High-quality single-cell Hi-C library building method

Abstract

The invention relates to the technical field of single-cell sequencing, and discloses a high-quality single-cell Hi-C library building method, which comprises the following steps: by utilizing a cumulative effect, carrying out cross-linking immobilization, enzyme digestion, biotinylated nucleotide filling-in and connection on population cells, sorting single cells, immediately marking different bar code combinations on each cell, mixing extracts of each cell, and carrying out high-quality single-cell Hi-C library building. After mixing, the cell population is equivalent to a small amount of cell population, enriching biotinylated DNA by using streptavidin magnetic beads, and finally establishing a library. According to the method, the library quality can be remarkably improved while the single cell resolution is maintained.

Description

Technical Field

[0001] This invention relates to the field of single-cell sequencing technology, and in particular to a high-quality single-cell Hi-C library preparation method. Background Technology

[0002] Chromatin three-dimensional structure resolution technology is a core tool for studying the spatial folding state of the genome and the regulation of cell fate. Among them, Hi-C (High-throughput / resolution chromosome conformation capture) technology captures spatially adjacent DNA fragments through steps such as chromatin fixation, restriction enzyme digestion, end repair, and ligation, and constructs a three-dimensional genome interaction map with the help of high-throughput sequencing. However, traditional Hi-C relies on a population of millions of cells as input, and the interaction frequencies obtained only reflect the population average structure, making it difficult to reveal the heterogeneity between cells.

[0003] With the development of single-cell omics, researchers have combined in-situ Hi-C with technologies such as microsorting and microfluidics to propose various single-cell Hi-C protocols, enabling the resolution of chromatin interaction structures at the single-cell level. However, existing single-cell Hi-C technologies still face significant technical bottlenecks. For example, the currently common procedure involves cross-linking, enzyme digestion, and ligation within a population of cells, followed by the separation of individual cells using flow cytometry or microfluidics for library construction. However, due to the extremely low total amount of DNA available for sequencing in a single cell, and the difficulty of effectively enriching biotin at the single-cell level in existing procedures, the proportion of effective Hi-C fragments in the library is low, resulting in sparse data.

[0004] In traditional population-based Hi-C technology, after enzyme digestion, the DNA ends are labeled using a biotin-dATP-mediated completion reaction, and streptavidin beads are used to enrich the biotinylated DNA before library construction, thereby significantly increasing the proportion of effective interacting fragments. However, in single-cell Hi-C workflows, because each cell contains very little DNA, it is impossible to directly and effectively enrich the DNA of a single cell, thus failing to benefit from the improved library quality brought about by the "biotin-enrichment-library construction" chain in population-based Hi-C.

[0005] Existing single-cell Hi-C methods typically involve sorting cells one by one for library construction after cell population fixation, enzyme digestion, and end ligation. However, due to the extremely low total DNA content of single cells and the difficulty in effectively implementing enrichment steps at the single-cell level, the proportion of effective Hi-C interacting fragments is low, resulting in highly sparse library data and sequencing data utilization typically less than 20%–30%. Furthermore, while existing combinatorial indexed Hi-C methods can achieve barcode combination under population conditions, their barcode introduction method fails to synergize with the traditional biotin enrichment step, making it impossible to simultaneously achieve both "population-enriched library quality improvement" and "single-cell origin traceability."

[0006] In view of this, the purpose of this invention is to provide a high-quality single-cell Hi-C library construction method. Utilizing the cumulative effect, this method involves cross-linking and fixing a population of cells, enzymatic digestion, biotinylated nucleotide completion, ligation, and immediate labeling of each cell with a different barcode combination through single-cell sorting. The extracts from each cell are then mixed, resulting in a small cell population. Biotinylated DNA is enriched using streptavidin magnetic beads, and finally, library construction is performed. This method can significantly improve library quality while maintaining single-cell resolution.

[0007] The present invention solves the above-mentioned technical problems through the following technical means:

[0008] In a first aspect, this invention discloses a high-quality single-cell Hi-C library construction method, comprising:

[0009] S1. Sample preparation and cell dissociation, enrichment of cell population, fixation of cell population, restriction enzyme digestion, addition of nucleotides with enrichable groups to the digestion ends for a finishing reaction, followed by blunt end ligation under the action of ligase to obtain a cell population treated with conformation capture.

[0010] S2. The cell population processed in step S1 is first filtered and then sorted by a sorting device to be distributed into the individual reaction wells of the multi-well plate in a single-cell manner.

[0011] S3. The sorted single cells are lysed in each reaction well, and DNA modification reagents carrying different barcode sequences are added to the lysis system to give the lysed single-cell DNA cell source identifier, thereby forming the corresponding single-cell lysate.

[0012] S4. Collect all single-cell lysates from the multiple reaction wells described in step S3 and combine them to obtain a mixed DNA sample with different barcode identifiers. Then, selectively enrich the mixed DNA using the enrichable groups introduced in the balancing reaction of step S1.

[0013] S5. Construct a sequencing library from the DNA enriched in step S4, and split the sequencing data at the single-cell level based on the barcode sequence introduced in step S3.

[0014] In the HiC stage, biotin-labeled DNA fragments are still used. During single-cell sorting, each cell is labeled with different combinations of barcodes, and the labeled single-cell lysates can be fused arbitrarily. This allows for biotin enrichment, library construction, and sequencing of DNA information from the entire cell rather than individual cells. Then, the previously used barcode combinations are used to break down the overall data into single-cell data, achieving the goal of single-cell information analysis.

[0015] Preferably, the restriction enzyme digestion in step S1 uses MboI, DpnII, or their equivalent tetrabase recognition restriction endonuclease.

[0016] Preferably, the enrichable group in step S1 is biotin, a biotin analog, or an affinity group that can be specifically captured.

[0017] Preferably, the balancing reaction in step S1 is carried out in the presence of Klenow enzyme, the nucleotide mixture in the balancing reaction includes dGTP, dCTP, dTTP and nucleotides with enrichment groups, and the ligation reaction in step S1 is carried out in the presence of T4 DNA ligase.

[0018] Preferably, the filtration in step 2 is performed using a 40μm or 70μm cell sieve, the sorting device is a flow cytometer, and the multi-well plate is a 96-well plate or a 384-well plate.

[0019] Preferably, the lysis reaction in step S3 is carried out in a lysis system containing proteinase K at a temperature of 50°C-60°C for 30-90 minutes. The DNA modification reagent is a Tn5 transposase carrying a barcode sequence. The barcode sequence of the DNA modification reagent is formed by combining a first barcode and a second barcode, and is used to uniquely identify single-cell origin.

[0020] Preferably, the selective enrichment in step S4 is achieved using streptavidin magnetic beads, and the enrichment process involves at least two washes to remove DNA fragments without enrichable groups.

[0021] Preferably, the library construction step S5 includes adding paired-end adapters to the enriched DNA, performing an amplification reaction, and forming a sequencing library suitable for a high-throughput sequencing platform. The sequencing is performed using a paired-end sequencing mode of 2×100bp, 2×150bp, or 2×250bp, and the sequencing data is split into single cells based on the barcode sequence to restore single-cell chromatin interaction information.

[0022] Secondly, this invention provides the application of the single-cell Hi-C sequencing library constructed by the above method in identifying differences in chromatin interaction patterns among cell subpopulations, inferring cell state transitions, and constructing single-cell 3D genome maps.

[0023] Thirdly, the present invention provides the above-mentioned high-quality single-cell Hi-C library construction method, or the application of the single-cell Hi-C sequencing library obtained by the method in the preparation of detection kits, detection devices or detection systems for research on developmental process regulation, tumor cell heterogeneity analysis or immune cell differentiation research.

[0024] The beneficial effects of this invention are:

[0025] 1. This invention achieves stable introduction of enrichable groups onto large-scale DNA by completing key conformation capture steps such as cross-linking, restriction enzyme digestion, biotinylation completion, and end joining at the cell population stage. Subsequently, after single-cell sorting, each cell is independently added to a barcode labeling system, enabling accurate differentiation of single-cell sources in subsequent data analysis. This strategy achieves the first effective integration of population-level enrichment and single-cell tracking capabilities, providing a new construction path for single-cell Hi-C technology.

[0026] 2. This invention overcomes the bottleneck of existing single-cell Hi-C methods, which cannot effectively enrich the DNA library. By combining all barcoded single-cell lysates before biotin enrichment, this invention ensures the enrichment process is performed under conditions of sufficient DNA quantity, thereby significantly improving library quality. The method of this invention can increase sequencing data utilization to 60%, a three-fold improvement compared to the conventional single-cell Hi-C method's 20%.

[0027] 3. This invention enables the acquisition of single-cell Hi-C libraries with higher coverage and significantly reduced sparsity, allowing for more accurate reconstruction of higher-order chromatin structures such as TADs, A / B compartments, and loops at single-cell resolution. This further facilitates key biological analyses such as identifying differences in chromatin interactions within cell populations, inferring cell state transitions, and reconstructing cell fate trajectories, demonstrating significant application value in developmental biology, stem cell research, tumor heterogeneity analysis, and immune cell differentiation research.

[0028] 4. This invention employs a Tn5-based dual-barcode combination system, enabling high-throughput operation in 96-well or 384-well plates, and exhibiting excellent process compatibility and scalability. This method is suitable for both conventional laboratory environments and automated library construction platforms, supporting the construction of large-scale single-cell 3D genome maps, providing a high-quality foundational tool for scientific research and the development of related diagnostic products. Attached Figure Description

[0029] Figure 1This is a flowchart illustrating the present invention;

[0030] Figure 2 These are the interaction heatmaps and effective read ratios of the embodiments and Comparative Example 1. Detailed Implementation

[0031] The technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0032] Example 1

[0033] like Figure 1 As shown, a high-quality single-cell Hi-C library construction method includes:

[0034] S1. Sample preparation and cell dissociation, enrichment of cell population, fixation of cell population, restriction enzyme digestion, addition of nucleotides with enrichable groups to the digestion ends for a finishing reaction, followed by blunt end ligation under the action of ligase to obtain a cell population treated with conformation capture.

[0035] (1) Sample preparation and cell dissociation

[0036] Tissue was digested with acutase for 10-20 min, centrifuged to collect the pellet, resuspended in PBS and gently passed through a 70 μm cell sieve. Live cells could be enriched using MACS or FACS depending on the sample conditions.

[0037] (2) Cell fixation

[0038] Incubate with 1% paraformaldehyde at room temperature for 10 min, then add glycine to a final concentration of 125 mM and incubate at room temperature for 5 min to neutralize and fix. Centrifuge and discard the supernatant. Place the sample on ice and wash three times with ice-cold PBS.

[0039] (3) Cell lysis (Hi-C pretreatment)

[0040] Add 1 mL of ice-cold Hi-C lysis buffer containing: 10 mM Tris-HCl (pH=7.4), 10 mM NaCl, 0.1 mM EDTA, 0.5% NP-40, and 1× protease inhibitor; incubate on ice for 30-60 min, centrifuge and discard the supernatant, then wash once with lysis buffer; wash the precipitate once with 1× NEB Buffer 3.1.

[0041] (4) Nuclear membrane opening and restriction enzyme digestion

[0042] Add 10 μL of 0.5% SDS and incubate at 62℃ for 10 min; then add 25 μL of water and 5 μL of 10% Triton X-100 and incubate at 37℃ for 15 min to neutralize; add 5 μL of 10×NEB Buffer 3.1 and 2 μL of MboI; incubate overnight at 37℃ to complete the sticky end cleavage of chromatin.

[0043] (5) Filling in the gaps (introducing enrichable groups)

[0044] Add dG / T / CTP, biotin-14-dATP, and Klenow enzyme and incubate at 37°C for 1 hour. Introduce biotin at the 5' end of the enzyme digestion to enrich the group.

[0045] (6) Flat-end connection (conformation capture)

[0046] Add 10× T4 DNA ligase buffer, 10% Triton X-100, BSA, and T4 DNA ligase, and incubate at room temperature for 4 hours.

[0047] S2. The cell population processed in step S1 is first filtered and then sorted by a sorting device to be distributed into the individual reaction wells of the multi-well plate in a single-cell manner.

[0048] Cells subjected to centrifugation and conformational capture were resuspended in PBS and passed through a 40 μm cell sieve again. Single cells were sorted into 96-well plates using flow cytometry (FACS); each well was pre-filled with lysis buffer containing 100 ng / mL proteinase K.

[0049] S3. The sorted single cells are lysed in each reaction well, and DNA modification reagents carrying different barcode sequences are added to the lysis system to give the lysed single-cell DNA cell source identifier, thereby forming the corresponding single-cell lysate.

[0050] After sorting, the 96-well plates were incubated at 58°C for 1 hour to complete lysis. A barcoded Tn5 transposase with different barcode combinations (e.g., T5×T7 combination) was added to each well: the transposition reaction was performed at 55°C for 10 minutes to obtain a unique barcode sequence for each single-cell DNA; the reaction was terminated with 250 mM EDTA; the lysates from all wells were collected and DNA was extracted. The barcode combinations are shown in Tables 1 and 2.

[0051] Table 1

[0052] T5-1 TTTCCCTACACGACGCTCTTCCGATCTTATAGCCTGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-2 TTTCCCTACACGACGCTCTTCCGATCTATAGAGGCGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-3 TTTCCCTACACGACGCTCTTCCGATCTCCTATCCTGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-4 TTTCCCTACACGACGCTCTTCCGATCTGGCTCTGAGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-5 TTTCCCTACACGACGCTCTTCCGATCTAGGCGAAGGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-6 TTTCCCTACACGACGCTCTTCCGATCTTAATCTTAGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-7 TTTCCCTACACGACGCTCTTCCGATCTCAGGACGTGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-8 TTTCCCTACACGACGCTCTTCCGATCTGTACTGACGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-9 TTTCCCTACACGACGCTCTTCCGATCTTAGGTATGGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-10 TTTCCCTACACGACGCTCTTCCGATCTAACACCTAGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-11 TTTCCCTACACGACGCTCTTCCGATCTCTCCGAACGCGATCGAGGACGGCAGATGTGTATAAGAGACAG T5-12 TTTCCCTACACGACGCTCTTCCGATCTCAACGGCAGCGATCGAGGACGGCAGATGTGTATAAGAGACAG

[0053] Table 2

[0054] T7-1 GAGTTCAGACGTGTGCTCTTCCGATCTCGAGTAATCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-2 GAGTTCAGACGTGTGCTCTTCCGATCTTCTCCGGACACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-3 GAGTTCAGACGTGTGCTCTTCCGATCTAATGAGCGCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-4 GAGTTCAGACGTGTGCTCTTCCGATCTGGAATCTCCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-5 GAGTTCAGACGTGTGCTCTTCCGATCTTTCTGAATCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-6 GAGTTCAGACGTGTGCTCTTCCGATCTACGAATTCCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-7 GAGTTCAGACGTGTGCTCTTCCGATCTAGCTTCAGCACCGTCTCCGCCTCAGATGTGTATAAGAGACAG T7-8 GAGTTCAGACGTGTGCTCTTCCGATCTGCGCATTACACCGTCTCCGCCTCAGATGTGTATAAGAGACAG

[0055] S4. Collect all single-cell lysates from the multiple reaction wells described in step S3 and combine them to obtain a mixed DNA sample with different barcode identifiers. Then, selectively enrich the mixed DNA using the enrichable groups introduced in the balancing reaction of step S1.

[0056] Cell lysates from all reaction wells were combined to form a mixed DNA sample containing different barcode markers. DNA was selectively enriched using 10 μL of C1 streptavidin magnetic beads, with rotation binding for 20–30 min. The sample was then washed at least twice with B&W buffer to remove unbiotinylated fragments.

[0057] S5. Construct a sequencing library from the DNA enriched in step S4, and split the sequencing data at the single-cell level based on the barcode sequence introduced in step S3.

[0058] Add paired-end adapters to enriched DNA, amplify by PCR for 10-14 cycles, purify and quantify. Use Illumina NovaSeq™ 6000; sequencing mode PE150, library fragment size approximately 300±50 bp. Use the Q30 index to assess data quality; split reads according to Tn5 barcodes (T5×T7); obtain the Hi-C interaction matrix at the single-cell level.

[0059] Data processing: Quality control was performed on the HiC sequencing data, including the removal of adapter sequences and low-quality sequences. The processed data was aligned with the human genome, and quality control was performed based on the alignment specificity. Significance screening was performed using p-values ​​or q-values. Data processing was performed using HiC-Pro (version 3.1.0), including read alignment, resolution matrix quantification, and matrix normalization. Subsequent analysis was conducted using the three-dimensional genome interaction information provided by HiC-Pro.

[0060] Comparative Example 1

[0061] This comparative example uses the Dip-C method reported by Longzhi Tan et al. (Science, 2018) to resolve the three-dimensional structure of a single-cell genome. The specific steps are as follows:

[0062] Step 1: In situ conformational capture (immobilization, enzyme digestion, and ligation)

[0063] Take 1×10⁻⁶ GM12878 cells (in G1 or G0 phase) or isolated PBMC cells. 6Collect cells by centrifugation. Add 1% formaldehyde (final concentration) to the cell pellet and fix at room temperature for 10 min. Then add 125 mmol / L glycine to terminate the reaction for 5 min, centrifuge and discard the supernatant. Wash three times with pre-cooled PBS, gently mixing to avoid cell rupture. Add an appropriate amount of restriction endonuclease to the fixed cell suspension and incubate at 37°C for 1-2 h to allow chromatin to be cleaved in situ into fragments of approximately 300-500 bp. Add T4 DNAligase and ligation buffer to allow spatially adjacent DNA ends to ligate in the nucleus; incubate at room temperature for 4 h. Collect cells by centrifugation, discard the supernatant, and retain the cell pellet for subsequent operations.

[0064] Step 2: Single-cell isolation

[0065] The treated cells were resuspended in PBS containing 0.1% BSA and filtered to remove aggregates. Single cells were then precisely sorted into individual wells of 96-well or 384-well plates using flow cytometry. Each well contained only one cell, with a final volume of approximately 2-5 μL.

[0066] Step 3: Single-cell lysis

[0067] Add lysis buffer (containing SDS or Proteinase K) to each single-cell well and incubate at 60°C for 1.5 h to completely lyse the cell membrane and nuclear membrane, releasing the ligation products. Terminate the lysis reaction by adding a stop solution.

[0068] Step 4: META whole genome amplification. The ligation products in the lysis buffer are subjected to META amplification.

[0069] Random primers (N6 / N8) containing end-tags are added to the lysed DNA suspension to initiate DNA synthesis across the entire genome. High-temperature denaturation followed by low-temperature annealing allows the random primers to attach a tag sequence to the ends of the DNA molecule. Amplification is then performed in a system containing DNA polymerase and amplification buffer, typically involving 20-30 cycles to ensure the ligation product is sufficiently amplified to a library-constructable level.

[0070] Step 5: Library construction, independent indexing, and PCR amplification

[0071] The amplification products were purified using magnetic beads (AMPure Beads) with an elution volume of 10-20 μL. Adapters were added according to the standard Illumina library preparation system, and PCR amplification was performed after primer annealing. A unique index sequence was added to each single-cell reaction well to ensure that libraries from different single cells could be distinguished after sequencing. PCR amplification resulted in libraries suitable for high-throughput sequencing.

[0072] Step 6: High-throughput sequencing and data splitting

[0073] The library preparation products amplified from each well were mixed and then subjected to high-throughput sequencing. The sequencing data were demultiplexed according to their respective index sequences to correspond to individual single cells.

[0074] The examples and Comparative Example 1 were compared, and the same analysis was performed using the HiC-Pro tool. Figure 2 As shown, the comparison revealed that the data utilization rate increased from 20% to 60%, and a more complete single-cell HiC atlas could be drawn with the same amount of sequencing data.

[0075] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. A high-quality single-cell Hi-C library construction method, characterized in that, The method comprises the following steps: S1, sample preparation and cell dissociation, enrichment of cell population, fixation of cell population, restriction enzyme digestion, and addition of nucleotides with an enrichment group to the ends of the enzyme digestion for filling reaction, followed by blunt end ligation under the action of ligase to obtain a cell population treated by conformation capture; S2, the cell population treated in step S1 is filtered and then distributed into independent reaction wells of a multi-well plate by a sorting device in a single cell manner; S3, each single cell sorted in each reaction well is lysed, and a DNA modification reagent carrying different barcode sequences is added to the lysis system, so that the DNA of the lysed single cell obtains a cell source identifier, thereby forming a corresponding single cell lysate; S4, all single cell lysates in the multiple reaction wells in step S3 are collected and combined to obtain a mixed DNA sample containing different barcode identifiers, and the mixed DNA is selectively enriched by the enrichment group introduced in the filling reaction of step S1; S5, the DNA enriched in step S4 is subjected to library construction, and the sequencing data is split at the single cell level according to the barcode sequence introduced in step S3.

2. The high-quality single-cell Hi-C library construction method of claim 1, wherein: The restriction enzyme digestion in step S1 uses MboI, DpnII or an equivalent four-base recognition restriction enzyme.

3. The high-quality single-cell Hi-C library construction method of claim 2, wherein: The enrichment group in step S1 is biotin, a biotin analogue or an affinity group that can be specifically captured.

4. The high-quality single-cell Hi-C library construction method of claim 3, wherein: The filling reaction in step S1 is carried out in the presence of Klenow enzyme, and the nucleotide mixture of the filling reaction includes dGTP, dCTP, dTTP and nucleotides with an enrichment group. The ligation reaction in step S1 is carried out in the presence of T4 DNA ligase.

5. The high-quality single-cell Hi-C library construction method of claim 4, wherein: The filtration in step 2 is filtration with a 40 μm or 70 μm cell screen, the sorting device is a flow cytometer, and the multi-well plate is a 96-well plate or a 384-well plate.

6. The high-quality single-cell Hi-C library construction method of claim 5, wherein: The lysis reaction in step S3 is carried out in a lysis system containing proteinase K at 50-60°C for 30-90 minutes, the DNA modification reagent is Tn5 transposase carrying a barcode sequence, and the barcode sequence of the DNA modification reagent is formed by combination of a first barcode and a second barcode for uniquely identifying the single cell source.

7. The high-quality single-cell Hi-C library construction method of claim 6, wherein: The selective enrichment in step S4 is achieved by streptavidin magnetic beads, and at least two washes are performed during the enrichment process to remove DNA fragments without the enrichment group.

8. The high-quality single-cell Hi-C library construction method of claim 7, wherein: The library construction step in step S5 includes adding double-end adapters to the enriched DNA, performing amplification reaction and forming a sequencing library suitable for high-throughput sequencing platform, the sequencing is carried out in a double-end sequencing mode of 2×100 bp, 2×150 bp or 2×250 bp, and the sequencing data is split at the single cell level based on the barcode sequence to recover the single cell chromatin interaction information.

9. Use of the single cell Hi-C sequencing library constructed by the method of any one of claims 1-8 in identifying differences in chromatin interaction patterns between cell subpopulations, inferring cell state transitions, and constructing single cell 3D genome maps.

10. The high-quality single-cell Hi-C library construction method according to any one of claims 1-8, or a single-cell Hi-C sequencing library obtained by using the method, for use in the preparation of a detection kit, a detection device or a detection system for developmental process regulation research, tumor cell heterogeneity analysis or immune cell differentiation research.

Images