpresses the *panD* gene derived from *Bacillus subtilis* to enhance the metabolic flux of the β-alanine pathway; overexpresses the *pa0132* gene derived from *Pseudomonas aeruginosa* to catalyze the synthesis of the direct precursor malonyl hemialdehyde; overexpresses the *E. coli*-derived *sthA* gene to promote the interconversion of NAD+ and NADH, ensuring the redox metabolic balance of *E. coli*; and overexpresses the *dhaS* gene derived from *Bacillus licheniformis* to catalyze the dehydrogenation of malonyl hemialdehyde to produce malonic acid.

[0065] As an implementable method, the recombinant host bacterial construction process of the present invention further includes a step of constructing a second recombinant expression vector. Preferably, the genome of *Escherichia coli* K12 W3110 is used as a template, and the Ptrc-ppc product is amplified by PCR using primers ppc-F and ppc-R; the genome of *Bacillus subtilis* W168 is used as a template, and the panD product is amplified by PCR using primers panD-F and panD-R; the genome of *Pseudomonas aeruginosa* PAO1 is used as a template, and the pa0132 product is amplified by PCR using primers pa0132-F and pa0132-R; the genome of *Escherichia coli* K12 W3110 is used as a template, and the sthA product is amplified by PCR using primers sthA-F and sthA-R; and the pRSFI1 product is amplified by PCR using plasmid pRSFDuet-1 as a template using primers pRSF-F and pRSF-R. The above product was purified and homologously recombined, then chemically transformed into E. coli DH5α competent cells. After 1 hour of recovery, the cells were plated on kanamycin plates and incubated at 37°C for 12 hours. Single colonies were picked, and the recombinant plasmid was extracted and sequenced to obtain the recombinant plasmid pRSF-Ptrc-ppc-panD-pa0132-sthA.

[0066] As an feasible implementation method, in the construction of the recombinant host bacterium described in this invention, for the construction of the recombinant expression vector, the genome of Bacillus licheniformis ATCC 14580 is preferably used as a template, and the Ptrc-dhaS product is obtained by PCR amplification using primers dhaS-F and dhaS-R. The pACYC product is obtained by PCR amplification using plasmid pACYCDuet-1 as a template. After purification of the two products, homologous recombination is performed, followed by chemical transformation into Escherichia coli DH5α competent cells. After thawing for 1 hour, the cells are plated on kanamycin plates and cultured at 37°C for 12 hours. Single colonies are picked, the recombinant plasmid is extracted, and sequenced to obtain the recombinant plasmid pACYC-Ptrc-dhaS.

[0067] As an implementable method, in the process of constructing the recombinant host bacteria described in this invention, the recombinant plasmids pRSF-Ptrc-ppc-panD-pa0132-sthA and pACYC-Ptrc-dhaS constructed above are transformed into the substrate bacteria Escherichia coli K12W3110 to obtain the desired malonic acid producing bacteria.

[0068] The present invention provides a method for fermenting and producing malonic acid, as illustrated in the following embodiments. The experimental culture medium can be any active culture medium commonly used in the art, and exemplary media include a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutrient factors. As a carbon source, sugars such as glucose, lactose, and galactose can be used. As an inorganic nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used; as an organic nitrogen source, organic nitrogen sources such as corn steep liquor, soybean meal hydrolysate, yeast, extracts, and peptone can be used. Inorganic ions include one or more of the following: iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium.

[0069] In the following embodiments of the present invention, the yield of malonic acid in the fermentation broth can be quantitatively determined by HPLC during the entire induced fermentation process. Any method known and feasible in the art can be used as a detection means. An exemplary method is as follows: Take the supernatant of the fermentation broth, dilute it with purified water to an appropriate concentration, and filter it through a 0.22 μm filter membrane. Analysis is performed using a differential detector with the following detection parameters: 5 mmol / L H₂SO₄ as the mobile phase, injection rate of 0.6 mL / min, column temperature of 30 °C, injection volume of 20 μL, and detector temperature of 30 °C.

[0070] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from regular biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, the techniques used in the following examples are conventional methods and commercially available instruments and reagents well known to those skilled in the art. Please refer to *Molecular Cloning: A Laboratory Manual (3rd Edition)* (Science Press), *Microbiology Experiments (4th Edition)* (Higher Education Press), and the manufacturer's instructions for the corresponding instruments and reagents for reference.

[0071] If the sequence described in the instruction manual is inconsistent with the sequence list, the sequence described in the instruction manual shall prevail.

[0072] The technical solution and effects of the present invention will be further illustrated below with reference to the embodiments.

[0073] Example 1

[0074] In this embodiment, an engineered bacterium for producing malonic acid was constructed using a whole-cell catalytic method.

[0075] Twelve aldehyde dehydrogenase genes were synthesized by Genewiz and directly constructed into the pACYCDuet-1 plasmid. The same Ptrc promoter sequence was added before each sequence, as shown in SEQ ID No. 13.

[0076] SEQ ID NO.13:

[0077] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC.

[0078] In this embodiment, the sources and sequences of the 12 aldehyde dehydrogenase genes screened are shown below.

[0079] 1. Glutarate hemialdehyde dehydrogenase BSn5_13560, derived from Bacillus subtilis BSn5, has the gene sequence shown in SEQ ID No. 1;

[0080] SEQ ID NO.1:

[0081]

[0082] 2. Lactaldehyde dehydrogenase HR38_17865, derived from Klebsiella michiganensis M1, has the gene sequence shown in SEQ ID No. 2;

[0083] SEQ ID NO.2:

[0084]

[0085] 3. The 2,5-dioxovalerate dehydrogenase ABAZ39_21335 derived from Azospirillumbrasilense Az39, the gene sequence of which is shown in SEQ ID No. 3;

[0086] SEQ ID NO.3:

[0087]

[0088] 4. PP_1948, a benzaldehyde dehydrogenase derived from Pseudomonas putida KT2440, has the gene sequence shown in SEQ ID No. 4;

[0089] SEQ ID NO.4:

[0090]

[0091] 5. Phenylacetaldehyde dehydrogenase PADK2_03960, derived from Pseudomonas aeruginosa DK2, has the gene sequence shown in SEQ ID No. 5;

[0092] SEQ ID NO.5:

[0093]

[0094] 6. Formaldehyde dehydrogenase FrmA derived from Escherichia coli W, the gene sequence of which is shown in SEQ ID No. 6;

[0095] SEQ ID NO.6:

[0096]

[0097] 7. The acetaldehyde dehydrogenase DhaS, derived from Bacillus licheniformis ATCC 14580, has the gene sequence shown in SEQ ID No. 7;

[0098] SEQ ID NO.7:

[0099]

[0100] 8. Glyceraldehyde-3-phosphate dehydrogenase BC0868, derived from Bacillus cereus ATCC 14579, has the gene sequence shown in SEQ ID No. 8;

[0101] SEQ ID NO.8:

[0102]

[0103] 9. Vanillin dehydrogenase LigV, derived from Sphingobium sp. SYK-6, has the gene sequence shown in SEQ ID No. 9;

[0104] SEQ ID NO.9:

[0105]

[0106] 10. Succinate semialdehyde dehydrogenase Pput_0228, derived from Pseudomonas putida F1, has the gene sequence shown in SEQ ID No. 10;

[0107] SEQ ID NO.10:

[0108]

[0109] 11. Salicylaldehyde dehydrogenase A458_06710 derived from *Stutzerimonasstutzeri* CCUG 29243, the gene sequence of which is shown in SEQ ID No. 11;

[0110] SEQ ID NO.11:

[0111]

[0112] 12. AldA, an alcohol aldehyde dehydrogenase derived from Cronobacter erturicensis of Zurich, has the gene sequence shown in SEQ ID No. 12;

[0113] SEQ ID NO.12:

[0114]

[0115] The 12 plasmids expressing aldehyde dehydrogenase genes from different sources and species were transformed into E. coli K12W3110 competent cells to obtain different whole-cell catalytic malonic acid-producing engineered bacteria.

[0116] Example 2

[0117] This embodiment uses engineered bacteria to screen the optimal aldehyde dehydrogenase system for whole-cell catalysis.

[0118] The bacterial growths of the 12 engineered bacteria constructed above were scraped off and inoculated into 12 mL sterile test tubes with breathable caps containing 3 mL LB medium (containing 50 mg / L chloramphenicol). The tubes were then placed in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The OD600 was measured to be 45.

[0119] The seed culture obtained was inoculated at a rate of 2% into a 500 mL baffled shaker flask containing 100 mL of LB medium (containing 50 mg / L chloramphenicol). The flask was then incubated at 37°C and 220 rpm for 2 hours. 0.3 mM IPTG was added as an inducer, and induction continued under the same conditions for another 4 hours. Finally, 0.1 M malondialdehyde solution was added to the induced flask, and the pH was adjusted to 7.0 using sodium hydroxide. The flask was then incubated at 37°C and 220 rpm for 2 hours.

[0120] After fermentation, the fermentation broth was collected and centrifuged. The supernatant was used to determine the malonic acid yield. Three parallel experiments were set up for each engineered strain, and the average value was used for counting. The malonic acid yield of the engineered strains overexpressing different aldehyde dehydrogenase genes is shown in Table 1 below.

[0121] Table 1. Malonic acid production results of engineered bacteria expressing different aldehyde dehydrogenase genes.

[0122] Aldehyde dehydrogenase source malonic acid yield (g / L) Bacillus subtilis 2.04±0.21 Klebsiella pneumoniae 0.12±0.01 Brazilian azospira 1.40±0.12 Pseudomonas putida 0.44±0.05 Pseudomonas aeruginosa 0.78±0.09 E. coli 0.11±0.02 Bacillus licheniformis 5.74±0.25 Bacillus cereus 1.22±0.11 Sphingosine monocytogenes 0.03±0.01 Pseudomonas putida 2.08±0.13 Pseudomonas schrenckii 1.89±0.21 Cronobacter zürich 1.48±0.03

[0123] It is evident that the recombinant engineered bacteria overexpressing aldehyde dehydrogenase derived from Bacillus licheniformis produced the highest malonic acid yield. Preliminary screening identified aldehyde dehydrogenase DhaS from Bacillus licheniformis ATCC 14580, possessing the nucleotide sequence shown in SEQ ID No. 7, as the target coding gene.

[0124] Example 3

[0125] In this embodiment, the acetaldehyde dehydrogenase DhaS from Bacillus licheniformis ATCC14580, screened in Example 2, was used to construct a recombinant engineered bacterium for fermentation to produce malonic acid.

[0126] Construction of the recombinant expression vector pACYC-Ptrc-dhaS

[0127] Using the genome of Bacillus licheniformis ATCC 14580 screened in Example 2 as a template, the Ptrc-dhaS product was obtained by PCR amplification using primers dhaS-F and dhaS-R as shown in Table 2 below.

[0128] Using plasmid pACYCDuet-1 as a template, the pACYC product was obtained by PCR amplification using primers pACYC-F and pACYC-R as shown in Table 2 below.

[0129] After purification, the two products underwent homologous recombination and were subsequently chemically transformed into *E. coli* DH5α competent cells. After 1 hour of recovery, the cells were plated on kanamycin plates and incubated at 37°C for 12 hours. Single colonies were picked, and the recombinant plasmid was extracted and sequenced to obtain the recombinant expression vector pACYC-Ptrc-dhaS.

[0130] Construction of the recombinant expression vector pRSF-Ptrc-ppc-panD-pa0132-sthA

[0131] Using the genome of Escherichia coli K12 W3110 as a template, the Ptrc-ppc product was amplified by PCR using primers ppc-F and ppc-R as shown in Table 2 below.

[0132] Using the genome of Bacillus subtilis W168 as a template, the panD product was amplified by PCR using primers panD-F and panD-R as shown in Table 2 below.

[0133] Using the genome of Pseudomonas aeruginosa PAO1 as a template, the product pa0132 was amplified by PCR using primers pa0132-F and pa0132-R as shown in Table 2 below.

[0134] Using the genome of Escherichia coli K12 W3110 as a template, the sthA product was amplified by PCR using primers sthA-F and sthA-R as shown in Table 2 below.

[0135] Using plasmid pRSFDuet-1 as a template, the pRSFI1 product was amplified by PCR using primers pRSF-F and pRSF-R as shown in Table 2 below.

[0136] The above product was purified and homologously recombined, then chemically transformed into E. coli DH5α competent cells. After 1 hour of recovery, the cells were plated on kanamycin plates and incubated at 37°C for 12 hours. Single colonies were picked, and the recombinant plasmid was extracted and sequenced to obtain the recombinant expression vector pRSF-Ptrc-ppc-panD-pa0132-sthA.

[0137] Table 2 Primer List

[0138]

[0139]

[0140] The recombinant plasmids pRSF-Ptrc-ppc-panD-pa0132-sthA and pACYC-Ptrc-dhaS constructed above were transformed into the substrate bacteria—Escherichia coli K12 W3110, and malonic acid producing bacteria could be obtained by cell culture.

[0141] Example 4

[0142] This embodiment is based on the recombinant engineered bacteria constructed in Example 3 for malonic acid fermentation catalysis.

[0143] The recombinant engineered bacteria were inoculated into a 12 mL sterile test tube with a breathable cap containing 3 mL of LB medium (containing 50 mg / L chloramphenicol) and cultured in a shaker at 37°C and 220 rpm for 12 h to obtain the seed culture.

[0144] The seed culture obtained was inoculated at a rate of 2% into a 500 mL baffled shaker flask containing 100 mL of LB medium (containing 50 mg / L chloramphenicol). The flask was then incubated at 37°C and 220 rpm for 2 hours. 0.3 mM IPTG was added as an inducer, and induction continued under the same conditions for another 4 hours. Finally, 0.1 M malondialdehyde solution was added to the induced flask, and the pH was adjusted to 7.0 using sodium hydroxide. The flask was then incubated at 37°C and 220 rpm for 2 hours.

[0145] After fermentation, the fermentation broth was collected and centrifuged. The supernatant was used to test the yield of malonic acid, which was 0.05M. The reaction yield (actual amount of target product (0.05M) / theoretical amount of target product (0.1M)) was calculated to be 50%.

[0146] Example 5

[0147] This embodiment is based on the recombinant engineered bacteria constructed in Example 3 for malonic acid fermentation catalysis.

[0148] In this embodiment, the culture medium suitable for the fermentation of the recombinant engineered bacteria includes: 30 kg / L glucose, 5 kg / L yeast extract, 2 kg / L peptone, 1 kg / L potassium dihydrogen phosphate, 1 kg / L potassium chloride, 0.5 kg / L sodium chloride, 6 kg / L ammonium sulfate, 0.02 kg / L vitamin B1, and 0.02 kg / L vitamin H2.

[0149] In this embodiment, the malonic acid production process is as follows: after culturing in a shaker at 37°C and 220 rpm for 4 hours, 0.3 mM IPTG is added, the shaker temperature is turned to 30°C, and fermentation continues for 48 hours. During the fermentation process, ammonia water is used every 24 hours to adjust the pH to about 7.0.

[0150] After fermentation, the fermentation broth was collected and centrifuged. The supernatant was used to test the malonic acid yield, which was 32 g / L, and the reaction yield (glucose conversion rate) was calculated to be 27.5%.

[0151] Example 6

[0152] This embodiment is based on the recombinant engineered bacteria constructed in Example 3 for malonic acid fermentation catalysis.

[0153] In this embodiment, the M9 inorganic salt medium is selected as the suitable culture medium for the fermentation of the recombinant engineered bacteria.

[0154] In this embodiment, the malonic acid production process is as follows: after culturing in a shaker at 37°C and 220 rpm for 3 hours, 0.3 mM IPTG is added, the shaker temperature is turned to 30°C, and fermentation continues for 72 hours. During the fermentation process, ammonia water is used every 24 hours to adjust the pH to about 7.0.

[0155] Example 7

[0156] This embodiment describes the construction of the recombinant expression vector pRSF-Ptrc-ppc-panD-pa0132-sthA-dhaS.

[0157] Using the genome of Escherichia coli K12 W3110 as a template, the Ptrc-ppc product was amplified by PCR using primers ppc-F and ppc-R as shown in Table 2 above.

[0158] Using the genome of Bacillus subtilis W168 as a template, the panD product was amplified by PCR using the primers panD-F and panD-R shown in Table 2 above.

[0159] Using the genome of Pseudomonas aeruginosa PAO1 as a template, the product pa0132 was amplified by PCR using the primers pa0132-F and pa0132-R shown in Table 2 above.

[0160] Using the genome of Escherichia coli K12 W3110 as a template, the sthA product was amplified by PCR using the primers sthA-F and sthA-R shown in Table 2 above.

[0161] Using the genome of Bacillus licheniformis ATCC 14580 as a template, the dhaS2 product was amplified by PCR using the primers dhaS-F2 and dhaS-R2 shown in Table 2 above.

[0162] Using plasmid pRSFDuet-1 as a template, the pRSFI1 product was amplified by PCR using primers pRSF-F and pRSF-R shown in Table 2 above.

[0163] The above product was purified and homologously recombined, then chemically transformed into *E. coli* DH5α competent cells. After 1 hour of recovery, the cells were plated on kanamycin plates and incubated at 37°C for 12 hours. Single colonies were picked, and the recombinant plasmid was extracted and sequenced to obtain the desired recombinant expression vector pRSF-Ptrc-ppc-panD-pa0132-sthA-dhaS.

[0164] The recombinant plasmid pRSF-Ptrc-ppc-panD-pa0132-sthA-dhaS constructed above was transformed into the substrate bacterium Escherichia coli K12 W3110, and malonic acid producing bacteria could be obtained by cell culture.

[0165] This embodiment uses a constructed malonic acid producing bacterium and the fermentation method described in Example 5 to produce malonic acid through fermentation.

[0166] After fermentation, the fermentation broth was collected and centrifuged. The supernatant was used to test the malonic acid yield, which was 27 g / L, and the reaction yield (glucose conversion rate) was calculated to be 20.9%.

[0167] It is evident that the acetaldehyde dehydrogenase derived from Bacillus licheniformis ATCC 14580 exhibits significantly higher activity in catalyzing the dehydrogenation of malonic acid hemialdehyde to malonic acid compared to aldehyde dehydrogenases from other sources. Furthermore, the engineered bacteria for fermenting malonic acid production constructed using dhaS derived from Bacillus licheniformis can overcome the metabolic bottleneck in the biosynthesis of malonic acid, effectively improving the synthesis efficiency of malonic acid.

[0168] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A gene encoding acetaldehyde dehydrogenase, dhaS, characterized in that, The acetaldehyde dehydrogenase encoding gene dhaS has at least one of the following characteristics: (1) The acetaldehyde dehydrogenase encoding gene dhaS has the nucleotide sequence shown in SEQ ID No. 7; (2) The acetaldehyde dehydrogenase encoding gene dhaS has a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID No. 7, and has the same or similar function as the nucleotide sequence shown in SEQ ID No. 7; (3) The acetaldehyde dehydrogenase encoding gene dhaS has a nucleotide sequence that is at least 80% homologous to the nucleotide sequence shown in SEQ ID No.

7.

2. An acetaldehyde dehydrogenase encoded by the acetaldehyde dehydrogenase encoding gene dhaS as described in claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector carries the acetaldehyde dehydrogenase encoding gene dhaS as described in claim 1; Preferably, the recombinant expression vector comprises the recombinant plasmid pACYC-Ptrc-dhaS.

4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector further includes at least one of the following (1)-(4): (1) Strong promoters and / or strong RBS; (2) Derived from the panD gene of Bacillus subtilis W168; (3) The pa0132 gene derived from Pseudomonas aeruginosa PAO1; (4) Increased the copy number of sthA and / or ppc genes; Preferably, the recombinant expression vector comprises the recombinant plasmid pRSF-Ptrc-ppc-panD-pa0132-sthA-dhaS.

5. A recombinant host, characterized in that, The recombinant host expresses the acetaldehyde dehydrogenase encoding gene dhaS as described in claim 1 or the recombinant expression vector as described in claim 3 or 4.

6. The recombinant host according to claim 5, characterized in that, The recombinant host also includes a second recombinant expression vector; The second recombinant expression vector includes at least one of the following (1)-(4): (1) Strong promoters and / or strong RBS; (2) Derived from the panD gene of Bacillus subtilis W168; (3) The pa0132 gene derived from Pseudomonas aeruginosa PAO1; (4) Increased the copy number of sthA and / or ppc genes; Preferably, the second recombinant expression vector comprises the recombinant plasmid pRSF-Ptrc-ppc-panD-pa0132-sthA.

7. The recombinant host according to claim 5 or 6, characterized in that, The recombinant host includes recombinant host cells or recombinant host bacteria.

8. A method for constructing the recombinant host according to any one of claims 5-7, characterized in that, Includes the step of transfecting or transforming the recombinant expression vector of claim 3 or 4 into the host; Preferably, the method further includes the step of transfecting or transforming the second recombinant expression vector into the host.

9. The method for constructing a recombinant host according to claim 8, characterized in that, The host includes Escherichia coli; Preferably, the host includes Escherichia coli K12; Preferably, the host includes Escherichia coli strain K12 W3110.

10. The application of the acetaldehyde dehydrogenase encoding gene dhaS according to claim 1, the acetaldehyde dehydrogenase according to claim 2, the recombinant expression vector according to claim 3 or 4, or the recombinant host according to any one of claims 5-7 in the field of malonic acid production.

11. A method for preparing malonic acid, characterized in that, Includes the step of inducing fermentation using the recombinant host as described in any one of claims 5-7.

12. The method for preparing malonic acid according to claim 11, characterized in that, The induced fermentation step includes inoculating the recombinant host into the fermentation medium for fermentation for 3-40 hours, adding an inducer for fermentation for 0.5-30 hours, and optionally adding malondimethyl ether as a substrate for further fermentation. Preferably, the fermentation medium includes a carbon source, a nitrogen source, inorganic ions, antibiotics, and nutrient factors; and / or, Preferably, the initial pH of the fermentation medium is 5-8; and / or, Preferably, the inducer comprises at least one of IPTG, lactose, or allolactose; and / or, Preferably, the amount of the inducer added is 0.01-1 mmol; and / or, Preferably, the temperature of the induced fermentation step is 25-45°C; and / or, Preferably, the induced fermentation step takes 5-48 hours.

Images