Method for improving protein expression quantity, recombinant plasmid as well as construction method and application of recombinant plasmid

By integrating the Retron element Pa135 into the pE15A vector and inserting a weak promoter-driven target protein expression cassette, the pRetron-X plasmid was constructed. This overcame the shortcomings of the T7 system and low-copy plasmids, achieving efficient protein expression under a weak promoter, with an expression level increased by 154-fold.

CN121592684APending Publication Date: 2026-03-03HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610021081.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

In existing technologies, the T7 system rapidly depletes the host's ATP and ribosomes after induction, leading to cell growth arrest or even death. Low-copy plasmids are easily lost, and resistance genes increase the host's adaptation costs. Furthermore, protein expression is low under weak promoter conditions, making it difficult to achieve efficient expression.

Method used

The Retron element Pa135 of *Pseudomonas acervulatus* was integrated into the pE15A vector, and a weak promoter-driven target protein expression cassette was inserted into its MSD region to construct the pRetron-X plasmid, which was then transformed into host competent cells to express the target protein.

Benefits of technology

It achieves efficient improvement of protein expression under weak promoter conditions. By placing the protein to be expressed efficiently into the Retron expression box, the expression level is increased by about 154 times, which solves the contradiction between insufficient expression intensity of weak promoter and excessive metabolic burden of strong expression system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121592684A_ABST
    Figure CN121592684A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a method for improving the protein expression quantity, a recombinant plasmid and a construction method and application of the recombinant plasmid, a natural Retron element of pseudonocardia maple shown as SEQ ID NO.6 is integrated in a pE15A carrier skeleton, a target protein expression cassette driven by a weak promoter is inserted into an MSD area of the Retron element Pa135, and an expression plasmid pRetron-X is obtained; and transforming the pRetron-X plasmid into a host competent cell so as to express the target protein. The method provided by the invention efficiently improves the expression quantity of the target protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for increasing protein expression levels, recombinant plasmids, their construction methods, and applications. Background Technology

[0002] Current protein expression optimization techniques include utilizing phage T7 RNA polymerase to drive strong promoters of target genes, such as the pET system, to achieve high expression through IPTG induction, and using low-copy or high-copy plasmids combined with resistance genes to maintain plasmid stability and increase the target protein dosage. However, the T7 system rapidly depletes host ATP and ribosomes after induction, leading to cell growth arrest or even death, and the expression intensity still cannot be matched with the host's metabolic burden. While low-copy plasmids can reduce the burden, they are easily lost, and resistance genes increase the host's adaptation costs. Low protein expression levels under weak promoter conditions are a problem that urgently needs to be solved. There is a pressing need to develop a method to increase protein expression levels. Summary of the Invention

[0003] To develop a method for increasing protein expression levels, this invention provides a method for increasing protein expression levels, a recombinant plasmid, its construction method, and its applications. The method provided by this invention efficiently increases the expression level of the target protein. This method eliminates the need for expression vectors; only a weak promoter is required to increase protein expression levels. Furthermore, the desired protein for efficient expression can be placed into the Retron expression cassette.

[0004] This invention provides a method for increasing protein expression levels, comprising integrating the Retron element Pa135 shown in SEQ ID NO. 6 into the pE15A vector backbone, and inserting a target protein expression cassette driven by a weak promoter into the MSD region of the Retron element to obtain the expression plasmid pRetron-X; and transforming the pRetron-X plasmid into host competent cells to express the target protein.

[0005] This invention integrates the natural retrotron element Pa135 of *Pseudomonas acervulatum* into the pE15A vector backbone and inserts a target protein expression cassette driven by a weak promoter into the MSD region of the retrotron element to obtain an expression plasmid expressing the target protein. After transformation into competent host cells, the target protein is expressed. This method can efficiently increase protein expression levels with only a weak promoter, and the retrotron expression cassette can be used to insert the protein that is desired to be expressed efficiently.

[0006] Furthermore, the weak promoter is P J23112 Promoter.

[0007] Furthermore, the target protein is a reporter protein or a therapeutic protein.

[0008] Furthermore, the reporter protein is the red fluorescent protein mCherry.

[0009] Furthermore, the host competent cells are Escherichia coli competent cells.

[0010] Furthermore, the competent Escherichia coli cells are BL21(DE3).

[0011] The present invention also provides a recombinant expression plasmid for improving protein expression levels, wherein the recombinant expression plasmid is the pRetron-X plasmid obtained by the above method; X represents the name of the target protein expressed by the plasmid.

[0012] The present invention also provides a host cell containing the recombinant expression plasmid that enhances protein expression.

[0013] Furthermore, the host cell is Escherichia coli.

[0014] The present invention also provides the application of the recombinant expression plasmid or the host cell in increasing protein expression levels.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The method provided by this invention resolves the contradiction between "insufficient expression intensity of weak promoters" and "excessive metabolic burden of strong expression systems." By providing a recombinant plasmid (pRetron-RFP) integrating the Retrotron Pa135 element, the expression level of mCherry fluorescent protein is increased by approximately 154-fold. This demonstrates that the natural Retrotron element Pa135 can effectively overcome the expression bottleneck of weak promoters, achieving efficient expression of the target protein under low metabolic burden.

[0016] This invention eliminates the need for expression vectors, requiring only weak promoters to enhance protein expression levels. Furthermore, the retro-transcription cassette allows for the placement of proteins with desired high-efficiency expression. The specific reverse transcription structure "MSD" enhances the expression of target proteins. mCherry The synthesis efficiency is high. The method provided by this invention essentially offers a reporter system for efficient expression of the target protein under a weak promoter, and the feasibility of this reporter system was visually assessed using flow cytometry. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a spectrum of plasmid pE15A in this invention.

[0019] Figure 2 This is a spectrum of the plasmid pRFP in this invention; Figure 3 This is a spectrum of the plasmid pRetron-RFP in this invention; Figure 4 A bar graph showing the fluorescence intensity of pE15A, pRFP, and pRetron-RFP for flow cytometry detection; Figure 5 To detect the fluorescence intensity of pRetron-RFP by flow cytometry. Detailed Implementation

[0020] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0021] This invention provides a method for increasing protein expression levels by adding *Pseudomonas aeruginosa* (a type of bacteria) to the pE15A vector. Pseudonocardia alni strain Shahu's natural retrotron element Pa135, the DNA sequence encoding retrotron element Pa135 is shown in SEQ ID NO.6, with P inserted into the reverse transcription portion of retrotron element Pa135. J23112 weak starter driven mCherry The red fluorescent protein (RFP) gene is used to form the pRetron-RFP plasmid. Transforming the pRetron-RFP plasmid into competent cells increases the expression level of the target protein. The method provided by this invention efficiently improves protein expression levels.

[0022] This invention uses pE15A plasmid and the weak promoter P J23112 and fluorescent genes mCherry The expression intensity is reduced in the initial stage to maintain host cell viability.

[0023] This invention proposes adding the natural retrotron element Pa135 from *Pseudomonas acervulatum*, including the MSR and MSD genes, to the pE15A vector, and inserting the complete retrotron element into the pE15A plasmid to form P... J23112 Weak promoter - Retron-mCherry structure. The P in this invention... J23112The weak promoter can also be denoted as J23112 or BBa_J23112.

[0024] The retrotron provided by this invention is a genetic element found in bacteria, typically composed of three main parts: non-coding RNA (ncRNA), reverse transcriptase (RT), and an additional protein or domain fused to the RT. The reverse transcriptase (RT) recognizes ncRNAs with specific structures and reverse transcribes them into single-stranded DNA (ssDNA). The non-coding RNA (ncRNA) is one of the core components of the retrotron system, providing the template for RT reverse transcription. The structure of the ncRNA is crucial for RT recognition and the subsequent reverse transcription process. The reverse transcriptase (RT) is responsible for reverse transcribing the ncRNA template into ssDNA. RT is one of the first reverse transcriptases discovered in bacteria, and effector proteins or RT domains exhibit diversity across different retrotrons.

[0025] The Retron system can generate designed ssDNA sequences within cells, which can serve as templates for gene editing. By optimizing Retron's ncRNA, cDNA production can be increased, thereby improving the efficiency of genome editing. This invention will utilize the characteristic structure of the Retron system's Pa135 to enhance the synthesis efficiency of target proteins after the host enters the stationary phase.

[0026] Example 1: A method to increase protein expression levels.

[0027] I. Experimental Materials and Methods 1. Experimental Materials The pET28a vector ColE1 replicon was replaced with the p15A replicon to obtain the pE15A vector. The nucleotide sequence of the pE15A vector is shown in SEQ ID NO.1.

[0028] SEQ ID NO.1: LBK medium: LB medium supplemented with 50 μg / mL kanamycin.

[0029] 2. Construction of the basic expression plasmid pRFP (1) Linearization of pE15A vector Based on the pE15A vector, double enzyme digestion was performed, and the enzyme digestion reaction system is shown in Table 1.

[0030] Table 1 Enzyme digestion reaction system The enzyme digestion reaction system described in Table 1 was placed in a constant temperature water bath at 37°C for 2 h for enzyme digestion, and the enzyme digestion product, i.e., the linearized pE15A vector, was collected.

[0031] (2) mCherry Target fragment amplification ① Based on the mCherry sequence (GenBank ID: LC466107.1), DNA was synthesized, and primers were designed, including the upstream primer mCherry-F as shown in SEQ ID NO.2 and the downstream primer mCherry-R as shown in SEQ ID NO.3. PCR amplification was performed according to the PCR reaction system shown in Table 2, and the PCR products were collected. mCherry Target segment.

[0032] mCherry-F: 5'-CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCTAAGGAGGTTTCGTGAAAATG-3' (SEQ ID NO. 2); mCherry-R: 5'-CCGAAGGTGAGCCAGTGTGACTAGTAGTCGACCTTGTACA-3' (SEQ ID NO. 3).

[0033] Table 2 PCR reaction system The PCR reaction conditions were as follows: 95℃ for 3 min, 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s / kb, 30 cycles, and 72℃ for 5 min for complete extension.

[0034] ②P J23112 -mCherry- ter fragment amplification by mCherryPrimers were designed based on the sequence (GenBank ID: LC466107.1), including the upstream primer J23112-F shown in SEQ ID NO.4 and the downstream primer ter-R shown in SEQ ID NO.5. The sequence obtained in ①... mCherry Using the target fragment as a template, and J23112-F and ter-R as primers, PCR amplification was performed according to the PCR reaction system shown in Table 3. PCR products were collected to obtain the complete P fragment. J23112 -mCherry- ter fragment.

[0035] The PCR amplification program was as follows: 95℃ for 3 min, 98℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s / kb extension, 30 cycles, and 72℃ for 5 min for complete extension.

[0036] J23112-F: 5'-CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCTAAGGAGGTTC-3' (SEQ ID NO. 4); ter-R: 5'-TAAGCCAGTATACACTCCGCTAGCGCAAATAATAAAAAAGCCGGAT-3' (SEQ ID NO. 5).

[0037] Table 3 PCR reaction system (3) Seamless cloning The purified PCR product (P) J23112 -mCherry- The ter fragment and the enzyme digestion product (linearized pE15A vector) were assembled using a seamless cloning method to obtain the pRFP basic expression plasmid, such as... Figure 2 As shown. The specific steps are as follows:

[0038] The enzyme digestion product (linearized pE15A vector) and the recovered intact P J23112 The -mCherry-ter fragment was prepared according to the instructions of the ClonExpress II One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.). The recombination reaction was carried out at 37℃ for 30 min. 5 μL of the recombinant product was then added to 50 μL of [the following is a separate, unrelated section:] E. coliTop 10 competent cells were briefly centrifuged and then incubated on ice for 30 min. Afterward, they were placed in a 42°C water bath for 45 s, immediately placed on ice for approximately 2 min, and then 1 mL of LB incubation medium was added. The cells were incubated on a shaker at 37°C for 1 h. 200 μL of the incubation medium was then plated onto LBK plates and incubated at 37°C for 14 h. Several single colonies were picked from the plates and inoculated into LB liquid medium containing kanamycin (50 μg / mL), and cultured overnight at 37°C with shaking. Subsequently, plasmid DNA was extracted from these colonies using a plasmid mini-extraction kit. Recombinant plasmid pRFP was screened and sequenced for verification.

[0039] 3. Construct expression enhancement plasmids containing Retrons Based on the pRFP expression plasmid, the MSR and MSD of the natural retrotron element Pa135 (sequence shown in SEQ ID NO. 6) of *Pseudomonas acervulatus* were inserted into the plasmid to construct the pRetron-RFP plasmid. The pRetron-RFP plasmid map is shown below. Figure 3 As shown.

[0040] SEQ ID NO.6: GGCCGCCCCGGTTCCGGCCAGGGCCCGCGACTCCGGGGCAACCCCGGGGTGCACCGGCACGATGCAGCACGGCGTCCCGCGCGCGGGTGGCAGGACAGCGCTGCCGGCGGCGCGCGGCGGACGGAGAACACCGGT.

[0041] The first to 30 positions of the SEQ ID NO. 6 sequence are MSR sequences: GGCCGCCCCGGTTCCGGCCAGGGCCCGCGA.

[0042] The 31st to 135th positions of the SEQ ID NO.6 sequence are the MSD sequence: CTCCGGGGCAACCCCGGGGTGCACCGGCACGATGCAGCACGGCGTCCCGCGCGCGGGTGGCAGGACAGCGCTGCCGGCGGCGCGCGGCGGACGGAGAACACCGGT.

[0043] The specific construction steps of the pRetron-RFP plasmid are as follows: (1) Place the Retron expression frame into the pE15A vector and insert the Retron fragment amplified from the genome of Pseudomonas aeruginosa into the pE15A vector.

[0044] Primer sequences were designed using overlap extension PCR with the pE15A vector as a template, including the upstream primer pE15A-FK-F shown in SEQ ID NO.7 and the downstream primer pE15A-FK-R shown in SEQ ID NO.8. Using pE15A plasmid DNA as a template, amplification was performed according to the PCR reaction system shown in Table 4, and the PCR product, i.e., the pE15A fragment, was recovered.

[0045] pE15A-FK-F: 5'-GCGCTAGCCGGAGTGTATACT-3' (SEQ ID NO. 7); pE15A-FK-R: 5'-ACGGAATCTTATCATAGTTA-3' (SEQ ID NO. 8).

[0046] Table 4 PCR reaction system The PCR reaction conditions were as follows: 95℃ for 3 min, 98℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension / kb, 30 cycles, and 72℃ for 5 min for complete extension.

[0047] According to *Nocardia maculata* in GenBank ( Pseudonocardia alni strain DNA encoding the Pa135 Retron sequence from the Shahu strain genome (GenBank ID: CP052771.1) was synthesized. The DNA sequence encoding Pa135 Retron is shown in SEQ ID NO. 6. Using the synthesized Pa135 Retron DNA as a template, PCR amplification was performed using the upstream primer MSR-F shown in SEQ ID NO. 9 and the downstream primer MSD-R shown in SEQ ID NO. 10. The PCR product, i.e., the Retron fragment, was collected. The PCR reaction system is shown in Table 5.

[0048] MSR-F: 5'-TAACTATGATAAGATTCCGTGGCCGCCCCGGTTCCGGCCA-3' (SEQ ID NO. 9); MSD-R: 5'-CCGAAGGTGAGCCAGTGTGAACCGGTGTTTCTCCGTCCGCC-3' (SEQ ID NO. 10).

[0049] Table 5 PCR reaction system The PCR reaction conditions were as follows: 95℃ for 3 min, 98℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension / kb, 30 cycles, and 72℃ for 5 min for complete extension.

[0050] The recovered pE15A and Retron fragments were prepared according to the ClonExpress II One Step Cloning Kit instructions (Nanjing Novizan Biotechnology Co., Ltd.). The recombination reaction was carried out at 37°C for 30 minutes. 5 μL of the recombination product was then added to 50 μL of the reaction mixture. E. coli Top 10 competent cells were briefly centrifuged and then incubated on ice for 30 min. Afterward, they were incubated in a 42°C water bath for 45 sec, immediately followed by approximately 2 min on ice. 1 mL of LB broth was added, and the cells were incubated on a shaker at 37°C for 1 h. 200 μL of the incubation solution was then plated onto LBK plates and cultured at 37°C until single colonies appeared. Several single colonies were picked from the plates and inoculated into LB liquid medium containing kanamycin (50 μg / mL). The cells were incubated overnight at 37°C with shaking. Cells were collected, and plasmid DNA was extracted using a plasmid mini-extraction kit. The recombinant plasmid pE15A-Retron was screened and sequenced for verification.

[0051] (2) Combine the recombinant plasmid pE15A-Retron with mCherry Connect the expression boxes to construct a complete expression with Retrorödinger and Retrorödinger. mCherry The plasmid pRetron-RFP was used. The specific steps are as follows:

[0052] ①Using overlap extension PCR, a nucleotide sequence was designed using the pE15A-Retron plasmid as a template, including the upstream primer pE15A-Retron-FK-F shown in SEQ ID NO.11 and the downstream primer pE15A-Retron-FK-R shown in SEQ ID NO.12. PCR amplification was performed according to the PCR reaction system shown in Table 6, and the PCR product, i.e., the pE15A-Retron fragment, was collected.

[0053] pE15A-Retron-FK-F: 5'-AGCATCGCCTGATGCTCTCC-3' (SEQ ID NO. 11); pE15A-Retron-FK-R: 5'-CTCCGTTCCAACAAGGAAAA-3' (SEQ ID NO. 12).

[0054] Table 6 PCR Reaction System The PCR reaction conditions were as follows: 95℃ for 3 min, 98℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension / kb, 30 cycles, and 72℃ for 5 min for complete extension.

[0055] Then use the complete mCherry expression box (P) J23112 -mCherry- The nucleotide sequence was designed using the mCherry fragment as a template, including the upstream primer pRetron-RFP-mCherry-F shown in SEQ ID NO.13 and the downstream primer pRetron-RFP-mCherry-R shown in SEQ ID NO.14. PCR amplification was performed according to the PCR reaction system shown in Table 7, and the PCR product, i.e., the mCherry fragment, was collected.

[0056] pRetron-RFP-mCherry-F: 5'-AGCACGGCGTCCCGCGCGCGCTGATAGCTAGCTCAGTCCT-3' (SEQ ID NO. 13); pRetron-RFP-mCherry-R: 5'-GGCAGCGCTGTCCTGCCACCCTAGTAGTCGACCTTGTACA-3' (SEQ ID NO. 14).

[0057] Table 7 PCR Reaction System The PCR reaction conditions were as follows: 95℃ for 3 min, 98℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension / kb, 30 cycles, and 72℃ for 5 min for complete extension.

[0058] The recovered pE15A-Retron and mCherry fragments were prepared according to the ClonExpress II One Step Cloning Kit instructions (Nanjing Novizan Biotechnology Co., Ltd.). The recombination reaction was carried out at 37°C for 30 min. 5 μL of the recombinant product was added to 50 μL of the kit. E. coliTop 10 competent cells were briefly centrifuged and then incubated on ice for 30 min. Afterward, they were incubated in a 42°C water bath for 45 s, immediately followed by approximately 2 min on ice. 1 mL of LB broth was added, and the cells were incubated on a shaker at 37°C for 1 h. 200 μL of the incubation solution was then plated onto LK plates and cultured at 37°C until single colonies appeared. Several single colonies were picked from the plates and inoculated into LB broth containing kanamycin (50 μg / mL). The cells were incubated overnight at 37°C with shaking. Cells were collected, and plasmid DNA was extracted using a plasmid mini-extraction kit. The recombinant plasmid pRetron-RFP was screened and sequenced for verification.

[0059] 4. Transform the constructed plasmid into E. coli BL21(DE3) competent cells. The constructed empty control pE15A vector, pRFP basic expression plasmid, and pRetron-RFP plasmid were electroporated into BL21(DE3) competent cells. Positive clones were verified by spectinomycin. The three strains carrying the above plasmids were then inoculated into LS (LB+KanR) medium and cultured at 37°C with shaking until OD. 600 =0.6.

[0060] The three strains transformed into different plasmids were analyzed by flow cytometry to detect the luminescence of two fluorescent proteins in the cells.

[0061] Experimental results are as follows Figures 4 to 5 As shown, this invention utilizes the special structure of the Retron system Pal135 to significantly increase the expression level of mCherry protein under weak promoter conditions. According to the average fluorescence intensity of flow cytometry, under the same culture conditions, the fluorescence intensity of the pRetron-RFP plasmid reached 21870.50, which is 154.08 times that of the weak promoter control plasmid pRFP (141.94).

[0062] Therefore, the characteristic structure of the Retron system Pa135 can overcome the expression bottleneck of weak promoters, and after the host enters the stationary phase, it can increase the synthesis and expression level of the target protein mCherry, which continues to increase with the extension of culture time, indicating that Retron can adapt to host metabolism. Experimental results show that compared with the weak promoter control plasmid (pRFP) without Retron element, the recombinant plasmid (pRetron-RFP) integrating Retron Pa135 element can increase the expression level of mCherry fluorescent protein by about 154 times. This proves that the natural Retron element Pa135 can effectively overcome the expression bottleneck of weak promoters and achieve efficient expression of the target protein under low metabolic burden.

[0063] In this invention, the recombinant expression plasmid is designated as 'pRetron-X', where 'X' is the name of the target protein expressed by the plasmid. For example, when the target protein is mCherry, the plasmid is designated as pRetron-RFP; when the target protein is any other target protein, it can be named according to this rule, such as: when used to express green fluorescent protein, it can be pRetron-GFP; when used to express human growth hormone, it can be pRetron-hGH.

[0064] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0065] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method for increasing protein expression levels, characterized in that, The Retron element Pa135 shown in SEQ ID NO.6 was integrated into the pE15A vector backbone, and a target protein expression cassette driven by a weak promoter was inserted into the MSD region of the Retron element Pa135 to obtain the expression plasmid pRetron-X; the pRetron-X plasmid was transformed into host competent cells to express the target protein.

2. The method for increasing protein expression levels according to claim 1, characterized in that, The weak promoter is P. J23112 Promoter.

3. The method for increasing protein expression levels according to claim 1, characterized in that, The target protein is either a reporter protein or a therapeutic protein.

4. The method for increasing protein expression levels according to claim 3, characterized in that, The reporter protein is the red fluorescent protein mCherry.

5. The method for increasing protein expression levels according to claim 1, characterized in that, The host competent cells are Escherichia coli competent cells.

6. The method for increasing protein expression levels according to claim 5, characterized in that, The competent Escherichia coli cells were BL21(DE3).

7. A recombinant expression plasmid for increasing protein expression levels, characterized in that, The recombinant expression plasmid is the pRetron-X plasmid constructed by any one of claims 1 to 4; X represents the name of the target protein expressed by the plasmid.

8. A host cell, characterized in that, The host cell contains the recombinant expression plasmid for increasing protein expression as described in claim 7.

9. The host cell according to claim 8, characterized in that, The host cell is Escherichia coli.

10. The use of a recombinant expression plasmid for increasing protein expression as described in claim 7 or the host cell for increasing protein expression as described in claim 8.