Application of DDA1 and DULLARD in preparation of anti-MASLD-HCC diagnosis and treatment reagent
By detecting and regulating the genes and proteins of DDA1 and DULLARD, the challenges of early diagnosis and treatment of MASLD-HCC have been solved, providing an efficient diagnostic and treatment approach that significantly impacts patient prognosis.
Patent Information
- Application Number
- CN202610120762.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2046-01-29
Smart Images

Figure CN121592780A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of diagnostic and therapeutic reagent technology, specifically involving the application of DDA1 and DULLARD in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC. Background Technology
[0002] Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. In recent years, with the prevalence of metabolic diseases such as obesity and diabetes, metabolic dysfunction-associated steatotic liver disease (MASLD) has replaced viral hepatitis as the fastest-growing cause of HCC. The development of MASLD-associated HCC (MASLD-HCC) is a complex process that progresses from simple steatosis and steatohepatitis to fibrosis, cirrhosis, and finally liver cancer. Its molecular mechanisms are not yet fully understood, resulting in a severe lack of early diagnostic biomarkers and effective therapeutic targets for this subtype of HCC.
[0003] Currently, the clinical diagnosis of HCC mainly relies on imaging examinations (such as ultrasound, CT, and MRI) and serum alpha-fetoprotein (AFP) testing. However, imaging examinations have limited sensitivity for early-stage small hepatocellular carcinomas, and AFP expression levels are low in early-stage HCC and some patients with MASLD-HCC, resulting in unsatisfactory specificity and sensitivity, and a high rate of missed diagnoses. Therefore, finding highly sensitive and specific molecular diagnostic biomarkers is crucial for the early detection and accurate prognostic assessment of MASLD-HCC.
[0004] In terms of treatment, apart from radical methods such as surgical resection and liver transplantation, systemic therapies for advanced HCC remain very limited. Although multi-target tyrosine kinase inhibitors such as sorafenib and lenvatinib, as well as immunotherapies such as atezolizumab combined with bevacizumab, have been used clinically, the overall response rate is low, and drug resistance is easily developed. Developing novel molecularly targeted drugs against the specific pathogenic pathways of MASLD-HCC is an important direction in current anti-liver cancer drug research and development.
[0005] DDA1 is part of the Cul4-RING E3 ubiquitin ligase complex and participates in protein ubiquitination. DULLARD is a conserved phosphatase in mammals involved in regulating phosphatidic acid metabolism and endoplasmic reticulum stress. However, the roles of DDA1 and DULLARD in liver diseases, particularly in the development of MASLD-HCC, remain largely unknown. More importantly, existing research focuses only on the function of individual genes in isolation; no reports have revealed any functional interactions or synergistic effects between DDA1 and DULLARD, let alone systematic studies of them as a potential diagnostic and therapeutic combination target.
[0006] Therefore, the urgent technical problem to be solved in this field is to find and validate novel, efficient and specific combinations of molecular targets that can be used for early diagnosis, prognostic assessment and targeted therapy of MASLD-HCC, so as to overcome the limitations of current diagnostic and treatment methods. Summary of the Invention
[0007] In view of the problems existing in the prior art, the purpose of this invention is to provide the application of DDA1 and DULLARD in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: The use of DDA1 and DULLARD in the preparation of diagnostic and therapeutic agents for anti-MASLD-HCC, wherein the use is at least one of the following a to f: a. Preparation of reagents for the treatment or adjunctive treatment of MASLD-HCC; b. Preparation of reagents to inhibit the occurrence and development of MASLD-HCC; c. Preparation of reagents to inhibit the proliferation or growth of liver cancer cells; d. Prepare reagents for the diagnosis or auxiliary diagnosis of MASLD-HCC; e. Preparation of reagents for prognostic assessment of MASLD-HCC; f. Prepare reagents for screening candidate drugs against MASLD-HCC.
[0009] Based on the above scheme, the reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and the reagents for predicting the prognosis of MASLD-HCC shall at least include reagents for detecting the expression levels of DDA1 and DULLARD genes or proteins in biological samples.
[0010] Based on the above scheme, the reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and the reagents for prognostic assessment of MASLD-HCC include primers and / or probes required for detecting the expression levels of DDA1 and DULLARD genes by RT-qPCR.
[0011] Based on the above scheme, the reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and the reagents for prognostic assessment of MASLD-HCC include specific antibodies required to detect the expression levels of DDA1 and DULLARD proteins by Western blotting or immunohistochemical staining.
[0012] Based on the above scheme, when the expression levels of DDA1 and DULLARD genes or proteins are higher than normal, it indicates that the biological sample to be tested is from a MASLD-HCC patient and has a poor prognosis; when the expression levels of DDA1 and DULLARD genes or proteins are equal to or lower than normal, it indicates that the biological sample to be tested is not from a MASLD-HCC patient and has a good prognosis.
[0013] Based on the above scheme, the biological sample is a blood, serum, exosome, or liver tissue biopsy sample.
[0014] Based on the above scheme, the reagents in a~c include reagents that knock down the expression levels of DDA1 and DULLARD genes or proteins.
[0015] Based on the above scheme, the reagents for knocking down the expression levels of DDA1 and DULLARD genes or proteins include siRNA, shRNA, and antisense oligonucleotides of DDA1 and DULLARD.
[0016] Based on the above scheme, the reagents for screening anti-MASLD-HCC candidate drugs include reagents that increase the expression levels of DDA1 and DULLARD genes or proteins.
[0017] Based on the above approach, reagents are used to increase the expression levels of DDA1 and DULLARD genes or proteins in MASLD-HCC cells or animal models. Candidate drugs are then tested in MASLD-HCC cells or animal models with high expression of DDA1 and DULLARD, and drugs that can significantly reduce the expression of DDA1 and DULLARD and inhibit tumor growth are selected.
[0018] Advantages of the technical solution of this invention This invention provides the application of DDA1 and DULLARD in the preparation of diagnostic and therapeutic reagents against MASLD-HCC. The expression levels of DDA1 and DULLARD differed significantly between healthy individuals and liver tissues of liver cancer patients, and their expression levels significantly affected the survival time of liver cancer patients. Knocking down DDA1 or DULLARD gene expression alone in HepG2 cells had little effect on cell proliferation, while co-knocking down DDA1 or DULLARD significantly reduced HepG2 cell proliferation. Conversely, co-upregulating DDA1 and DULLARD had the opposite effect, indicating that DDA1 and DULLARD knockout can synergistically inhibit HCC cell proliferation. Furthermore, mouse experiments showed that liver-specific knockout of DDA1 and DULLARD alleviated hepatic steatosis, damage, and tumor status in MASLD-HCC. Liver-specific overexpression of DDA1 and DULLARD in mice promoted the progression of MASLD-HCC. In summary, the results indicate that the expression levels of DDA1 and DULLARD are related to the pathogenesis of MASLD-HCC. DDA1 and DULLARD can serve as therapeutic targets for MASLD-HCC and have significant potential applications in the diagnosis, treatment, prognosis, and screening of anti-MASLD-HCC drugs. Attached Figure Description
[0019] Figure 1 The expression levels of DDA1 and DULLARD genes in liver tissues of healthy and hepatocellular carcinoma patients; Figure 2 The expression level of DDA1 protein in liver tissue of HCC patients; Figure 3 ROC curves for the DDA1 and DULLARD genes; Figure 4 The effect of DDA1 gene expression level on survival time of liver cancer patients; Figure 5 The impact of DULLARD gene expression levels on survival time in liver cancer patients; Figure 6 The expression levels of DDA1 and DULLARD in HepG2 cells were determined by knockdown or overexpression of DDA1 and DULLARD. Figure 7 The effect of knocking down DDA1 or DULLARD gene expression alone on cell proliferation in HepG2 cells; Figure 8 The effect of co-knockdown or co-overexpression of DDA1 and DULLARD on cell proliferation in HepG2 cells; Figure 9 Effects of knockout of liver-specific DDA1 and DULLARD genes on physiological and biochemical parameters in mice; Figure 10 Staining results of liver tissue sections from liver-specific DDA1 and DULLARD gene knockout mice; Figure 11 Effects of liver-specific DDA1 and DULLARD gene overexpression on physiological and biochemical parameters in mice; Figure 12 Staining results of liver tissue sections from mice that overexpress liver-specific DDA1 and DULLARD genes.
[0020] In the above figure, the values above the different groups represent the p-values, where p ≥ 0.05 indicates no significant difference, p < 0.05 indicates a significant difference, and p < 0.01 indicates an extremely significant difference. Detailed Implementation
[0021] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.
[0022] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.
[0023] In the following examples, the nucleotide sequence of the human DDA1 gene used is shown in SEQ ID NO:1; the nucleotide sequence of the human DULLARD gene used is shown in SEQ ID NO:2; the nucleotide sequence of the mouse DDA1 gene used is shown in SEQ ID NO:3; and the nucleotide sequence of the mouse DULLARD gene used is shown in SEQ ID NO:4.
[0024] SEQ ID NO:1 (5'→3'): 1 aagttatactgt gaggcggcgg ctaagaaggc ggctctggtg gcggcggtgg aggctgaggc 61 ggcggccgag gcggcgacgg aggaaacaga agatggcaga ttttttgaaa ggactgcctg 121 tctacaacaa aagcaatttt agtcgatttc acgcggactc cgtgtgcaaa gcctcgaacc 181 gacggccctc agtctacctg cctacccgcg agtacccgtc tgaacagatc atcgtgacag 241 aaaagacaaa catcctcctg cgctacctgc atcagcaatg ggacaaaaag aacgctgcca 301 agaagagaga ccaggagcaa gtggagctgg aaggcgagag ctccgcacct ccccgcaagg 361 tggcgcggac cgacagccca gacatgcacg aggacactta agactctcaa ctccacaggc 421 gcctcctgcc aggtctgctc ctcggtcgcc cacccgcctg cccgccatgt gtaagcaccc 481 cgcccgcccg cctccctgcc ggcccatcca caccctgcgt ccacaccact tccaacctca 541 taggagccga tgtatttatt ttccttgagt ttttatttat gctgtaacct gtatcaagcg 601 ttggttaaag gggacatcag acccagtagt gtgatgttgg tagatgcttt ttaaaaaaaa 661 caacattgtc cccccgaccc ccgccttcca tcgggccagt tccccgattc ctgcccccag 721 ttctccagag aaccagagtg tgtctgtgag agtctctagc gggggcttta ctgtggccgg 781 gcgacagggg cgggcccggg gtggcctgac ctaccaggac agccgagtgg ccttctcccc 841 cccaacaccg gtccaggcca ttgagactcg gtcttgtccc acgcttcgcc cggaactttc 901 ccatgcccag gcctcactca gcgtgcacgc acgttgggga gaagtcggcc cttgggatct 961 ttctcttgag tcattttat tttatcatgg actagtgcgt gctccgtgtc cacccaata 1021 aaagggtctt tcctacttga cctcgcgtct ttgctccaca caccttggctgcagaggacg 1081 gagcccctgg gagtcatccc tgttgtcacc aagaggagtg agaagggccccccacgccag 1141 gggccccagg accggctgga ttctctcgtg ggcttgctga ggccaccatgttcaaggcca 1201 agacctgcct ggaccatccc ctctgcctct cctgtcaagg tgaccccaaggacaggtcat 1261 tcctgagaga cggtccatgg tgccaaggat ggagcggggt cagccccctgcctgggatac 1321 cgccaagcag ggcagcgcac ctgtcagaca ccgcagagat ggccggcctcatccgggggc 1381 ctggggtctc tggcctctgc tgctcccctg aggcatggtg aagtacagacggcatctgg 1441 ccggtcttgc tgtcctaggt ggtggcctca cccttgctgg gtcatagagggctctacag 1501 aaggttggca cctggcagtt ggcatgtgcc atggccgctc atggggacccctcttccgcc 1561 agctgggctg ggtttggggc tgagcttggg tatgtagggg tgttcgggctctgggcagaa 1621 ggtttgtggc cctgaccact gagcctgggg ctgggggaac accgcttctccccttattgc 1681 ccccactggt ggtggtgggg atctcagttt tcttttgttt tgttttgtttgtttgtttga 1741 gttggggtct tgtactcttt cccaggctgg agtgcagtgg cgtaatcacagctcactgca 1801 gcctcgacct caagccttcc tcccacctca gccttccaag ccgctgggaccacaggcacc 1861 caccaccatg cctggctaat tttttttttt ttttgagatg gagtctcgctgtgtctccca 1921 ggctggagtg cagtggcaag atctcagctc actacaacct ctgcctcccaggttcaagtg 1981 attctcctac ctcagcctcc tgagtagctg ggattacacg cgtgcgcccctacacccagc 2041 taatttttct atttttagtg gagacggcgt tttgtcatgt tggccaggctggtctcgaac 2101 tcctgacctc aggtgcttcg cctgcctcgg cctcccaaag tgctgtgaccgcacctggct 2161 gcctggctaa tattttaaaa attttttgta gagacagggt ttcaccatgttgcccaggct 2221 ggtctcaaac tcctgggctc aagtcatcca ccttcctcag cctcccaaagtgctggggtt 2281 acagacgtga accaccgtgc ctggcagagg tctctgtttt gagagctgagtctgagggcg 2341 ttgggatggt gtagggttgg gccacagagc tagcagacac tccgggctatggagggtccg 2401 cctgccccag attccactgt ggagggccct gcctgtgtca gaccctcgggcctaggcggc 2461 ccatctctcc caaggacgga gagtgccagg gtgggctccc gtcctacacaaggagtggct 2521 gaccaggccc aggcacagca cagccaccct gctgtacctc ccagctcccggcagtgtcta 2581 caccacagtg atggtgctac aggggccatg tggtcacagg acaggtggtcaggaaatgca 2641 cacttgactg cggtcgatgg tgccgggtcc ggctgaatgc cctggaggctcccaggccag 2701 ctggggagtc ccagtcccca gggttggtgt gacctgggca ggcctgcggtgtccatctgt 2761 gaatgactga gatggtggga cttcagcttc caaggccagg ggccagagtgggagcagggg 2821 gcactcccgc ctttcccctc ggcctgtcta gacctctctg gctcccagtttctgctttga 2881 gtggctgggg gctgtctcct gcctgtgctg tctgcccgtc gctctgcagggctgctggggc 2941 gggcacctcc ttcccctccc ctacctcagc tccctccttt ggggtctgagggctgtgccc 3001 cagcttgcct ccctgtggcc tccccctaga acccctgggt ctgtcgggacatgccccacc 3061 tggcacacac accctgtgta gctcccactg cctgtgggag gacgctgggcccctgagccg 3121 gcctctgtct acccctcctg cctttggggt cccctttacc ccactgttcccccaaactgc 3181 cttccacctt ctccgccttt gcacaggctg ttctcctgcc tccagtgaactctgacttct 3241 ccacagcctc ccaaagggcc ccttgctcac actggcccag ccctgcagcatggccatgtt 3301 ggtctctgag ccttaagcct ttggatgtgg acacatttgt cctcttcctgaaaaatgtga 3361 gggtctgaga ggccacgttc ctgttcctga gtcatacgac agagtcccagtgacttgggt 3421 ctgatgtctg tcccacagtg ggacatccct gctgcatccc aatgccaccccgtgtcctgg 3481 ggacacccaa atgtgccatt ctctcagtat cacaagtcgg ggactgcaggaggctcaggt 3541 gccaggtgcc ttctgatgtt catgccacaa gctcttccca ctgtctctggctccccagac 3601 gatgttccag gaggcgggtg tgccagaagg ggccacgtct tgcaaaccaccgcgctgtcc 3661 tctttgagaa ggagtcttac tcaggactgg ggcctgtgca cacattgtcgcctcttttca 3721 gcacttagag attccttcct ttgtctagtg gctgaagcca gggctgaagttggcctccaa 3781 atctgggccg tctcagaggc ggcgcagcct ggagttttcc atctgtggccaagacccagt 3841 ttttggggagg aggccctcat gggtcaagcc agcctgtacc aggggggggggggttc 3901 ccacctagg ccccagccac ccagactccc ccccccc tcccttttccactgctctga 3961 cctcgggcac tgttgaata tagtttttat tgcatttctg ccgttttacaaaaattgac 4021 aaaataatt aaaaacaaat aaa SEQ ID NO:2(5'→3') 1 agccccctag cgcgcctgcg cagcgggcca ctctctgctt tccccccctc cccttccctt 61 ttcccttcct cccttttccc tagccccctc ccccctgcc ccctcccccca attackccttc 121 cccttccctc caggtctcgg aggaccccat cctagcccta cctgtctcgg cccgcaacct 181 ccccgaagcc gtcggtgcca ctcccagccc atgtgggccc ccgcgggctg cccacgcctg 241 tcccccagct ccccgttccg ctgggcttta ccctcgccag gggtggcttt ctgagccgcc 301 cgctccgtgc ccctctctgc agccctctcct gccctcggg gcccccgttc cccctcccgg 361 cggcgggggg ctgcccccgg ggggctggcg gagctgggcc gcggggggccc cggggccggc 421 ggtgccgggg tcatcgggat gatgcggacg cagtgtctgc tggggctgcg cacgttcgtg 481 gccttcgccg ccaagctctg gagcttcttc atttaccttc tgcggaggca gatccgcacg 541 gtaattcagt accaaactgt tcgatatgat atcctcccct tatctcctgt gtcccggaat 601 cggctagccc aggtgaagag gaagatcctg gtgctggatc tggatgagac acttattcac 661 tcccaccatg atggggtcct gaggcccaca gtccggcctg gtacgcctcc tgacttcatc 721 ctcaaggtgg taatagacaa acatcctgtc cggttttttg tacataagag gccccatgtg 781 gatttcttcc tggaagtggt gagccagtgg tacgagctgg tggtgtttac agcaagcatg 841 gagatctatg gctctgctgt ggcagataaa ctggacaata gcagaagcat tcttaagagg 901 agatattaca gacagcactg cactttggag ttgggcagct acatcaagga cctctctgtg 961 gtccacagtg acctctccag cattgtgatc ctggataact ccccaggggc ttacaggagc 1021 catccagaca atgccatccc catcaaatcc tggttcagtg accccagcgacacagccctt 1081 ctcaacctgc tcccaatgct ggatgccctc aggttcaccg ctgatgttcgttccgtgctg 1141 agccgaaacc ttcaccaaca tcggctctgg tgacagctgc tccccctccacctgagttgg 1201 ggtggggggg aaagggaggg cgagcccttg ggatgccgtc tgatgccctgtccaatgtga 1261 ggactgcctg ggcagggtct gcccctccca cccctctctg ccctgggagccctacactcc 1321 acttggagtc tggatggaca catgggccag gggctctgaa gcagcctcactcttaacttc 1381 gtgttcacac tccatggaaa ccccagactg ggacacaggc ggaagcctaggagagccgaa 1441 tcagtgtttg tgaagaggca ggactggcca gagtgacaga catacggtgatccaggaggc 1501 tcaaagagaa gccaagtcag ctttgttgtg atttgatttt ttttaaaaaactcttgtaca 1561 aaactgatct aattcttcac tcctgctcca agggctgggc tgtgggtgggatactgggat 1621 tttgggccac tggattttcc ctaaatttgt ccccccttta ctctccctctatttttctct 1681 ccttagactc cctcagacct gtaaccagct ttgtgtcttt tttccttttctctcttttaa 1741 accatgcatt ataactttga aaccaaa SEQ ID NO:3(5’→3’): 1 gcggtgctgt cgccatcgga gtgagctgcg cggcggctgg aagtggctgt gcggcggcta 61 ctgggaagga ggctgcggct gcggcggcgg cggcggcggc ggcggtccgg gtggcagaag 121 acgcggacga tggcagactt tctgaaaggc ttgcccgtct acaacaagag caacttcagc 181 aggttccacg cggactctgt gtgcaaggcc tcgaaccgcc gtccctcagt atacctgccg 241 acccgagagt acccgtcaga acagaaatgc tgccaagaag agagaccaag agcaggtgga 301 ggcggagggc gagagctcag cgccacctcg caaggtggcc cggaccgaca gccccgacat 361 gccggaggac acctaggtcc tgtgcatctc ccctcatctg tcagctctgt ccactcccac 421 ccgcgtgtgt aagcgcggcc cgcctcctac atccagcccg cgccctccaa ccgcatagga 481 tccatgtatt tattttcctt gagtttttat ttatgctgta actcgtgtca agcattggtt 541 aaagggacac caggcccagc cgcgaggtat cagtacatgc tttttaaagc acagtggtgc 601 cccccacccg gccacccaca gcgagacctc gccagagtct agagcccagg gcgggctggt 661 cccccaacac accgagcggc ctttcgctcc ttcctaccca caggcctggc cggattgcag 721 gtcctccggg tcctcctgtg cccaggcctc actctgagcc cgtgccaggg caggaaagag 781 ctggctcctc tggatctttc ttttacatca tttatcatgg actagcccgt gctccacgtc 841 caccccaata aaaggacctt tcctactcca cacggcgtct ttgctccgca aactttggcc 901 ggagccactg ggacctgtag gaaccaaccc ctgcctgggg tccttggggc caggtcccct 961 gggagactga gcccaggata gtaccacggg gctaaccaac agccacccac cactgggtat 1021 catgtgcaag gcccgccaac ctccagcact ggtatccatc tggccactcgagaacattgc 1081 agggctgagg tggccacatt atcattggga tatgggggaa ctacctggactggtagagtg 1141 gctgtgcacc ctcagctgta gcatggtact cactgcaagg atggggttctgaggaccctg 1201 catacttgtg aaggctaacg gtgtctgtgt tcactggggg ccattattatttggctgtgg 1261 ccctactgac ctgggcctgg tatggcccta gtagcatctc agcctcatgctgtgacttgg 1321 caactgccgc cgtgccctat taaaccctgg gatgccctgg ccagaatcctccacggtacc 1381 gttcctggag ctgctccctg tgtctgcctc tgaaggcctc tcccctttcagatacaggca 1441 gaagtttctc ccactctcag gtcttggtct gaattccaac tgccttcctatgattgcctt 1501 ttgctgtgct actactgtgc attcttggga gtcacctgga ccacccaggttcctgcaggt 1561 gggccatatg acctgagtct aggctcagca ggctgctccc ggtgcagaacctctgtcctg 1621 ggcaccccta tgagtgaacc atgtcacatc tggctgaggt gtggagtgccatgtgtatct 1681 ggacccagac cagagaggac ctggacctcc tagaggcctc attctgggagaactagggtg 1741 ctcagcctcc agccacggat ctggcaaggc cccttcactg ctctgacctcgagcactgtt 1801 gaaatagaca ttttattgca tttctgccgt tttacaaaaa tatgacaaaataaattaaaa 1861 acaaataaat aaccg SEQ ID NO:4(5’→3’): 1 cttccctcct ggtctcagag gaccctgtcc tagcccgacc tgtttcggcc tgcagcccac 61 gcgaagtcgt cggtgccact tcccgctcat gtgggccccc gcgggctgcc cacgccagtc 121 ccccagttcc cggttccgct gggctttccc ttcgctgggg gtggctttct aagccaccca 181 ctccgtgctc atctctgcag cctctcctgc cgctcggggc ccccgttccc cctccctgcg 241 gcggggggct gcccccgggg ggctggcgga gctgggccgc gggggccccg gggccggcgg 301 tgccggggtc atcgggatga tgcggacgca gtgtctgctg gggctgcgca cgttcgtggc 361 cttcgccgcc aagctctgga gcttctttat ttaccttttg cggaggcaga tccgcacggt 421 aattcagtat cagactgttc gatatgatat cctgccctta tctcctttgt cccggaatcg 481 cctagcccag gtgaagagga agatcctggt gctggatctg gacgaaaccc tgattcactc 541 tcaccacgat ggggtgctga ggcctacagt gagacctggg acacctcccg acttcatcct 601 caaggtggta atagacaaac acccagtccg gttttttgta cataagaggc cccatgtgga 661 tttcttctta gaagtggtaa gccagtggta tgagcttgtg gtgttcacag caagcatgga 721 aatttatggc tctgctgtgg cagataaact ggacaacagc agaagcattc ttaagaggag 781 atactacaga cagcactgca ctttggagtt gggcagctac atcaaagacc tctccgtggt 841 ccacagcgac ctgtccagca tcgtgatcct ggacaactcc cccggggctt acaggagcca 901 cccagacaat gccatcccca tcaaatcctg gttcagtgac cccagtgaca cagcccttct 961 caaccttctc ccaatgctgg atgccctcag gttcactgct gatgtccgat cggtgctgag 1021 ccgaaacctt caccaacata ggctctggtg acagctgctc cccctccacctgagttgggg 1081 tggaggggaa agggaggggag agttcttggg acaccgtctg ttgccctgtccaatgtgagg 1141 actgcctggg cagagtctgc ccctcccacc cctctgccct gggagccctacactccactt 1201 atggagtctg gatggacaca tgggccagac cgtgaagcag cctcactctgggttcacact 1261 ccgtggaaat gccagactgg gacaggcgaa ggcctagagg agccgaaacagtctggtgaa 1321 gaggcaggac tggccagagt gacagacata tcccagaggc tcaaaagaagccaattcaac 1381 tttgttgtga tttgattttt ttaaaaactc ttatacaaaa ctgatctaattcttcactcc 1441 tgctccaagg gctgggctgt gggtggggac tggggtttcg ggccactggatcctcctcag 1501 acttgtcccc cccttacttt tcctcatttt ttttctttcc ccaatcccccatacctgtaa 1561 tcggctcctt tcttctttcc tcttttaaac catgcattat aactttgaaa ccaaa In the following examples, the animal feed was purchased from Changzhou Shuyi Shuer Biotechnology Co., Ltd. All animal experimental procedures of this invention were conducted in accordance with the guidelines approved by the Institutional Animal Care and Use Committee of Ocean University of China.
[0025] In the following embodiments, HepG2 liver cancer cell line was purchased from Shanghai Jikai Gene Medical Technology Co., Ltd. The pcDNA3.1 plasmid was purchased from Changsha Ruiying Biotechnology Co., Ltd. The recombinant plasmids pcDNA3.1-DDA1 and pcDNA3.1-DULLARD were purchased from Changsha Ruiying Biotechnology Co., Ltd., and were obtained by double digestion of pcDNA3.1 plasmid (BamHI and XhoI) followed by insertion into DDA1 or DULLARD. The TransIT-2020 Transfection Reagent transfection reagent used for recombinant plasmid transfection was purchased from MirusBio, USA. HiPerFect Transfection Reagent for siRNA transfection was purchased from Qiagen. AAV vectors carrying the DDA1 and DULLARD genes (pAAV-ApoE / hAATp-DDA1 and pAAV-ApoE / hAATp-DULLARD), negative control vector (pAAV-ApoE / hAATp-null), and AAV vector carrying the Cre enzyme (pAAV-ApoE / hAATp-Cre) were purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.
[0026] flox mice (mice flanked by LoxP genes for DDA1 or DULLARD) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.
[0027] Example 1 Expression of DDA1 and DULLARD genes in liver tissue of hepatocellular carcinoma patients Gene expression matrix data from the liver hepatocellular carcinoma (LIHC) cohort was downloaded from the TCGA website (https: / / cancergenome.nih.gov / ). Analysis of DDA1 and DULLARD expression in liver tissue of LIHC patients using gene expression data from the TCGA database revealed significantly elevated DDA1 and DULLARD gene expression in LIHC patients (P < 0.0001). Figure 1 ).
[0028] A search on the HPA website (https: / / www.proteinatlas.org) yielded a protein expression map of DDA1, showing elevated DDA1 protein levels in the liver tissue of HCC patients. Figure 2 ).
[0029] Prognostic information for hepatocellular carcinoma patients was downloaded from the TCGA website (https: / / cancergenome.nih.gov / ) and analyzed using the area under the ROC curve (AUC) and survival analysis. The AUC showed that the expression levels of both DDA1 (AUC = 0.95) and DULLARD (AUC = 0.81) genes effectively distinguished between tumor and non-tumor patients. Figure 3 Survival analysis based on prognostic data from TCGA liver cancer patients revealed a significant negative correlation between DDA1 and DULLARD gene expression levels and patient prognosis. Figure 4 and Figure 5 ).
[0030] Example 2 Effects of DDA1 and DULLARD gene expression levels on cell proliferation in the HepG2 liver cancer cell line 1. Obtaining DDA1 and DULLARD overexpressing cells Recombinant plasmids pcDNA3.1-DDA1 and pcDNA3.1-DULLARD were transduced into the HepG2 liver cancer cell line to construct DDA1, DULLARD, and DDA1+DULLARD overexpressing cells. Clonogenesis assays were performed to determine the effect of DDA1 and DULLARD gene expression levels on cell proliferation.
[0031] Transfection was performed using Mirus Bio's TransIT-2020 Transfection Reagent, a method that exhibits high transfection efficiency and low cytotoxicity in HepG2 cells. The specific steps are as follows: Cell preparation: HepG2 cells in logarithmic growth phase were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at a density of 5 × 10⁶ cells per well. 5 Cells were seeded at a density of 1000 g / cm³ in 6-well plates. The plates were incubated overnight at 37°C with 5% CO₂ until 80%-90% confluence was reached, at which point transfection was performed. One hour before transfection, the culture medium was replaced with 1.8 mL of fresh complete culture medium.
[0032] Preparation of transfection complex (using a single well of a 6-well plate as an example): Dilute 2.0 µg of pcDNA3.1-DDA1 and 2.0 µg of pcDNA3.1-DULLARD, or 1.0 µg of pcDNA3.1-DDA1 and 1.0 µg of pcDNA3.1-DULLARD mixed recombinant plasmid DNA in 100 µL of serum-free Opti-MEM medium and mix gently. Add 6.0 µL of TransIT-2020 transfection reagent directly to the diluted DNA solution (total volume approximately 106 µL). Gently pipette 4-5 times to mix, then incubate at room temperature for 15-30 minutes to form a stable DNA-transfection reagent complex.
[0033] Transfection: Add the incubated transfection complex (approximately 106 µL) dropwise evenly to the prepared 6-well cell culture medium. Gently shake the culture plate to distribute the complex evenly.
[0034] Culture: The cells were returned to the incubator for further culture. After 48 hours, the cells were harvested to obtain DDA1, DULLARD, and DDA1+DULLARD overexpressing cells for subsequent experiments.
[0035] 2. Obtaining DDA1 and DULLARD knockdown cells Using RNA interference technology, HepG2 cells were transfected with specific small interfering RNA (siRNA) targeting the target genes DDA1 and DULLARD. The RNA-induced silencing complex in the cells degraded the corresponding target mRNA, thereby achieving specific knockdown of gene expression at the posttranscriptional level.
[0036] The siRNA sequence used is as follows: DDA1 (Homo): Chain of Justice: 5'-GAAAGGACUGCCUGUCUACTT-3' (SEQ ID NO:5); Antisense chain: 5'-GUAGACAGGCAGUCCUUUCTT-3' (SEQ ID NO: 6); DULLARD (Homo): Chain of Justice: 5'-GUACCAAACUGUUCGAUAUTT-3' (SEQ ID NO:7); Antisense chain: 5'-AUAUCGAACAGUUUGGUACTT-3' (SEQ ID NO:8); siRNA transfection was performed using Qiagen's HiPerFect Transfection Reagent. The specific steps are as follows: Cell preparation: HepG2 cells in logarithmic growth phase were cultured in DMEM high-glucose medium (antibiotic-free) containing 10% fetal bovine serum at a density of 5 × 10⁶ cells / well. 4 Cells were seeded at a density of 1000 cells / well in 24-well plates. The cells were then incubated at 37°C with 5% CO2 for 18-24 hours until the cell confluence reached 50%-60%. This is the optimal cell state for transfection.
[0037] Preparation of transfection working solution: Resuspend the lyophilized siRNA in sterile 1× siRNA buffer or RNase-free water to a stock solution concentration of 20 µM.
[0038] Transfection complex preparation (per well): Add 100 µL of serum-free DMEM medium to a sterile 1.5 mL EP tube. Add the calculated amount of siRNA to the tube. Typically, the final working concentration for each gene knockdown is 50 nM. For a 24-well plate (final medium volume 500 µL), add 1.25 µL of 20 µM siRNA stock solution. Add 3.0 µL of HiPerFect transfection reagent to the same tube. Immediately mix vigorously by pipetting 10 times or by brief vortexing. Then incubate at room temperature for 10–15 minutes to form a stable siRNA-liposome complex.
[0039] Transfection: Add the incubated transfection complex (approximately 104 µL) dropwise and evenly to the cell culture medium in the corresponding wells. Gently shake the culture plate back and forth and side to side several times to ensure that the complex is evenly dispersed in the culture medium, and then return the cells to the incubator to continue culturing.
[0040] Culture and sample collection: 48 hours after transfection, cells were collected to obtain DDA1 knockdown cells or DULLARD knockdown cells; DDA1+DULLARD combined knockdown cells were obtained by culturing the obtained DDA1 knockdown cells for 24 hours and then knocking down DULLARD cells using the above method; DDA1 knockdown cells, DULLARD knockdown cells and DDA1+DULLARD combined knockdown cells were used for subsequent experiments.
[0041] Western blotting was used to detect the expression levels of DDA1 and DULLARD genes after overexpression or knockdown in DDA1+DULLARD overexpression cells and DDA1+DULLARD combined knockdown cells, with β-actin expression level used as a control. Results are as follows: Figure 6As shown: Compared with the control group, the expression levels of DDA1 and DULLARD were significantly increased in HepG2 cells overexpressing DDA1+DULLARD, and the expression levels of DDA1 and DULLARD were significantly decreased in HepG2 cells knocked down by DDA1+DULLARD. This indicates that the knockdown or overexpression of DDA1+DULLARD was successful (all antibodies used were from Proteintech).
[0042] Cloning experiments: Adjust the cell suspension concentration to 100 cells per microliter based on the cell count results. Add 2 mL of complete culture medium to each well of a 6-well plate, then add 50 μL of cell suspension and mix thoroughly to ensure even cell distribution. Incubate at 37°C with 5% CO2 for 12-16 days, replacing the complete culture medium every 4-5 days. Discard the culture medium, wash once with 2 mL of PBS buffer, and then fix the cells in 2 mL of 4% paraformaldehyde solution for 30 minutes. Staining: Discard the paraformaldehyde solution in the wells, then add 1 mL of 0.1% crystal violet solution and stain for 30 minutes. Wash the 6-well plate three times with PBS buffer to remove unstained areas, air dry at room temperature, fix the camera on a stand at a suitable height, and take photographs that include all stained areas.
[0043] Cell colony formation assays showed that knocking down DDA1 or DULLARD genes alone had no significant effect on the proliferation of HepG2 cells. Figure 7 In HepG2 cells, co-downregulation of DDA1 and DULLARD significantly reduced cell colony numbers, while co-upregulation of DDA1 and DULLARD had the opposite effect. This suggests that overexpression of DDA1 and DULLARD can synergistically promote the proliferation of HCC cells. Figure 8 ).
[0044] The data from the above clonogenic assays indicate that DDA1 and DULLARD can synergistically promote the proliferation of HCC cells. Strategies aimed at inhibiting the expression of DDA1 and DULLARD may have therapeutic potential for HCC patients.
[0045] Example 3 Effects of knockout or overexpression of liver-specific DDA1 and DULLARD genes on the severity of liver cancer in mice (1) Constructing different transgenic mice Mice with DDA1 (or DULLARD) gene knockout were injected via the tail vein into mice flanked by LoxP. AAV vector carrying Cre enzyme (pAAV-ApoE / hAATp-Cre) was injected to obtain mice with DDA1 (or DULLARD) gene knockout. Then, mice with DDA1 gene knockout and mice with DULLARD gene knockout were crossed to obtain homozygous mice with both DDA1 and DULLARD gene knockout.
[0046] The negative control vector (pAAV-ApoE / hAATp-null) was injected into the tail vein of mice flanked by LoxP, respectively, to obtain two types of flox mice. These mice were then crossed to obtain homozygous mice that were injected with the negative vector and flanked by LoxP for both the DDA1 and DULLARD genes. These mice served as the knockout control group.
[0047] Six-week-old male C57BL / 6J mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were injected via tail vein with an AAV vector carrying the DDA1 gene (pAAV-ApoE / hAATp-DDA1). One week later, the mice were injected via tail vein with an AAV vector carrying the DULLARD gene (pAAV-ApoE / hAATp-DULLARD) to obtain mice that specifically overexpress DDA1 and DULLARD in the liver.
[0048] Six-week-old male C57BL / 6J mice were used to obtain an overexpression control group by injecting the negative control vector (pAAV-ApoE / hAATp-null) via the tail vein.
[0049] (2) The transgenic mice constructed above were randomly divided into two groups according to their genotypes: knockout control group (4 mice), DDA1 and DULLARD gene knockout group (4 mice), overexpression control group (4 mice), and DDA1 and DULLARD gene overexpression group (4 mice).
[0050] (3) The mice in each group were fed a Western diet [21.1% fat, 41% sucrose, 1.25% cholesterol and high glucose (18.9 g / L), fructose solution (23.1 g / L)] and intraperitoneally injected with CCL4 (0.25 μg / g) once a week for 24 weeks to induce the MASLD-HCC model. During the model construction process, all mice maintained a 12-hour light / dark cycle, had free access to food and water, and were weighed twice a week.
[0051] (4) After the model was established, each group of mice was fasted from food and water starting at 7:00 AM, and their weight was measured 6 hours later. After anesthetizing the mice, blood was collected from their eyeballs, and then they were dissected. The condition of each organ was observed and recorded. The mouse liver was completely isolated, washed with physiological saline, photographed, and weighed. The liver tissue and plasma were stored separately in -80℃ freezers for subsequent experiments.
[0052] The diameter of the largest cross-section of tumors in each group of mice was measured. Mouse livers were sliced at 1 mm intervals, and the number of tumors in each slice was counted. Liver triglyceride (TG) and total cholesterol (TC) levels in mice were measured using a liver triglyceride (TG) and total cholesterol (TC) assay kit from the Nanjing Jiancheng Biotechnology Institute, China. Optical density (OD) values were measured using a spectrophotometer. Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in mice were analyzed and evaluated using a fully automated biochemical analyzer.
[0053] Liver tissue samples were fixed with 4% paraformaldehyde for Oil Red O staining, hematoxylin and eosin (H&E) staining, and immunohistochemistry (IHC). Paraffin-embedded biopsies were used for H&E staining and IHC, with the Ki67 antibody used in the IHC obtained from Savill Biotechnology Co., Ltd. Frozen liver tissue sections were used for Oil Red O staining. Images were viewed and captured using a Nikon Eclipse E100 equipped with a Nikon DS-U3 imaging system.
[0054] (5) Biochemical parameters of liver-specific DDA1 and DULLARD knockout mice (HKO) and knockout control mice are as follows: Figure 9 As shown, in liver-specific DDA1 and DULLARD knockout mice, the body weight, liver weight, liver TG content, liver TC content, serum ALT and AST, number of liver tumors, and diameter of the largest nodule were all significantly lower than those in the control group mice.
[0055] The staining results of liver tissue sections from liver-specific DDA1 and DULLARD knockout mice and knockout control mice are as follows: Figure 10 As shown, HE staining revealed clear cell-like changes, indicating HCC-like nodules; Oil Red O staining showed reduced liver fat content in HKO mice; and the Ki-67 indicator of tumor cell proliferation showed that the Ki-67 positivity rate in HKO mice was significantly lower than that in the control group.
[0056] (6) Biochemical parameters of liver-specific DDA1 and DULLARD overexpressing mice (OE) and overexpressing control mice are as follows: Figure 11 As shown, the body weight, liver weight, liver TG content, liver TC content, serum ALT and AST, number of liver tumors, and largest nodule diameter of OE mice were significantly higher than those of control mice.
[0057] Staining results of liver tissue sections from liver-specific DDA1 and DULLARD overexpressing mice and control mice are as follows: Figure 12 As shown, HE staining revealed clear cell-like changes, which were also HCC-like nodules; Oil Red O staining indicated increased fat accumulation in the liver of OE mice; the Ki-67 indicator of tumor cell proliferation showed that the Ki-67 positivity rate in OE mice was significantly higher than that in the control group mice.
[0058] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. The application of DDA1 and DULLARD in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The application is at least one of the following a~f: a. Preparation of reagents for the treatment or adjunctive treatment of MASLD-HCC; b. Preparation of reagents to inhibit the occurrence and development of MASLD-HCC; c. Preparation of reagents to inhibit the proliferation or growth of liver cancer cells; d. Prepare reagents for the diagnosis or auxiliary diagnosis of MASLD-HCC; e. Preparation of reagents for prognostic assessment of MASLD-HCC; f. Prepare reagents for screening candidate drugs against MASLD-HCC.
2. The application of DDA1 and DULLARD according to claim 1 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and the reagents for prognostic assessment of MASLD-HCC shall at least include reagents for detecting the expression levels of DDA1 and DULLARD genes or proteins in biological samples.
3. The application of DDA1 and DULLARD according to claim 2 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and for assessing the prognosis of MASLD-HCC include primers and / or probes required for detecting the expression levels of DDA1 and DULLARD genes by RT-qPCR.
4. The application of DDA1 and DULLARD according to claim 2 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The reagents for diagnosing or assisting in the diagnosis of MASLD-HCC and for assessing the prognosis of MASLD-HCC include specific antibodies required to detect the expression levels of DDA1 and DULLARD proteins by Western blotting or immunohistochemical staining.
5. The application of DDA1 and DULLARD according to claim 2 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, When the expression levels of the DDA1 and DULLARD genes or proteins are higher than normal, it indicates that the biological sample being tested originated from a MASLD-HCC patient and has a poor prognosis; when the expression levels of the DDA1 and DULLARD genes or proteins are equal to or lower than normal, it indicates that the biological sample being tested did not originate from a MASLD-HCC patient and has a better prognosis.
6. The application of DDA1 and DULLARD according to claim 2 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The biological samples are blood, serum, exosomes, or liver tissue biopsy samples.
7. The application of DDA1 and DULLARD according to claim 1 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The reagents in a~c include reagents that knock down the expression levels of the DDA1 and DULLARD genes or proteins.
8. The application of DDA1 and DULLARD according to claim 7 in the preparation of diagnostic and therapeutic agents for anti-MASLD-HCC, characterized in that, The reagents used to knock down the expression levels of DDA1 and DULLARD genes or proteins include siRNA, shRNA, and antisense oligonucleotides of DDA1 and DULLARD.
9. The application of DDA1 and DULLARD according to claim 1 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The reagents used to screen candidate drugs against MASLD-HCC include reagents that increase the expression levels of DDA1 and DULLARD genes or proteins.
10. The application of DDA1 and DULLARD according to claim 9 in the preparation of diagnostic and therapeutic reagents for anti-MASLD-HCC, characterized in that, The expression levels of DDA1 and DULLARD genes or proteins in MASLD-HCC cells or animal models are increased by using reagents. Candidate drugs are then tested in MASLD-HCC cells or animal models with high expression of DDA1 and DULLARD, and drugs that can significantly reduce the expression of DDA1 and DULLARD and inhibit tumor growth are selected.
Citation Information
Patent Citations
Application of biomarker for predicting sensitivity of tumor patient to specific anti-tumor drug
CN113025713A
Application of HOXD1 in diagnosis, prognosis and treatment of liver cancer
CN119433025A
Application of DRAM1 as diagnosis and treatment target for resisting non-alcoholic fatty liver disease related hepatocellular carcinoma in preparation of kit, carrier and medicine
CN120683257A
Methods and compositions for the diagnosis and selective treatment of cancer
US20180140578A1