Preparation method of self-assembled nano pesticide
By using a microfluidic self-assembly method to prepare berberine hydrochloride and nucleic acid molecules to form nanoparticles, the problems of complex preparation process and poor stability of nano-biological pesticides have been solved, and efficient and environmentally friendly gray mold control effects have been achieved.
Patent Information
- Application Number
- CN202511823965.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-04
- Publication Date
- 2026-03-06
AI Technical Summary
Existing methods for preparing nano-biological pesticides suffer from problems such as large batch-to-batch variability, poor stability, complex operation steps, difficulty in scale-up and limited production. Furthermore, common nanocarriers are complex to prepare and have low pesticide loading capacity, leading to high environmental pollution risks.
Berberine hydrochloride and nucleic acid molecules (such as dsERG) were prepared using a microfluidic self-assembly method to form nanoparticles. These nanoparticles were formed through electrostatic adsorption and had a particle size of less than 200 nm, a polydispersity index of less than 0.5, and a zeta potential of 1-5 mV. These nanoparticles were then used to control gray mold.
This technology enables the development of simple and easy-to-use nano-biological pesticides with good repeatability, small particle size, and good dispersibility, thereby improving pesticide utilization, reducing environmental pollution risks, and making them suitable for the control of fungi in crops.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopesticide technology, specifically relating to a method for preparing self-assembled nanopesticides. Background Technology
[0002] Botrytis cinereal (B. cinerea), the second most influential plant pathogen on agriculture after rice blast fungus, utilizes various lysozymes and phytotoxins to destroy host cells in order to obtain nutrients. It can cause gray mold disease in over 1000 plant species, resulting in over $10 billion in economic losses globally each year. Currently, control methods for gray mold mainly include chemical fungicide control, biological control, disease-resistant breeding, agricultural cultivation techniques, and the combined use of multiple methods. Chemical fungicides are the most common method. However, the widespread use of chemical fungicides often has serious consequences for human health and ecosystems, and the emergence of resistant gray mold strains reduces the effectiveness of chemical fungicides. Therefore, there is an urgent need to develop safer and more environmentally friendly control methods / products. Genetic engineering biotechnology has significant advantages in overcoming the drawbacks of chemical fungicides. Studies have shown that post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA), small interfering RNA (siRNA), and hairpin RNA (hpRNA), i.e., RNA interference, has become a promising means of controlling botrytis cinerea.
[0003] Ergosterol (ERG) plays a crucial role in the structure and function of fungal cell membranes. Ergosterol is responsible for maintaining membrane fluidity, regulating membrane permeability, influencing the activity of membrane-associated enzymes, and affecting fungal cell growth. Because ergosterol is essential for fungal growth and survival, the ergosterol biosynthesis pathway is a promising candidate for developing antifungal agents. dsRNA (dsERG) constructed by targeting three different genes in the ergosterol biosynthesis pathway of *Botrytis cinerea* shows potential for RNAi control of *Botrytis cinerea*. Naked dsERG is susceptible to degradation due to environmental factors, thus affecting its RNAi efficacy. To improve RNAi efficiency, current research often utilizes nanocarriers loaded with dsRNA to achieve targeted delivery of nucleic acid drugs and improve stability, thereby enhancing RNAi efficiency. However, conventional nanocarriers are complex to manufacture, have low drug loading capacity, and are expensive; moreover, non-natural nanocarriers can easily cause serious environmental pollution. Therefore, there is an urgent need to develop a new type of nanopesticide formulation that combines the advantages of nanocarriers with the disadvantages of complex preparation processes and low pesticide loading.
[0004] As a nucleic acid substance, dsERG contains a large number of phosphate groups, which carry a negative charge in aqueous solution. Therefore, it has the potential to form nanopesticides through self-assembly with positively charged small molecules. Berberine hydrochloride (BBR·HCl), also known as berberine, is a positively charged natural quaternary ammonium alkaloid isolated from various medicinal plants. Due to the presence of an isoquinoline chromophore in its molecular structure, it can kill microorganisms by generating singlet oxygen. Some studies also suggest that berberine can affect the integrity and permeability of bacterial cell membranes and bind to membrane proteins, thereby affecting protein structure and function. In agriculture, berberine can be used as a fungicide to control tomato gray mold, powdery mildew of Panax notoginseng, Phytophthora blight of pepper, moss blight of citrus trees, and brown spot disease of kiwifruit trees.
[0005] Current methods for preparing nanobiopesticides suffer from drawbacks such as large batch-to-batch variability, poor stability, complex procedures, difficulty in scale-up, and limited production capacity. Therefore, there is an urgent need in this field to develop a novel method for preparing self-assembled nanobiopesticides. Summary of the Invention
[0006] The purpose of this invention is to provide a simple, easy-to-operate, and reproducible microfluidic preparation method for nano-biological pesticide formulations; another purpose is to provide a dsERG and berberine hydrochloride nano-biological pesticide (dsERG-BBR) formulation with small particle size and good dispersibility, and to apply it to the control of fungi (such as botrytis cinerea) in crops.
[0007] The first aspect of the present invention provides a nanoparticle comprising berberine hydrochloride and a nucleic acid molecule, or composed thereof; wherein the nucleic acid molecule comprises a double-stranded RNA, the double-stranded RNA comprising a first RNA targeting ERG13, a second RNA targeting ERG11, and a third RNA targeting ERG1.
[0008] In one or more embodiments, the first RNA, the second RNA, and the third RNA:
[0009] (1) They are individual molecules,
[0010] (2) Any two of them can be directly connected or connected via a connector, and / or
[0011] (3) Direct connection or connection through a connector.
[0012] In one or more embodiments, (2) includes:
[0013] The first RNA and the second RNA are joined in a 5' to 3' or 3' to 5' sequence.
[0014] The first RNA and the third RNA are joined in a 5' to 3' or 3' to 5' sequence, and / or
[0015] The second RNA and the third RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0016] In one or more embodiments, (3) includes:
[0017] The first, second, and third RNAs are linked in a 5' to 3' or 3' to 5' sequence.
[0018] The first RNA, third RNA, and second RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0019] The second, first, and third RNAs are linked in a 5' to 3' or 3' to 5' sequence.
[0020] The second RNA, third RNA, and first RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0021] The third RNA, first RNA, and second RNA are joined in a 5' to 3' or 3' to 5' sequence, and / or
[0022] The third RNA, second RNA, and first RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0023] In one or more embodiments, the first RNA comprises the sequence shown in SEQ ID NO:3.
[0024] In one or more embodiments, the second RNA comprises the sequence shown in SEQ ID NO:4.
[0025] In one or more embodiments, the third RNA comprises the sequence shown in SEQ ID NO:5.
[0026] In one or more embodiments, one strand of the double-stranded RNA is shown as SEQ ID NO:2.
[0027] In one or more embodiments, berberine hydrochloride and the nucleic acid molecule form the nanoparticles through non-covalent interactions.
[0028] In one or more embodiments, berberine hydrochloride and the nucleic acid molecules form the nanoparticles through electrostatic adsorption.
[0029] In one or more embodiments, the molar ratio of nitrogen atoms in berberine hydrochloride to phosphorus atoms in the nucleic acid molecule is 1:1 to 9:1.
[0030] In one or more embodiments, the molar ratio of the substances is 1:1-5:1 or 1:1-3:1.
[0031] In one or more embodiments, the nanoparticles have a particle size of 500 nm or less or 200 nm or less, for example, 10-200 nm, 30-150 nm, 40-80 nm or 40-50 nm.
[0032] In one or more embodiments, the polydispersity index of the nanoparticles is less than or equal to 0.5 or less than or equal to 0.3, for example, 0.2-0.3.
[0033] In one or more embodiments, the zeta potential of the nanoparticles is 1-5 mV or 2-3 mV.
[0034] In one or more embodiments, the nanoparticles exhibit a particle size change rate of ≤5% within 7 days under storage conditions at 4°C, and show no obvious aggregation.
[0035] A second aspect of the present invention provides a method for preparing nanoparticles as described in any embodiment herein, characterized in that the method comprises providing berberine hydrochloride and the nucleic acid molecule, mixing them uniformly, and the mixture being the nanoparticles.
[0036] In one or more embodiments, the mixing includes mixing via microfluidic methods.
[0037] In one or more embodiments, the mixing includes mixing via a microfluidic reactor.
[0038] In one or more embodiments, the method includes the following steps: (1) providing a solution containing the nucleic acid molecules; (2) providing a solution containing berberine hydrochloride; and (3) injecting the solutions from steps (1) and (2) into two feed channels of a microfluidic reactor, wherein the mixture is the nanoparticles.
[0039] In one or more embodiments, the flow rate ratio of the solution containing nucleic acid molecules to the solution containing berberine hydrochloride is 1:5-2:1, preferably 1:5-1:1.
[0040] In one or more embodiments, the microfluidic reactor includes one or more of the following: capillary microreactor, T-type microreactor, Y-type microreactor, herringbone structure microreactor, LTF microreactor, heart-shaped microreactor, and serpentine microreactor.
[0041] A third aspect of the present invention provides a method for reducing the particle size and stability of nanoparticles containing berberine hydrochloride and nucleic acid molecules, the method comprising mixing berberine hydrochloride and nucleic acid molecules using a microfluidic method, the mixture being the nanoparticles; wherein the nucleic acid molecules are as described in any embodiment herein.
[0042] In one or more embodiments, the microfluidic method mixing is performed via a microfluidic reactor.
[0043] In one or more embodiments, a solution containing the nucleic acid molecules and a solution containing berberine hydrochloride are respectively injected into two feed channels of a microfluidic reactor, wherein the flow rate ratio of the solution containing the nucleic acid molecules to the solution containing berberine hydrochloride is 1:5-2:1, preferably 1:5-1:1.
[0044] A fourth aspect of the present invention provides a formulation or pesticide composition comprising nanoparticles as described in any embodiment herein, and optionally a pesticide-acceptable carrier.
[0045] In one or more embodiments, the formulation or pesticide composition includes aqueous solutions, suspensions, wettable powders, emulsifiable concentrates, emulsions, sprayable solutions, aqueous dispersions, powders, granules, or microcapsules.
[0046] A fifth aspect of the present invention provides a method for controlling gray mold in plants, the method comprising applying a formulation carrying a nucleic acid inhibitor and capable of expressing the nucleic acid inhibitor or a formulation carrying nanoparticles as described in any embodiment herein to the object to be controlled, wherein the nucleic acid inhibitor comprises a nucleic acid molecule as described in any embodiment herein.
[0047] In one or more embodiments, the objects include vegetables, fruits, ornamental plants, field crops, and wild plants.
[0048] In one or more embodiments, the object includes fungi containing ergosterol, such as Ascomycota or Basidiomycota.
[0049] A sixth aspect of the present invention provides the application of nanoparticles as described in any embodiment herein in the control of gray mold in plants, the application including preventive and curative applications.
[0050] In one or more embodiments, the preventive application is: applying a nano-pesticide solution to the plant surface when the plant is not infected with gray mold.
[0051] In one or more embodiments, the therapeutic application is: applying a nano-pesticide solution to the infected site after a plant has been infected with gray mold.
[0052] In one or more embodiments, 15-25 μL of the nanoparticles are applied to each infected site. Attached Figure Description
[0053] Figure 1 This is the chemical structure diagram of BBR·HCl.
[0054] Figure 2 This is a design concept diagram for dsERG-BBR.
[0055] Figure 3 This is a schematic diagram of the conformation of the complex after docking BBR·HCl with dsERG.
[0056] Figure 4 The image shows the agarose gel electrophoresis results of dsERG.
[0057] Figure 5 Particle size and PDI of dsERG-BBR at different nitrogen-to-phosphorus ratios.
[0058] Figure 6 Particle size and PDI of dsERG-BBR at different flow rates (dsERG:BBR·HCl).
[0059] Figure 7 (A) Particle size distribution and (B) TEM image of dsERG-BBR, and (C) Zeta potential of dsERG, BBR·HCl and dsERG-BBR.
[0060] Figure 8 Fluorescence uptake patterns of Botrytis cinerea (A) dsERG-Cy5 and (B) dsERG-BBR-Cy5.
[0061] Figure 9 Sporotube lengths under DEPC water, dsERG, BBR·HCl, dsERG-BBR, 1 / 2 dsERG-BEBR, and dsERG+BBR·HCl treatments.
[0062] Figure 10 The graph shows the changes in OD values under the treatments of DEPC water, dsERG, BBR·HCl, dsERG-BBR, 1 / 2 dsERG-BEBR, and dsERG+BBR·HCl.
[0063] Figure 11 Photographs showing the (A) preventive effects, (B) disease severity grading, and (C) plaque area of DEPC water, dsERG, BBR·HCl, dsERG-BBR, 1 / 2 dsERG-BEBR, and dsERG+BBR·HCl on gray mold.
[0064] Figure 12Photographs showing the (A) control effects of DEPC water, dsERG, BBR·HCl, dsERG-BBR, 1 / 2 dsERG-BEBR, and dsERG+BBR·HCl on gray mold, along with (B) disease severity and (C) plaque area. Detailed Implementation
[0065] To enable those skilled in the art to understand the features and effects of the present invention, the terms and expressions used in the specification and claims are explained and defined in general below. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in case of conflict, the definitions in this specification shall prevail.
[0066] The theories or mechanisms described and disclosed herein, whether right or wrong, should not in any way limit the scope of the invention, that is, the contents of the invention can be implemented without being limited by any particular theory or mechanism.
[0067] In this document, the terms “contains,” “includes,” “containing,” and similar terms encompass the meanings of “basically composed of” and “composed of.” For example, when this document discloses “A contains B and C,” “A is basically composed of B and C” and “A is composed of B and C” should be considered as having been disclosed in this document.
[0068] In this document, all features defined in the form of numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, descriptions of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible sub-ranges and individual numerical values (including integers and fractions) within those ranges.
[0069] Unless otherwise specified, percentages refer to mass percentages and proportions refer to mass ratios in this article.
[0070] In this article, the sum of the percentages of all components in the composition is 100%.
[0071] In this article, the polydispersity index is the degree of dispersion of particles in water after they dissolve.
[0072] In this paper, the Zeta potential is the core indicator for describing the surface charge state of colloidal particles and measuring the stability of colloids. It is the net charge potential carried by the surface of colloidal particles and the surrounding adsorption layer.
[0073] In this document, when describing embodiments or examples, it should be understood that it is not intended to limit the invention to those embodiments or examples. Rather, all alternatives, modifications, and equivalents of the methods and materials described herein are covered within the scope defined by the claims.
[0074] For the sake of brevity, not all possible combinations of the technical features in each implementation scheme or embodiment are described herein. Therefore, as long as there is no contradiction in the combination of these technical features, the technical features in each implementation scheme or embodiment can be combined arbitrarily, and all possible combinations should be considered within the scope of this specification.
[0075] The inventors prepared a nano-biopesticide formulation by combining dsERG with berberine hydrochloride (BBR·HCl) using a microfluidic self-assembly method. This nano-biopesticide formulation has a particle size of less than 200 nm, exhibits good dispersibility, and is free of organic solvents. It can be applied to crops to control fungi, improving pesticide utilization and achieving reduced dosage while increasing efficiency. Specifically, dsREG is a dsRNA. This application selected three different genes in the known ergosterol biosynthesis pathway of *Botrytis cinerea* as targets to construct the dsERG (dsRNA). This completes the invention.
[0076] Ergosterol and its biosynthetic pathway
[0077] Ergosterol is a core and specific lipid polynucleotide molecule in fungal cells. The inventors used three different genes in the ergosterol biosynthesis pathway as targets for inhibition or silencing to prepare specific interfering molecules and nanopesticides to inhibit fungi. In this paper, the ERG1 (Gene ID: 853086), ERG11 (Gene ID: 856398), and ERG13 (Gene ID: 854913) genes were used as targets for inhibition or silencing. These genes can also be from other organisms, whose functions have been established in the literature. Their nucleotide sequences are highly homologous to the fungal ergosterol biosynthesis pathway, or their gene functions are similar to those of genes in the ergosterol biosynthesis pathway. It is foreseeable that these highly homologous or functionally similar genes can serve as targets to prepare specific interfering molecules and inhibit the growth of other organisms.
[0078] As used herein, the term "highly homologous" or "highly homologous" refers to a nucleotide sequence that hybridizes with the sequence of SEQ ID NO: 1 or 2 or its complementary sequence under stringent conditions. A sequence that hybridizes with the sequence of SEQ ID NO: 1 or 2 or its complementary sequence under stringent conditions is one that allows antiparallel alignment between the two sequences, and the two sequences can then form hydrogen bonds at corresponding bases on opposite strands under stringent conditions to form a dimer molecule that is sufficiently stable under stringent conditions and detectable using methods known in the art. Preferably, such highly homologous sequences have approximately 40% to approximately 50% sequence identity with the control nucleotide sequence shown in SEQ ID NO: 1 or 2 or its complementary sequence, or most preferably, approximately 90% to approximately 95% sequence identity, up to approximately 99% sequence identity. In the SEQ ID NO: 1 or 2 sequences herein, a single underscore indicates the sequence fragment corresponding to the target gene ERG13, a double underscore indicates the sequence fragment corresponding to the target gene ERG11, and a dashed underscore indicates the sequence fragment corresponding to the target gene ERG1.
[0079] The methods used to determine sequence identity are conventional in the art and include the use of Blast and EMBOSS software (The European Molecular Biology Open Software Suite (2000), Rice, P. Longden, I. and Bleasby, A. Trends in Genetics 16, (6) pp276-277). As used herein, the term “identity” refers to the relationship between sequences at the nucleotide level. The “percentage of identity” is determined by comparing optimally aligned sequences (e.g., two or more) within a comparison window, where the sequence portion in the comparison window may contain insertions or deletions compared to a reference sequence for optimal sequence alignment. The reference sequence does not contain insertions or deletions. The reference window is selected from at least 10 consecutive nucleotides to about 50, about 100, or about 150 nucleotides, preferably about 50 to 150 nucleotides. The “percentage of identity” is then calculated by determining the number of identical nucleotides between the sequences in the window, dividing that number by the number of nucleotides in the window, and multiplying by 100.
[0080] The present invention also provides an isolated polynucleotide molecule comprising: (1) the sequence shown in SEQ ID NO: 1 or 2 or its complementary sequence; (2) any polynucleotide sequence that hybridizes with the sequence defined in (1) under stringent conditions; and (3) any polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% sequence identity with the sequence defined in (1). When it is necessary to prepare nucleic acid inhibitors (such as constructs or dsRNAs) or formulations thereof for the ergosterol biosynthetic pathway, one or two polynucleotides can be obtained from the said polynucleotide set. Nucleic acid inhibitors can be prepared separately with multiple polynucleotide sequences (preferably, for example, two), and when applied simultaneously (or in combination), a broader and more effective antifungal effect can be achieved.
[0081] The target gene (fragment) fragments or truncated forms are also included in this invention, provided that when these fragments or truncated forms are used to prepare the nucleic acid inhibitor, the nucleic acid inhibitor also has the activity of inhibiting ergosterol synthesis.
[0082] In this invention, "strict conditions" or "rigorous conditions" refer to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 90%, preferably more than 95%. Furthermore, the hybridizable polynucleotide-encoded polypeptide has the same biological function and activity as the mature polypeptide.
[0083] In this article, "isolated" means that a substance has been separated from its original environment (or, in the case of a natural substance, its original environment). For example, polynucleotides and peptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or peptides are isolated and purified if separated from other substances present in their natural state. Those skilled in the art can purify proteins using standard protein purification techniques. Essentially, pure peptides produce a single master band on a non-reducing polyacrylamide gel.
[0084] Nucleic acid inhibitors (siRNA microparticles)
[0085] Based on the gene or its sequence provided by the present invention, constructs for expressing the dsRNA can be designed. Therefore, the present invention provides an artificially constructed nucleic acid inhibitor or nucleic acid molecule that can be applied to objects requiring protection (such as target crops or plants) to achieve the purpose of controlling gray mold. Preferably, the nucleic acid inhibitor is a construct of interfering molecules, such as dsRNA, antisense nucleic acid, siRNA, or miRNA, or a construct capable of expressing or forming the dsRNA, antisense nucleic acid, siRNA, or miRNA.
[0086] The nucleic acid inhibitor or nucleic acid molecule can be prepared using methods commonly used in the field, such as co-bathing a plasmid containing the nucleic acid inhibitor sequence with competent E. coli cells, incubating the E. coli, lysing and centrifuging to obtain the crude nucleic acid inhibitor.
[0087] In this article, the term "RNA interference (RNAi)" refers to the ability of certain RNAs to efficiently and specifically block the expression of specific genes in vivo, promote mRNA degradation, and induce cells to exhibit a phenotype of specific gene deletion. It is also known as RNA intervention or interference. RNA interference is a highly specific gene silencing mechanism at the mRNA level.
[0088] In this article, the term "interfering RNA" or "dsRNA" refers to an RNA molecule that can degrade specific mRNAs by targeting mRNAs with homologous complementary sequences. This process is called the RNA interference pathway.
[0089] In this document, "substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures (e.g., stem-loop structures). Typically, two "substantially complementary" nucleotide sequences have at least 70% complementary nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Generally, two sufficiently complementary molecules can have a maximum of seven mismatched nucleotides: preferably, a maximum of six; more preferably, a maximum of five; and even more preferably, a maximum of four, such as 0, 1, 2, 3, or 4 mismatched nucleotides.
[0090] In this article, "complementary" sequence usually refers to a sequence in the 5'-3' direction that is transformed into a sequence in the 3'-5' direction (e.g., 5'ATCG 3'→GCTA), and then its complementary sequence is taken (e.g., GCTA-5'CGAT 3').
[0091] In this document, "nucleic acid inhibitors" refers to a class of substances prepared based on target genes or fragments or truncated forms of genes useful for the ergosterol biosynthetic pathway according to the present invention, which have inhibitory activity on ergosterol biosynthesis. These "nucleic acid inhibitors" include, for example, interfering molecules such as dsRNA (also known as double-stranded RNA, double-stranded ribonucleic acid, or double-stranded ribonucleotide sequences), antisense nucleic acids, siRNA, miRNA, etc., or constructs that can express or form said dsRNA, antisense nucleic acid, siRNA, or miRNA.
[0092] In this document, the term "connector" refers to either a flexible or rigid connector. As used herein, the term "connector" means any molecule that enables direct connection between different parts of a fusion protein. Examples of connectors that establish covalent links between different parts of a fusion protein include skin connectors and non-protein polymers, including but not limited to polyethylene glycol (PEG), polypropylene glycol, polyoxyethylene, or copolymers of polyethylene glycol and polypropylene glycol.
[0093] The nucleic acid molecules described in this article include double-stranded RNA, which contains a first RNA targeting ERG13, a second RNA targeting ERG11, and a third RNA targeting ERG1.
[0094] In one or more embodiments, the first RNA, the second RNA, and the third RNA:
[0095] (1) They are individual molecules,
[0096] (2) Any two of them can be directly connected or connected via a connector, and / or
[0097] (3) Direct connection or connection through a connector.
[0098] In one or more embodiments, (2) includes:
[0099] The first RNA and the second RNA are joined in a 5' to 3' or 3' to 5' sequence.
[0100] The first RNA and the third RNA are joined in a 5' to 3' or 3' to 5' sequence, and / or
[0101] The second RNA and the third RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0102] In one or more embodiments, (3) includes:
[0103] The first, second, and third RNAs are linked in a 5' to 3' or 3' to 5' sequence.
[0104] The first RNA, third RNA, and second RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0105] The second, first, and third RNAs are linked in a 5' to 3' or 3' to 5' sequence.
[0106] The second RNA, third RNA, and first RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0107] The third RNA, first RNA, and second RNA are joined in a 5' to 3' or 3' to 5' sequence, and / or
[0108] The third RNA, second RNA, and first RNA are linked in a 5' to 3' or 3' to 5' sequence.
[0109] In one or more embodiments, the first RNA comprises the sequence shown in SEQ ID NO:3.
[0110] In one or more embodiments, the second RNA comprises the sequence shown in SEQ ID NO:4.
[0111] In one or more embodiments, the third RNA comprises the sequence shown in SEQ ID NO:5.
[0112] In one or more embodiments, one strand of the double-stranded RNA is shown as SEQ ID NO:2.
[0113] Nanoparticles and their preparation methods
[0114] The nucleic acid inhibitor is a double-stranded nucleic acid molecule carrying a negatively charged phosphate group, while berberine hydrochloride carries a positively charged group. When the nucleic acid inhibitor and berberine hydrochloride are mixed, they can self-assemble into nanoparticles due to electrostatic adsorption. Therefore, this invention also provides nanoparticles obtained by mixing the nucleic acid inhibitor and berberine hydrochloride as described in any embodiment herein.
[0115] In the nanoparticles described in this paper, the nitrogen-to-phosphorus ratio of the nucleic acid inhibitor to the quaternary ammonium nitrogen in berberine hydrochloride can be 1:3-1:9, preferably 1:3-1:5, based on the ratio of the number of phosphorus atoms in the phosphate group of the nucleic acid inhibitor to the number of nitrogen atoms in the quaternary ammonium nitrogen of berberine hydrochloride. In this paper, the "nitrogen-to-phosphorus ratio" refers to the molar ratio of nitrogen atoms in BBR·HCl to phosphorus atoms in dsERG, specifically the ratio of the molar amounts (n) of N and P in 1 mol of BBR·HCl and dsERG. This value is used as the nitrogen-to-phosphorus ratio and then converted into a mass concentration for experimental purposes.
[0116] Therefore, this article also provides a method for preparing nanoparticles as described in any embodiment of this article, the method comprising: mixing the nucleic acid inhibitor described herein with berberine and its salt solution to obtain the nanoparticles.
[0117] The nucleic acid inhibitor and berberine hydrochloride described in this paper can be mixed using conventional methods. For example, the solution containing the nucleic acid inhibitor can be added to the berberine hydrochloride solution and stirred until homogeneous; or the solution containing berberine and its salt can be added to the solution containing the nucleic acid inhibitor and stirred until homogeneous.
[0118] In preferred embodiments, the nanoparticles described herein can be prepared using microfluidic methods to improve mixing efficiency, such as using microfluidic reactors, including continuous microfluidic channel reactors, droplet microfluidic reactors, gas-liquid microfluidic reactors, fixed-bed microfluidic reactors, and paper-based microfluidic reactors. In some embodiments, the microfluidic reactor described herein can be a capillary microreactor, a T-shaped microreactor, a Y-shaped microreactor, a herringbone structure microreactor, an LTF microreactor, a heart-shaped microreactor, and a serpentine microreactor. Preferably, the microreactor is a herringbone structure microreactor. In an exemplary embodiment, mixing can be performed using a microfluidic reactor, where nucleic acid inhibitors and berberine hydrochloride are respectively introduced into two channels, with a flow rate ratio between the two channels of 1:5 to 2:1, preferably 1:5 to 1:1.
[0119] In this study, the nanoparticles have a particle size of ≤500 nm or ≤200 nm, for example, 10-200 nm, 30-150 nm, 40-80 nm, or 40-50 nm. The polydispersity index (PDI) of these nanoparticles is ≤0.5 or ≤0.3, for example, 0.2-0.3. The PDI and particle size can be detected using commonly used equipment or methods in the art, such as DLS (Zetasizer Pro, Malvern) characterization analysis. The zeta potential of these nanoparticles is 1-5 mV or 2-3 mV. Under storage conditions at 4°C, the particle size change rate of this nanopesticide is ≤5% within 7 days, with no significant aggregation.
[0120] pesticide compositions
[0121] The nucleic acid inhibitors and nanoparticles described herein can be used to prepare formulations (such as pesticide compositions) containing a safe and effective amount of the inhibitor or nanoparticles carrying the nucleic acid inhibitor and capable of expressing the inhibitor (e.g., 1-10 or 1-5 ng / uL); and pesticide-acceptable carriers.
[0122] In this invention, the term "containing" indicates that various ingredients may be used together in the mixtures or compositions of this invention. Therefore, the terms "consistent with" and "composed of" are included in the term "containing".
[0123] In this invention, the term "containing" indicates that various ingredients may be used together in the mixtures or compositions of this invention. Therefore, the terms "consistent with..." and "composed of..." are included in the term "containing".
[0124] In this invention, "pesticide-acceptable" ingredients are substances suitable for agricultural use that do not cause excessive adverse side effects (such as toxicity, irritation, and allergic reactions) to humans, animals, or plants, i.e., substances with a reasonable benefit / risk ratio.
[0125] In this invention, a "pesticide-acceptable carrier" is an acceptable solvent, suspending agent, or excipient for delivering the construct of this invention and the nucleic acid inhibitor of this invention to a target crop. The pesticide-acceptable carrier can be liquid or solid, and preferably a carrier capable of maintaining the activity of the nucleic acid inhibitor to a high degree.
[0126] The formulation (or pesticide composition) can be in a variety of forms, including but not limited to: aqueous solutions, suspensions, wettable powders, emulsifiable concentrates, emulsions, sprayable solutions, aqueous dispersions, powders, granules, or microcapsules. It should be understood that any formulation capable of delivering the construct of the invention and expressing the nucleic acid inhibitor of the invention to the target crop while retaining all or part of its activity is desirable. Preferred formulations are those that are easily delivered, for example, the pesticide composition is a liquid spray or atomizer.
[0127] The concentrated pesticide composition contains a high concentration of the active ingredient (i.e., the nucleic acid inhibitor carrying the constructed compound and capable of expressing the present invention), such as 10-500 μg / mL, 80-200 μg / mL, or 50-250 μg / mL. This concentrated pesticide composition can be obtained by centrifugation. The centrifugation speed and time are adjusted according to the required concentration. In addition, it may contain other suitable chemical agents, synergists, trace elements, stabilizers, binders, wetting agents, dispersants, emulsifiers, penetrants, tanning agents, solvents, fillers, and other commonly used components. The pesticide composition of the present invention may also contain other active insecticides or microbial agents.
[0128] The liquid composition may be in the form of a solution, suspension, or emulsion, or may be encapsulated in a natural or synthetic polymer, and may contain wetting agents, dispersants, or emulsifiers. Such emulsions, suspensions, or solutions can be prepared using aqueous, organic, or water-organic diluents to prepare water-soluble polymers (and mixtures of the above diluents). Furthermore, the diluent may contain, for example, the ionic or nonionic wetting agents, dispersants, or emulsifiers described above, or mixtures thereof.
[0129] The pesticide composition described in this article is applicable to fungi containing ergosterol, including those in the Ascomycota and Basidiomycota phyla, such as pathogenic fungi, industrial fungi, or edible fungi. Pathogenic fungi include, but are not limited to, *Botrytis cinerea*, *Magnaporthe oryzae*, powdery mildew fungi (such as *Blumeria graminis* and *Podosphaera xanthii*), anthracnose fungi (such as *Colletotrichum gloeosporioides*), *Ustilaginoidea virens*, and root rot fungi (such as *Fusarium oxysporum*). Industrial or edible fungi include, but are not limited to, *Saccharomyces cerevisiae*, *Ganoderma lucidum*, *Lentinus edodes*, and *Penicillium chrysogenum*.
[0130] In this article, there are no specific restrictions on the "plant" or "target crop" as long as the plant or target crop is susceptible to fungal infections, especially botrytis cinerea, such as vegetables, fruits, ornamental plants, field crops, and wild plants commonly found in pesticides or agronomy. Vegetables include, but are not limited to, solanaceous vegetables (such as tomatoes (Solanum lycopersicum), cherry tomatoes (Lycopersicon esculentum var. cerasiforme A.Gray), eggplants (Solanum melongena), and peppers (Capsicum annuum)), cucurbits (such as cucumbers (Cucumis sativus) and zucchini (Cucurbita pepo)), leafy vegetables (such as lettuce (Lactuca sativa) and spinach (Spinacia oleracea)), and root vegetables (such as carrots (Daucus carota) and potatoes (Solanum tuberosum)). Fruits include, but are not limited to, berries (such as grapes (Vitis vinifera), blueberries (Vaccinium corymbosum), strawberries (Fragaria ananassa), and blackberries (Rubus fruticosus)), stone fruits (such as peaches (Prunus persica) and apricots (Prunus armeniaca)), and pome fruits (such as apples (Malus domestica) and pears (Pyrus pyrifolia)). Tropical and subtropical fruits (such as kiwifruit (Actinidia chinensis), mango (Mangifera indica), banana (Musa acuminata)), ornamental plants including but not limited to cut flowers (such as roses (Rosa hybrida), lilies (Lilium brownii), tulips (Tulipagesneriana)), potted plants (such as geraniums (Pelargonium hortorum), poinsettias (Euphorbia pulcherrima)), succulents (such as Crassulaceae and Aizoaceae), field crops including but not limited to rapeseed (Brassicanapus), soybeans (Glycine max), sunflowers (Helianthus annuus), wheat (Triticum aestivum), corn (Zea mays), oats (Avena sativa), barley (Hordeum vulgare), cotton (Gossypium hirsutum), etc., and wild plants including but not limited to dandelions, plantains and other weeds, and daisies, violets and other wild flowers.
[0131] The pesticide composition described in this article is also applicable to (1) controlling gray mold, anthracnose, leaf mold, powdery mildew, downy mildew, etc. in tomatoes; (2) controlling scab fungus in peppers; (3) controlling wilt and damping-off in celery; (4) controlling anthracnose, gray mold, powdery mildew, etc. in strawberries; (5) controlling black heart disease and verticillium wilt in radishes; (6) controlling black fungus, anthracnose, ring spot, etc. in beans; (7) controlling anthracnose spot fungus and angular spot fungus in cucumbers; and (8) controlling soft rot fungus in Chinese cabbage. In particular, it is effective against gray mold in plants or crops as described in any of the embodiments described in this article.
[0132] Methods for preventing and controlling gray mold
[0133] For the purpose of controlling plant fungal infestations, especially Botrytis cinerea, the delivery of the nanoparticles described herein to the fabric surface via spray application provides a means of protecting plants.
[0134] Therefore, the present invention provides a method for controlling gray mold in plants, the method comprising applying a formulation carrying the nucleic acid inhibitor and capable of expressing the nucleic acid inhibitor or a formulation carrying the nanoparticles to the object requiring control (e.g., plants, particularly plants infested by gray mold).
[0135] Specifically, dsRNA and nanoparticles can be synthesized and sprayed directly for plant control. The dosage and frequency of application can be adjusted according to the actual target plant or the severity of the disease. For example, the preventive application involves spraying the nanopesticide solution onto the plant surface when the plant is not infected with gray mold, using 1.2-1.8 mL for every 6 target plants; the therapeutic application involves dripping the nanopesticide solution onto the infected area after the plant is infected with gray mold, using 15-25 μL for each infected area.
[0136] In this article, "prevention and treatment" includes prevention and / or treatment.
[0137] The present invention has the following beneficial effects:
[0138] This invention yields a nano-biopesticide formulation of dsERG and berberine hydrochloride (BBR·HCl). This nano-biopesticide formulation has a particle size of less than 200 nm and exhibits excellent dispersibility. Furthermore, it has the advantage of not involving the use of organic solvents, thus improving pesticide utilization. When applied to the control of fungi in crops, it is beneficial for achieving reduced pesticide dosage and increased efficiency.
[0139] The present invention will be further described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the invention. Unless otherwise stated, the methods and reagents used in the embodiments are conventional methods and reagents in the art.
[0140] 1. Experimental apparatus
[0141] Instrument Name Instrument Model Manufacturers Electronic balance EL204 Mettler Toledo Instruments Ltd. Millipore-Q Ultrapure Water System Advantage A10 Millipore Ltd. Ultra-micro spectrophotometer NanoDrop 2000 / 2000c Thermo Fisher Scientific Nanomedicine manufacturing system Nano Shanghai Senmatsu Pharmaceutical Equipment Engineering Co., Ltd. Confocal fluorescence microscopy Leica DMI 3000B Leica Instruments GmbH, Germany Benchtop micro-volume high-speed centrifuge CT15RE Hitachi Koki Co., Ltd. Nanoparticle size potentiometer Zetasizer Pro Malvern Panaco Transmission electron microscope JEM 2100 Nippon Electronics Co., Ltd. ELISA reader SPECTROstar Omega Boqi Technology Co., Ltd. Tabletop constant temperature shaking bed JWY-200B Shanghai Jiange Electronic Technology Co., Ltd. Clean bench BBS-DDC BIOBASE microscope OLYMPUS BX63 Olympus (China) Co., Ltd.
[0142] 2. Names and sources of reagents and materials
[0143] LNP-B0 chip, Shanghai Pengzan Biotechnology Co., Ltd.;
[0144] Plasmid template, Wuhan Miaoling Biotechnology Co., Ltd.;
[0145] Berberine hydrochloride, Shanghai Zhonghe Chemical Technology Co., Ltd.;
[0146] Calf thymus DNA, Shanghai Gaoxin Chemical Glass Instrument Co., Ltd.;
[0147] DNA molecular weight standard (100-2000 bp), Sangon Biotech (Shanghai) Co., Ltd.
[0148] Plasmid Mini-Extraction Kit, Hunan Aikerui Biotechnology Co., Ltd.;
[0149] Competent cells, Shanghai Yisheng Biotechnology Co., Ltd.;
[0150] Ampicillin (Amp), Shanghai Chuangsai Technology Co., Ltd.;
[0151] Chloroform, Shanghai Yanlu Manman Technology Co., Ltd.
[0152] Isopropyl alcohol, Shanghai Maclean Biochemical Technology Co., Ltd.;
[0153] TEB buffer, Sangon Biotech (Shanghai) Co., Ltd.;
[0154] Gel-Green nucleic acid dye, Biosharp;
[0155] DEPC Water, Sangon Biotech (Shanghai) Co., Ltd.
[0156] Gracilaria gravidarum, provided by the laboratory;
[0157] Grapes, Hongshuo Fruit Shop, Sheshan Town, Songjiang District, Shanghai;
[0158] Cherry tomatoes, Huiling Food Supermarket, Xuhui District, Shanghai.
[0159] Experimental methods
[0160] 1. Dynamic light scattering measurement of particle size and PDI
[0161] The particle size and PDI value of the sample were measured using a Malvern nanoparticle potentiometer. The specific procedure was as follows: 1 mL of sample diluted to a certain concentration was placed in a DTS0012 plastic dish, the lid was closed, and the dish was placed in the Malvern nanoparticle potentiometer for measurement.
[0162] 2. Transmission electron microscopy characterization
[0163] After diluting the sample to a suitable concentration with ultrapure water, pipette 10 μL of the liquid onto a copper grid and allow it to air dry in a fume hood. Secure the dried copper grid with the sample onto the sample feed rod and photograph the sample morphology using a transmission electron microscope.
[0164] 3. Zeta potential measurement
[0165] The zeta potential values of dsERG, BBR·HCl and dsERG-BBR·HCl were measured using a Malvern nanoparticle potentiometer. The specific procedure was as follows: the aqueous solutions of dsERG and BBR·HCl used for sample preparation and the prepared dsERG-BBR·HCl solution were placed in DTS1070 plastic dishes, and then placed in the Malvern nanoparticle potentiometer for measurement.
[0166] 4. Verification of Botrytis cinerea intake
[0167] Cy5-labeled dsERG (dsERG-Cy5) was diluted to 100 ng / μL with DEPC water. An equal volume of dsERG-Cy5, pure water, and PDB medium was mixed thoroughly to form the control group; an equal volume of dsERG-BBR-Cy5, BBR·HCl aqueous solution, and PDB medium was mixed thoroughly to form the experimental group. All mixtures were incubated together at room temperature in the dark for 3 days, and fluorescence was observed using a confocal fluorescence microscope.
[0168] 5. Conidial germ tube growth inhibition experiment
[0169] The effect of dsERG-BBR·HCl on the growth of Botrytis cinerea conidial germ tubes was tested using an in vitro micro-assay. 10 μL of Botrytis cinerea spore suspension (10 μL) was used. 5The samples (peptones / mL) were cultured in SMB medium (10g peptone, 40g maltose, diluted to 1L with water, sterilized before use) containing different drug solutions at 25°C. Six experimental groups were set up: dsERG group containing only nucleic acid (20 μg / mL), BBR·HCI group containing only berberine hydrochloride (66 μg / mL), dsERG-BBR group using microfluidic mixing of nucleic acid and berberine hydrochloride (86 μg / mL), 1 / 2 dsERG-BBR group using microfluidic mixing of nucleic acid and berberine hydrochloride (43 μg / mL), and dsERG+BBR·HCI group directly mixing nucleic acid and berberine hydrochloride (concentrations of the two after mixing were 10 μg / mL and 33 μg / mL, respectively). Ultrapure water was used as a control group. After 12 hours of in vitro culture, the morphology of the conidia was observed under a microscope, and the germ tube length was measured and significance was analyzed using Cellsence Standard software.
[0170] 6. In vitro antibacterial test
[0171] To test the inhibitory effect of dsERG-BBR·HCl on *Botrytis cinerea* in vitro, the inhibitory effect on spore growth and reproduction was evaluated by measuring the change in OD value of spores in the drug-containing medium. The experimental setup was consistent with the method described in point 5, "Conidial Germ Tube Growth Inhibition Experiment," with ultrapure water used as the control group. In each well of a 96-well plate, 6 μL of conidial suspension (10⁵ spores / mL), 200 μL of 1% SMB medium, and equal volumes of the experimental and control group liquids were added and mixed thoroughly. The plates were incubated at room temperature, and the absorbance at 600 nm was measured using a microplate reader every 12 hours. Each experiment was repeated three times in parallel.
[0172] 7. Verification of the protective effect of dsERG-BBR·HCl
[0173] The grape skins were rubbed with sandpaper to remove their smooth texture without causing cell sap to seep out. Six experimental groups were set up: dsERG containing only nucleic acid (50 μg / mL), BBR·HCl containing only berberine hydrochloride (165 μg / mL), dsERG-BBR·HCl containing a microfluidic mixture of nucleic acid and berberine hydrochloride (215 μg / mL), 1 / 2 dsERG-BBR·HCl containing a microfluidic mixture of nucleic acid and berberine hydrochloride (107.5 μg / mL), and dsERG+BBR·HCl containing a direct mixture of nucleic acid and berberine hydrochloride (concentrations of the two mixtures were 25 μg / mL and 82.5 μg / mL, respectively). DEPC water was used as a control group. The solution was loaded into a spray bottle, and 1.5 mL of the solution was sprayed evenly onto every 6 grapes. One day later, 20 μL of Botrytis cinerea spore suspension (10 5The affected grapes were incubated at 25°C for 70 days. Five disease severity levels were set, and the severity of gray mold disease on the grapes was recorded daily. On day 7, photos were taken and the area of gray mold on each grape was measured using ImageJ software.
[0174] 8. Determination of bactericidal activity of dsERG-BBR·HCl
[0175] The skin of cherry tomatoes was rubbed with sandpaper to remove its smooth texture without causing cell sap to seep out. DEPC water was used as a control group in the experimental design. First, 20 μL of a suspension of *Gnaphalium affine* (10 μL) was added to the treated skin of each cherry tomato. 5 (each cherry tomato was placed in a solution of 100 μL / mL), and after standing for 12 hours, 20 μL of the corresponding solution was added dropwise. The treated cherry tomatoes were incubated at 25℃ for 7 days. Ten disease severity levels were set, and the severity of gray mold disease on the cherry tomatoes was recorded daily. On the 7th day, photos were taken, and the area of gray mold on each cherry tomato was measured using ImageJ software.
[0176] Example 1: Molecular docking simulation results
[0177] This embodiment uses AutoDock software to perform molecular docking simulations to predict the binding force between BBR·HC1 and dsERG. The specific molecular docking simulation steps are as follows:
[0178] 1. Obtain the 3D structure of the drug molecule. dsERG: Predict its 2D structure using RNAfold software, then use 3dRNA / DNA software to simulate and generate multiple dsERG three-dimensional structures, obtaining the PDB format file of the optimal simulation result. BBR·HCl: Search for the corresponding compound in the PubChem database, download its 3D structure SDF format file, and convert it to MOL2 format using OpenBabel software.
[0179] 2. Use Autodock software to process molecules. For dsERG as a macromolecule: perform hydrogenation, calculate charge number, and determine atomic rigidity properties, then export as a PDBOT format file. For BBR·HCl as a ligand: perform hydrogenation, detect torsional bonds, and select torsional bonds, then export as a PDBQT format file.
[0180] 3. Molecular docking simulation. In the ADT grid program, set the size and position of the docking box to completely cover the dsERG 3D structure, export it as a GPF format file, and run it to obtain a MAP file. Next, in the docking program, set the specific docking parameters, select the genetic algorithm to calculate the optimal binding conformation between drug molecules, select the default parameters for the number of runs and the number of dockings, run the molecular docking simulation, and export the docking simulation results.
[0181] 4. Simulation Results. Binding Energy and Hydrogen Bonds: Open the docking result file and the macromolecule file in the Analyse section of ADT. Select the energy-sorted method to view the analysis results and see the binding energy and hydrogen bond situation for each docking result. Visualize the docking results: Select the structure containing hydrogen bonds and with low binding energy as the optimal simulation result and save it. Use Pymol software to observe the docking structure.
[0182] Molecular docking simulations of BBR-HCl and dsERG were performed using Autodock. The calculated binding free energy between BBR-HCl and dsERG was -11.03 kcal / mol, indicating a strong interaction force between them and the possibility of spontaneous assembly. The docking results were visualized using Pymol software. Figure 3 As can be seen from the figure, there is a hydrogen bond interaction between the two molecules.
[0183] Example 2: Synthesis of dsERG
[0184] The dsERG sequence used in this invention is based on the dsERG designed by Duanis et al. for ergosterol (see Double-stranded RNA targeting fungal ergosterol biosynthesis pathway control). The plasmid dry powder template was provided by Wuhan Miaoling Biotechnology Co., Ltd. The specific synthesis process of dsERG is as follows:
[0185] 1. Plasmid Transformation: Dissolve the plasmid powder in ultrapure water, add 2 μL to 100 μL of competent cells, incubate on ice for 30 min, heat shock at 42℃ for 60 s, then quickly incubate on ice for 2 min. Spread the plasmid onto LB solid medium in a clean bench and incubate at 37℃ for 12-16 h. Then, select single colonies and place them in 12 mL shake tubes containing LB liquid culture (containing Amp), and incubate at 37℃ and 220 rpm for 3-4 h. Next, mix the bacterial culture with fresh LB liquid culture (containing Amp) at a 1:100 volume ratio, inoculate at 37℃ and 220 rpm for 112-16 h. After shaking, centrifuge at 4℃ and 4000 rpm for 10 min, remove the supernatant, and add 1 / 100 of the original volume of ultrapure water and mix thoroughly. After 10 freeze-thaw cycles with liquid nitrogen, store at -80℃.
[0186] 2. RNA Extraction: Thaw the bacterial culture preserved in the previous step at room temperature, add 2 volumes of chloroform, shake vigorously for 15 seconds, and let stand for 5-10 minutes. Centrifuge at 10000g for 15 minutes at 4℃, collect the supernatant in a new centrifuge tube, add an equal volume of isopropanol, shake for 15 seconds, incubate on ice for 15 minutes, then centrifuge at 10000g for 10 minutes and discard the supernatant. Add an equal volume of 75% ethanol, pipette until the precipitate leaves the bottom, centrifuge at 6000g for 5 minutes at 4℃, discard the supernatant, and repeat this step twice. Finally, invert the centrifuge tube containing the precipitate until the ethanol has completely evaporated to obtain dsERG.
[0187] 3. Agarose Gel Electrophoresis Characterization: Prepare a 1% agarose gel (agarose powder concentration of 110 mg / mL, dissolved in 1×TBE buffer). After microwave dissolution, pour the gel into a gel tank containing a comb and allow it to solidify completely. Then place the gel in the electrophoresis tank, add 1×TBE buffer until the gel is submerged, and add DNA2000 Maker and dsERG to the gel wells sequentially. Set the voltage to 110V and run the gel on ice for 40 min. After gel running, stain the gel in Gel-Green for 20 min and observe under UV light.
[0188] The dsERG, with a theoretical size of 751 bp, was characterized using agarose gel electrophoresis. Figure 4 It can be observed that the extracted dsERG band is located around 750 bp, which is very close to the theoretical 751 bp. Therefore, it can be considered that the target double-stranded RNA, namely dsERG (sequence shown as SEQ ID NO: 1), has been successfully obtained.
[0189] Example 3: Preparation of the nano-pesticide dsERG-BBR·HCl and screening of its process parameters
[0190] This embodiment uses an LNP-B0 chip containing a herringbone structure (such as...). Figure 2 As shown, the nanopesticide dsERG-BBR·HCl was prepared using microfluidic technology on a Senmatsu nanopesticide fabrication system. The microfluidic preparation process parameters for dsERG-BBR·HCl were screened using a single-factor controlled variable method. The screened process conditions included the nitrogen-to-phosphorus ratio (N / PRatio) and the flow rate ratio of dsERG and BBR·HCl (FRR). The particle size and polydispersity index (PDI) were measured under each condition using DLS, and the optimal process parameters were determined based on particle size and PDI as the main evaluation criteria.
[0191] (1) Screening based on nitrogen-to-phosphorus ratio (N / P Ratio)
[0192] Although dsERG-BBR·HCl particles can be obtained using simple stirring, their particle size varies significantly. Therefore, microfluidic technology was employed to prepare dsERG-BBR·HCl. Since dsERG contains negatively charged phosphate groups and BBR·HCl contains positively charged quaternary ammonium structures, the nitrogen-to-phosphorus ratio significantly influences their interaction. Through preliminary experiments, the inventors discovered that nanoparticles could only be formed when the flow rate ratio was 1:1 and the nitrogen-to-phosphorus ratio was less than 10:1. Therefore, five nitrogen-to-phosphorus ratios of 1:1, 3:1, 5:1, 7:1, and 9:1 were screened. The nitrogen-to-phosphorus ratio was obtained by controlling the dsERG concentration (dissolved in DEPC at a concentration of 100 μg / mL) and varying the concentration of berberine hydrochloride (e.g., at a nitrogen-to-phosphorus ratio of 3:1, dsERG was 100 μg / mL and BBR·HCl was 330 μg / mL).
[0193] The results are as follows Figure 5 As shown in Table 1, as the nitrogen-phosphorus ratio increased from 1:1 to 9:1, the particle size of dsERG-BBR·HCl exhibited a trend of first decreasing and then rapidly increasing. When the nitrogen-phosphorus ratio was less than 5:1, the resulting nanopesticide particles were all less than 150 nm in size, and the PDI value was less than 0.40. Subsequently, these three groups of dsERG-BBR·HCl solutions were stored at 4℃ and particle size was monitored. The results showed that the particle size change was minimal in the group with a nitrogen-phosphorus ratio of 3:1. Therefore, a nitrogen-phosphorus ratio of 3:1 was ultimately selected as the optimal nitrogen-phosphorus ratio process parameter for subsequent experiments.
[0194] Table 1:
[0195] N / P Size (nm) PDI 1:1 108.9 0.39 3:1 55.0 0.39 5:1 58.7 0.25 7:1 616.6 0.43 9:1 2466.3 0.48
[0196] (2) Flow rate ratio (FRR) screening
[0197] dsERG was dissolved in DEPC water to a concentration of 100 μg / mL; BBR·HCl was dissolved in ultrapure water, and different concentrations were prepared according to the same nitrogen-phosphorus ratio but different flow rate ratios. The nanopesticide dsERG-BBR was prepared using an LNP-B0 chip on a Senmatsu nanopesticide fabrication instrument. With the total flow rate and other parameters kept constant, nanopesticides were prepared under different flow rate ratios (2:1, 1:1, 1:2, 1:3, 1:4).
[0198] When screening flow rate ratios, since changing the flow rate ratio of the two phases affects the volume ratio of the two phases, thus affecting the nitrogen-phosphorus ratio, this embodiment ensures a consistent nitrogen-phosphorus ratio under different flow rate ratios by changing the concentration of the drug solution. For example, when the FFR is 1:1, microfluidic mixing is performed using dsERG at a concentration of 100 μg / mL and berberine hydrochloride at a concentration of 330 μg / mL; when the FFR is 1:5, microfluidic mixing is performed using dsERG at a concentration of 100 μg / mL and berberine hydrochloride at a concentration of 66 μg / mL. The screening results for the flow rate ratios are as follows: Figure 6 As shown in Table 2, the specific values indicate that as the flow rate ratio of dsERG to BBR-HCl increased from 1:5 to 5:1, the particle size of the nano-pesticides showed a trend of first decreasing and then increasing. When the flow rate ratio was from 1:5 to 2:1, the particle size of the nano-pesticides was relatively low. Among them, the nano-pesticides with the smallest particle size were obtained when the flow rate ratio was 1:1, and the PDI value at this time was 0.32. Therefore, the flow rate ratio of 1:1 was finally selected as the optimal flow rate ratio.
[0199] Table 2:
[0200] FFR Size (nm) PDI 1:5 133.2 0.21 1:2 121.4 0.31 1:1 79.81333 0.32 2:1 123.2333 0.30 5:1 687.1 0.88
[0201] Example 4: Characterization of the nano-pesticide dsERG-BBR·HCl
[0202] The properties of dsERG+BBR·HCl nanopesticides with an N / P ratio of 3:1 and an FFR of 1:1 were detected. The DLS test results are as follows: Figure 7 As shown in (A), dsERG-BBR·HCl is a uniform nanoparticle with a hydration kinetic diameter of 48.5 nm, a polydispersity index of 0.26, and a narrow particle size distribution. The morphology of dsERG-BBR was captured using TEM. Figure 7 (B) It can be seen that dsERG-BBR·HCl is a spherical nanoparticle with excellent dispersibility. For example... Figure 7 As shown in (C), the Zeta potentials of dsERG, BBR·HCl, and dsERG-BBR·HCl are -45.51 mV, 17.63 mV, and 2.42 mV, respectively. The Zeta potential of dsERG-BBR·HCl falls between that of dsERG and BBR·HCl, which may be due to the electrostatic interaction between dsERG and BBR·HCl, resulting in the cancellation of some of their charge.
[0203] Example 5: Verification of uptake of nano-pesticide dsERG-BBR·HCl by Botrytis cinerea
[0204] dsERG only exerts its RNAi effect when taken up by *Botrytis cinerea*, thus inhibiting its growth. The inhibitory effect of biopesticides on *Botrytis cinerea* is directly proportional to the amount taken up; therefore, it is necessary to compare the hyphal uptake efficiency of dsERG and dsERG-BBR·HCl. With Cy5 labeling, the uptake of dsERG and dsERG-BBR·HCl by *Botrytis cinerea* hyphae can be observed using LSCM, and the corresponding fluorescence intensities can be calculated using ImageJ software. Figure 8 The average fluorescence intensity of (A) is 187.26 AU. Figure 8 (B) showed an average fluorescence intensity of 219.75 AU, indicating that the nanopesticide dsERG-BBR·HCl improved the uptake efficiency of Botrytis cinerea by 17.4% compared to dsERG. Furthermore, from Figure 8 (B) It can also be seen that, under the same dsERG-Cy5 content, dsERG-BBR·HCl-Cy5, which is self-assembled with BBR·HCl, has a more obvious inhibitory effect on the mycelial growth of Botrytis cinerea.
[0205] Example 6: Conidial Germ Tube Growth Inhibition Experiment
[0206] Botrytis cinerea primarily reproduces through conidia; therefore, we used a conidial germ tube growth inhibition experiment to measure the in vitro inhibitory effect of nano-pesticides on Botrytis cinerea. After co-incubation of the spore suspension and the treatment solution for 12 h, the germ tube lengths of the CK group, dsERG group, BBR·HCl group, dsERG-BBR·HCl group, 1 / 2 dsERG-BBR·HCl group, and dsERG+BBR·HCl group are shown in Table 3. Figure 9 As shown, all experimental groups showed significant differences from the control group, indicating that nano-pesticides, berberine hydrochloride, and their mixtures all have the ability to inhibit the growth of *Botrytis cinerea* spores. Furthermore, the 1 / 2 dsERG-BBR·HCl group and the dsERG-BBR·HCl group showed significant differences in inhibiting germ tube growth compared to the dsERG group, the BBR-HCl group, and the dsERG+BBR·HCl group prepared by simple mixing. This indicates that the two active ingredients in dsERG-BBR·HCl prepared based on microfluidic technology can exert a synergistic effect in inhibiting germ tube growth and achieve better inhibition of germ tube growth through the small size effect. Even when its content is halved, it still has a more significant germ tube growth inhibition effect. Therefore, dsERG-BBR·HCl prepared based on microfluidic technology can exert a synergistic control effect, thereby reducing the amount of pesticides applied.
[0207] Table 3: Sporotube lengths under DEPC water, dsERG, BBR·HCl, dsERG-BBR·HCl, 1 / 2 dsERG-BBR·HCl and dsERG+BBR·HCl treatments
[0208] Processing group Germ tube length (μm) Inhibition rate (%) CK 49.31±1.70 a 0 dsERG 40.72±1.31 bc 17.43 BBR·HCl 41.30±1.93 bc 16.24 dsERG-BBR·HCl 36.54±1.53 cd 25.91 1 / 2 dsERG-BBR·HCl 35.53±1.41 d 27.94 dsERG+BBR·HCl 41.82±2.04 b 15.20
[0209] Example 7: In vitro antibacterial experiment
[0210] Optical density (OD value), relevant to fungal biology, was used to determine the in vitro fungal growth kinetics, and the growth inhibitory effects of different treatment groups on *Botrytis cinerea* were quantified by OD values. Figure 10 It can be seen that at 60 h, the OD values of the experimental groups were significantly lower than those of the CK group. Among them, the two groups of nano-pesticides prepared based on microwave fluidization technology had the lowest OD values at 60 h. Therefore, it can be roughly judged that the nano-dsERG-BBR·HCl prepared based on microfluidic technology has a better antibacterial effect on Botrytis cinerea than other experimental groups. Next, ANOVA analysis of the 60 h data was performed using SPSS. The results are shown in Table 4. There were significant differences between the CK group and all experimental groups. There was also a significant difference between the 1 / 2 dsERG-BBR·HCl group with the lowest OD value and the dsERG group. This indicates that the nano-dsERG-BBR·HCl prepared based on microfluidic technology may reduce the amount of dsERG used in inhibiting the growth of Botrytis cinerea.
[0211] Table 4: OD values after 60 h of treatment with DEPC water, dsERG, BBR·HCl, dsERG-BBR·HCl, 1 / 2 dsEIRG-BBR·HCl and dsERG+BBR·HCl
[0212] Processing group OD value CK 0.55±0.03 a dsERG 0.39±0.03 b BBR·HCl 0.36±0.02 bc dsERG-BBR·HCl 0.33±0.02 bc 1 / 2dsERG-BBR·HCl 0.29±0.01 c dsERG+BBR·HCl 0.37±0.04 bc
[0213] Example 8: Verification of the protective and preventive effect of dsERG-BBR·HCl
[0214] Grapes are one of the crops most severely affected by botrytis cinerea, therefore grapes were chosen as a crop model to compare the differences in crop protection effects between different groups. Pre-treatment by rubbing the grape skin mimics the minor damage grapes experience in nature, thus ensuring effective inoculation of botrytis cinerea on each grape. Figure 11 (A) It can be seen that the number of successfully inoculated *Botrytis cinerea* fungi on the CK group was significantly higher than that on other experimental groups, and the number and area of *Botrytis cinerea* growing on dsERG-BBR·HCl were significantly lower than those on other groups. The growth of *Botrytis cinerea* on the grapes was observed daily, and the corresponding disease severity was recorded. Figure 11(B) It can be seen that on day 7, the disease severity, from lowest to highest, was as follows: dsERG-BBR·HCl group, 1 / 2 dsERG-BBR·HCl group, dsERG group, dsERG+BEBR·HCl group, BBR·HCl group, and CK group. Next, ImageJ software was used to measure the area of gray mold spots on each grape vine. Figure 11 (C) It can be seen that the average gray mold plaque area of the CK group, dsERG group, BBR·HCl group, dsERG-BBR·HCl group, 1 / 2 dsERG-BBR·HCl group, and dsERG+BBR·HCl group was 0.36 cm². 2 0.10cm 2 0.26cm 2 0.01cm 2 0.15cm 2 and 0.26cm 2 SPSS ANOVA analysis revealed no significant differences between the dsERG-BBR·HCl group and the other experimental groups, except for a significant difference with the control group (CK). This may be because the surface friction treatment allowed all pesticide solutions to easily penetrate into the plant, preventing the dsERG-BBR·HCl nanopesticide from exerting its unique nanoparticle properties, thus resulting in no significant differences between the different experimental groups. Considering the disease severity and average gray mold patch area, the dsERG-BBR·HCl group was at the lowest level, significantly lower than other treatment groups. This indicates that dsERG-BBR·HCl has a certain crop protection effect and can prevent crop infection through pre-application.
[0215] Example 12: Determination of the bactericidal activity and therapeutic effect of dsERG-BBR·HCl
[0216] Cherry tomatoes, as one of the crops most severely affected by gray mold, were selected as a model crop for the fungicide activity assay. Figure 12 (A) It can be observed that the number and area of gray mold spots on the CK group were significantly higher than those on other experimental groups, indicating that cherry tomatoes are easily infected by gray mold without pesticide application. By observing the growth of gray mold on cherry tomatoes daily and recording the corresponding disease severity, [the following data was obtained]. Figure 12 (B) It can be seen that on day 7, the disease severity, from low to high, was as follows: dsERG-BBR·HCl group, 1 / 2 dsERG-BBR·HCl group, BBR·HCl group, dsERG+ BBR·HCl group, dsERG group, and CK group. Next, ImageJ software was used to measure the area of gray mold spots on each cherry tomato. Figure 12(C) It can be seen that the average gray mold patch area of the CK group, dsERG group, BBR·HCl group, dsERG-BBR·HCl group, 1 / 2dsERG-BBR·HCl group, and dsERG+BBR-HCl group was 1.33 cm². 2 0.26cm 2 0.20cm 2 0.10cm 2 0.15cm 2 and 0.28cm 2 ANOVA analysis using SPSS revealed significant differences between the CK group and all experimental groups, but no significant differences among the experimental groups themselves. This result is likely consistent with the analysis in Example 9. Although there were no significant differences among the experimental groups, the disease severity and average gray mold patch area in the dsERG-BBR·HCl group were the lowest among all treatment groups. This indicates that dsERG-BBR·HCl still possesses certain fungicidal activity and can inhibit the growth of gray mold even when infected.
[0217] In summary, these results all indicate that the self-assembled nanopesticide dsERG-BBR·HCl has better protective effects on plants and better control effects on gray mold than the single-application formulation. Therefore, we believe that the nanopesticide dsERG-BBR·HCl prepared using microfluidic technology has certain application potential in the control of gray mold.
[0218] Partial sequence of this article:
[0219] >SEQ ID NO: 1_dsERG
[0220] ATGCTACGGTGGTACCAACGCCGTTTTCAACGCTGTCAACTGGGTAGAATCATCTGCATGGGATGGAAG AGACGCCATTGTCGTTGCTGGAGATATTGCTCTATATGCCAAGGGTGCTGCACGTCCAACTGGAGGTGCTGGAGCTG TTGCCATGTTGATTGGACCAAATGCTCCAGTTGTTGTCGAGCCTGGTCTTCGCGGATCCTACATGCAACATGCCTAC GATTTCTACAACTGTTTTGACAACCCCCGTATTTGGCAAAGATGTAGTTTACGACTGCCCAAATGCGAAGTTGATGG AGCAAAAGAAGTTCATGAAAATTGGCTTGTCTACAGAAGCTTTCCGATCCTACGTCCCAATCATACAAATGGAGGTG GAAAACTTTATGAAGCGTTCTTCGGCGTTCAAAGGTCCAAAGGGAACTGCTGACATTGGTCCCGCTATGGCTGAAAT CACCATCTACACTGCTTCGCACACTCTGCAAGGAAAGGAAGTCCGCGATCGATTCGATACCTCCTTTGCCTCTCTCT ACCACGACCTAGAAGCAGATTGTTATTTTGGCCATCTCACCATCATCGCAGATGGATATGCCTCCAAATTCCGCAAG CAATACATCAACAAAACTCCCATTGTCAAAAGTAAATTCTACGCTCTAGAATTAATAGATTGTCCCATGCCAGCTCC CAATCATGGAATCGTAGTCCTCTCGGACGTCTCCCCAGTTCTCCTCTATCAAATCGGTACCCACGA
[0221] >RNA of SEQ ID NO:2_dsERG
[0222] AUGCUACGGUGGUACCAACGCCGUUUUCAACGCUGUCAACUGGGUAGAAUCAUCUGCAUGGGAUGGAAG AGACGCCAUUGUCGUUGCUGGAGAUAUUGCUCUAUAUGCCAAGGGUGCUGCACGUCCAACUGGAGGUGCUGGAGCUG UUGCCAUGUUGAUUGGACCAAAUGCUCCAGUUGUUGUCGAGCCUGGUCUUCGCGGAUCCUACAUGCAACAUGCCUAC GAUUUCUACAACUGUUUUGACAACCCCCGUAUUUGGCAAAGAUGUAGUUUACGACUGCCCAAAUGCGAAGUUGAUGG AGCAAAAGAAGUUCAUGAAAAUUGGCUUGUCUACAGAAGCUUUCCGAUCCUACGUCCCAAUCAUACAAAUGGAGGUG GAAAACUUUAUGAAGCGUUCUUCGGCGUUCAAAGGUCCAAAGGGAACUGCUGACAUUGGUCCCGCUAUGGCUGAAAU CACCAUCUACACUGCUUCGCACACUCUGCAAGGAAAGGAAGUCCGCGAUCGAUUCGAUACCUCCUUUGCCUCUCUCU ACCACGACCUAGAAGCAGAUUGUUAUUUUGGCCAUCUCACCAUCAUCGCAGAUGGAUAUGCCUCCAAAUUCCGCAAG CAAUACAUCAACAAAACUCCCAUUGUCAAAAGUAAAUUCUACGCUCUAGAAUUAAUAGAUUGUCCCAUGCCAGCUCC CAAUCAUGGAAUCGUAGUCCUCUCGGACGUCUCCCCAGUUCUCCUCUAUCAAAUCGGUACCCACGA
[0223] >SEQ ID NO:3_ ERG13
[0224] AUGCUACGGUGGUACCAACGCCGUUUUCAACGCUGUCAACUGGGUAGAAUCAUCUGCAUGGGAUGGAAGAGACGCCAUUGUCGUUGCUGGAGAUAUUGCUCUAUAUGCCAAGGGUGCUGCACGUCCAACUGGAGGUGCUGGAGCUGUUGCCAUGUUGAUUGGACCAAAUGCUCCAGUUGUUGUCGAGCCUGGUCUUCGCGGAUCCUACAUGCAACAUGCCUACGAUUUCUACAA
[0225] >SEQ ID NO:4_ERG11
[0226] CUGUUUUGACAACCCCCGUAUUUGGCAAAGAUGUAGUUUACGACUGCCCAAAUGCGAAGUUGAUGGAGCAAAAGAAGUUCAUGAAAAUUGGCUUGUCUACAGAAGCUUUCCGAUCCUACGUCCCAAUCAUACAAAUGGAGGUGGAAAACUUUAUGAAGCGUUCUUCGGCGUUCAAAGGUCCAAAGGGAACUGCUGACAUUGGUCCCGCUAUGGCUGAAAUCACCAUCUACACUGCUUCGCACACUCUGCAAGGAAAGGAAGUCCGCGAUCGAUUCGAUACCUCCUUUGCCUCUCUCUACCACGACCU
[0227] >SEQ ID NO:5_ERG1
[0228] AGAAGCAGAUUGUUAUUUUGGCCAUCUCACCAUCAUCGCAGAUGGAUAUGCCUCCAAAUUCCGCAAGCAAUACAUCAACAAAACUCCCAUUGUCAAAAGUAAAUUCUACGCUCUAGAAUUAAUAGAUUGUCCCAUGCCAGCUCCCAAUCAUGGAAUCGUAGUCCUCUCGGACGUCUCCCCAGUUCUCCUCUAUCAAAUCGGUACCCACGA
Claims
1. A nanoparticle, characterized in that, The nanoparticle comprises or consists of berberine hydrochloride and a nucleic acid molecule; wherein the nucleic acid molecule comprises double-stranded RNA comprising a first RNA targeting ERG13, a second RNA targeting ERG11 and a third RNA targeting ERG1.
2. The nanoparticle of claim 1, wherein, The first RNA, the second RNA and the third RNA: (1) are separate molecules, (2) are directly linked or linked via a linker, and / or (3) are directly linked or linked via a linker; Preferably, the (2) comprises: the first RNA and the second RNA are linked in the order of 5' to 3' or in the order of 3' to 5', the first RNA and the third RNA are linked in the order of 5' to 3' or in the order of 3' to 5', and / or the second RNA and the third RNA are linked in the order of 5' to 3' or in the order of 3' to 5'; Preferably, the (3) comprises: the first RNA, the second RNA and the third RNA are linked in the order of 5' to 3' or in the order of 3' to 5', the first RNA, the third RNA and the second RNA are linked in the order of 5' to 3' or in the order of 3' to 5', the second RNA, the first RNA and the third RNA are linked in the order of 5' to 3' or in the order of 3' to 5', the second RNA, the third RNA and the first RNA are linked in the order of 5' to 3' or in the order of 3' to 5', the third RNA, the first RNA and the second RNA are linked in the order of 5' to 3' or in the order of 3' to 5', and / or the third RNA, the second RNA and the first RNA are linked in the order of 5' to 3' or in the order of 3' to 5'; Preferably, the first RNA comprises the sequence shown in SEQ ID NO: 3; Preferably, the second RNA comprises the sequence shown in SEQ ID NO: 4; Preferably, the third RNA comprises the sequence shown in SEQ ID NO: 5; Preferably, one of the strands of the double-stranded RNA is shown in SEQ ID NO:
2.
3. The nanoparticle of claim 1 or 2, wherein The nanoparticle satisfies one or more of the following characteristics: The berberine hydrochloride and the nucleic acid molecule form the nanoparticle through non-covalent interaction; The berberine hydrochloride and the nucleic acid molecule form the nanoparticle through electrostatic adsorption; The ratio of the number of moles of nitrogen atoms in the berberine hydrochloride to the number of moles of phosphorus atoms in the nucleic acid molecule is 1:1-9:1; preferably, the ratio of the number of moles is 1:1-5:1 or 1:1-3:1; The nanoparticle has a particle size of less than or equal to 500 nm or less than or equal to 200 nm, for example 10-200 nm, 30-150 nm, 40-80 nm or 40-50 nm; The nanoparticle has a polydispersity coefficient of less than or equal to 0.5 or less than or equal to 0.3, for example 0.2-0.3; The nanoparticle has a Zeta potential value of 1-5 mV or 2-3 mV; The nanoparticle has a particle size change rate of ≤5% within 7 days under storage conditions of 4°C, and no obvious agglomeration phenomenon.
4. Process for the preparation of the nanoparticles according to any one of claims 1 to 3, characterized in that, The method comprises providing berberine hydrochloride and the nucleic acid molecule, mixing uniformly, and the mixture is the nanoparticle; Preferably, the mixing comprises mixing by a microfluidic method. Preferably, the mixing comprises mixing by a microfluidic reactor.
5. The method of claim 4, wherein, The method comprises the following steps: (1) providing a solution containing the nucleic acid molecule; (2) providing a solution containing berberine hydrochloride; (3) injecting the solutions of steps (1) and (2) into two feed channels of a microfluidic reactor, respectively, and the mixture is the nanoparticle; Preferably, the flow rate ratio of the solution containing the nucleic acid molecule and the solution containing berberine hydrochloride is 1:5-2:1, preferably 1:5-1:1; Preferably, the microfluidic reactor comprises one or more of a capillary microreactor, a T-shaped microreactor, a Y-shaped microreactor, a herringbone fishbone structure microreactor, an LTF microreactor, a heart-shaped microreactor, and a snake-shaped microreactor.
6. A method for reducing the particle size and stabilizing a nanoparticle comprising berberine hydrochloride and a nucleic acid molecule, the method comprising mixing the berberine hydrochloride and the nucleic acid molecule using a microfluidic method, the mixture being the nanoparticle; wherein, The nanoparticle is as claimed in any one of claims 1-3; Preferably, the microfluidic method mixing is by a microfluidic reactor; Preferably, the solution containing the nucleic acid molecule and the solution containing berberine hydrochloride are injected into two feed channels of a microfluidic reactor, respectively, and the flow rate ratio of the solution containing the nucleic acid molecule and the solution containing berberine hydrochloride is 1:5-2:1, preferably 1:5-1:
1.
7. A formulation or a pesticide composition containing the nanoparticle as claimed in any one of claims 1-3, and optionally a pesticide-acceptable carrier; Preferably, the formulation or pesticide composition dosage form comprises an aqueous solution, a suspension, a wettable powder, an emulsifiable concentrate, an emulsion, a sprayable solution, an aqueous dispersion, a powder, a granule, or a microcapsule.
8. A method for controlling plant gray mold, the method comprising applying to a subject in need of control a formulation carrying a nucleic acid suppressor and capable of expressing the nucleic acid suppressor or a formulation carrying the nanoparticle of any one of claims 1-3, wherein, The nucleic acid inhibitor comprises the nucleic acid molecule as claimed in claim 1 or 2.
9. The method of claim 8, wherein, The object comprises vegetables, fruits, ornamental plants, field crops, and wild plants, and / or The object comprises fungi containing ergosterol, such as Ascomycota or Basidiomycota.
10. The use of nanoparticles according to any one of claims 1 to 3 for the control of grey mould of plants, characterized in that The application comprises a prophylactic application and a therapeutic application; The prophylactic application is that the nanoparticle pesticide solution is applied to the surface of the plant when the plant is not infected with Botrytis cinerea; The therapeutic application is that the nanoparticle pesticide solution is applied to the diseased part after the plant is infected with Botrytis cinerea, preferably 15-25 μL of the nanoparticle is applied to each diseased part. The nanoparticle is as claimed in any one of claims 1-3; Preferably, the microfluidic method mixing is by a microfluidic reactor; Preferably, the solution containing the nucleic acid molecule and the solution containing berberine hydrochloride are injected into two feed channels of a microfluidic reactor, respectively, and the flow rate ratio of the solution containing the nucleic acid molecule and the solution containing berberine hydrochloride is 1:5-2:1, preferably 1:5-1:
1.
7. A formulation or a pesticide composition containing the nanoparticle as claimed in any one of claims 1-3, and optionally a pesticide-acceptable carrier; Preferably, the formulation or pesticide composition dosage form comprises an aqueous solution, a suspension, a wettable powder, an emulsifiable concentrate, an emulsion, a sprayable solution, an aqueous dispersion, a powder, a granule, or a microcapsule. The nucleic acid inhibitor comprises the nucleic acid molecule as claimed in claim 1 or 2. The object comprises vegetables, fruits, ornamental plants, field crops, and wild plants, and / or The object comprises fungi containing ergosterol, such as Ascomycota or Basidiomycota. The application comprises a prophylactic application and a therapeutic application; The prophylactic application is that the nanoparticle pesticide solution is applied to the surface of the plant when the plant is not infected with Botrytis cinerea; The therapeutic application is that the nanoparticle pesticide solution is applied to the diseased part after the plant is infected with Botrytis cinerea, preferably 15-25 μL of the nanoparticle is applied to each diseased part.