A crhr1 gene molecular marker for detecting superovulation trait of cattle and application method thereof
By cloning the bovine CRHR1 gene fragment and detecting SNP sites, the problem of large differences in superovulation traits in female animals was solved, enabling precise evaluation and genetic improvement of the superovulation effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JILIN UNIVERSITY
- Filing Date
- 2026-02-03
- Publication Date
- 2026-05-29
AI Technical Summary
In livestock production, there is a great deal of variation in superovulation traits among female animals, and existing technologies make it difficult to effectively utilize genetic polymorphism to evaluate and select for superovulation.
By cloning the bovine CRHR1 gene fragment, designing specific primers for PCR amplification, detecting SNP sites in genomic DNA, and using sequence determination and association analysis to determine the relationship between different genotypes and superovulation traits, molecular markers for bovine superovulation traits are provided.
The influence of SNPs at specific loci of the CRHR1 gene on superovulation in cattle has been clarified, providing an important molecular marker for marker-assisted selection in cattle, improving the predictive accuracy of superovulation and providing a theoretical basis for genetic improvement.
Smart Images

Figure CN121610586B_ABST
Abstract
Description
Technical Field
[0001] This invention discloses a molecular marker for detecting the superovulation trait in bovine CRHR1 gene and its application method, specifically involving the cloning of bovine CRHR1 gene fragments and their application in bovine marker-assisted selection, belonging to the field of animal genetic engineering technology. Background Technology
[0002] In livestock production, superovulation and embryo transfer techniques are commonly used to effectively utilize the production and reproductive performance of superior individuals. Before embryo transfer, superovulation is usually performed on superior female animals to obtain more high-quality embryos. However, in actual production, due to differences in genetic makeup, the superovulation traits of different female animals vary considerably. The total number of embryos obtained and the number of usable embryos are simple and direct indicators for evaluating the effectiveness of superovulation.
[0003] Numerous studies have found that the genetic basis of animals, namely genes, has a significant impact on the effect of superovulation, and the regulatory role of genes often depends on their polymorphisms. Single nucleotide polymorphisms (SNPs) are a class of gene polymorphisms that have received considerable attention. Numerous studies have shown that SNPs can regulate various reproductive traits in animals, including litter size, live birth rate, birth litter weight, and weaning litter weight (Silió et al., 2015; Selvaggi et al., 2019; He et al., 2020), and also influence the effect of superovulation (Yang et al., 2011; Zhang et al., 2011; Cory et al., 2012).
[0004] Some studies have shown that SNPs in the CRHR1 gene are associated with depression, panic disorder, post-traumatic stress disorder, and cognitive impairment and mental illness under stress (Keck et al., 2008; Rogers et al., 2013; Wang et al., 2011; Ishitobi et al., 2012; White et al., 2013). Other studies have shown that it plays an important pleiotropic role in regulating the biological effects of steroids as a major receptor for regulating the release of adrenocorticotropic hormone (Tantisira et al., 2004). However, its application in animal reproduction, especially in superovulation traits and early embryonic development, is very limited. Summary of the Invention
[0005] This invention discloses a molecular marker for detecting the superovulation trait in cattle, CRHR1 gene, and its application method. The purpose is to clone the bovine CRHR1 gene fragment and identify its specific mutation sites as a method for detecting polymorphisms in genes related to superovulation performance in cattle, providing a meaningful molecular marker for marker-assisted breeding in cattle.
[0006] The CRHR1 gene molecular marker for detecting superovulation in bovines, as described in this invention, is achieved through the following technical solution:
[0007] The 666bp sequence of CRHR1, a gene related to bovine superovulation performance, obtained by using specific primers and PCR, is shown in Table SEQ ID NO: 1.
[0008] The obtained CRHR1 gene fragment has a base mutation of ct at position 455 as described in SEQ ID NO: 1, resulting in a single nucleotide polymorphism (SNP).
[0009] The present invention describes a method for screening molecular markers suitable for bovine superovulation, which is prepared according to the following steps:
[0010] By designing a pair of specific primers:
[0011] Forward primer: CRHR1-fwd (SEQ ID NO:2): agttgtggcacatgggctcgat
[0012] Reverse primer: CRHR1-rev (SEQ ID NO:3): attctgcctcctgtcgccata.
[0013] Genomic DNA was extracted from bovine blood and amplified by PCR. A SNP polymorphism was generated due to a ct base mutation at position 455 of the PCR product DNA sequence, which was used to determine the specific genotype. Association analysis between the different genotypes and the superovulation trait in cattle showed that individuals with specific genotypes achieved better superovulation.
[0014] The present invention will now be described in detail:
[0015] I. Cloning of the bovine CRHR1 gene fragment
[0016] A pair of specific primers was designed using the biological software Oligo 6.0. The PCR reaction conditions were established as follows:
[0017] Forward primer: CRHR1-fwd (SEQ ID NO: 2): agttgtggcacatgggctcgat;
[0018] Reverse primer: CRHR1-rev (SEQ ID NO: 3): attctgcctcctgtcgccata.
[0019] To obtain good results quickly, this invention uses MonAmp™ ChemoHS qPCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.
[0020] II. PCR Product Sequencing and Genotype Determination
[0021] A 666 bp specific amplified fragment was obtained by amplifying bovine genomic DNA using primers CRHR1-fwd and CRHR1-rev. Sequencing results revealed that within this 666 bp fragment, due to a ct mutation at position 455, different genotypes (CC, CT, and TT) were generated. Specifically, CC-type individuals were homozygous for c at position 455; CT-type individuals were c / t heterozygous; and TT-type individuals were homozygous for t at position 455.
[0022] III. Marker-based trait association analysis
[0023] Using the experimental population as the experimental subjects, trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:
[0024] The statistical analysis model is: Y ij =μ+G i +e j ;
[0025] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.
[0026] The positive effects of this invention are as follows:
[0027] Association analysis between CRHR1 gene genetic polymorphism and bovine superovulation trait clarified the specific SNPs at CRHR1 gene loci and the impact of their genetic polymorphism on bovine superovulation. This provides important theoretical basis and application prospects for CRHR1 gene as a molecular marker for auxiliary selection of bovine superovulation and related reproductive performance, and for its application in genetic improvement in actual production. Attached Figure Description
[0028] Figure 1 The results of 1.5% agarose gel electrophoresis of the CRHR1 gene amplification product in Example 1 are shown (lane M is the standard molecular weight marker, lanes 1-6 are 6 randomly detected PCR products, with a clear and specific band at the 666bp position).
[0029] Figure 2 This is a sequencing peak diagram of the PCR products of the three genotypes in Example 1 (the arrows indicate the mutation sites. For CC genotype individuals, this site is a c base; for CT genotype individuals, this site is a c / t base; for TT genotype individuals, this site is a t base).
[0030] Figure 3 The results of 1.5% agarose gel electrophoresis of the CRHR1 gene amplification products in Example 2 are shown (lane M is the standard molecular weight marker, lanes 1-7 are 7 randomly detected PCR products, with a clear and specific band at the 666bp position).
[0031] Figure 4 This is a sequencing peak diagram of the PCR products of the three genotypes in Example 2 (the position indicated by the arrow is the mutation site. The site is c base for CC type individuals; c / t base for CT type individuals; and t base for TT type individuals). Detailed Implementation
[0032] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention.
[0033] Example 1
[0034] This invention uses extracted bovine genomic DNA (collected by the author in Changchun, Jilin Province, China) as a template, designs a pair of specific primers, clones a partial DNA sequence of the bovine CRHR1 gene, and provides molecular markers for marker-assisted selection in cattle by sequencing and genotyping, and by association analysis between different genotypes and superovulation traits.
[0035] 1. Cloning of a partial DNA fragment of the bovine CRHR1 gene
[0036] To ensure good primer quality, the primers in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences are shown in the description:
[0037] Forward primer: CRHR1-fwd (SEQ ID NO: 2): agttgtggcacatgggctcgat;
[0038] Reverse primer: CRHR1-rev (SEQ ID NO: 3): attctgcctcctgtcgccata;
[0039] The Taq enzyme, buffer, magnesium ions, dNTPs, etc. required in the PCR reaction can be selected by the user. To obtain good results quickly, this invention uses the 2× chemical dye quantitative PCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.
[0040] 2. PCR product sequencing and genotype determination
[0041] Bovine genomic DNA was amplified using primers CRHR1-fwd (SEQ ID NO: 2) and CRHR1-rev (SEQ ID NO: 3) to obtain a 666 bp specific amplified fragment. Figure 1 And SEQ ID NO:1). Sequencing results revealed that in this 666bp fragment, a mutation in ct at position 455bp led to the generation of different genotypes: CC, CT, and TT. Specifically, CC-type individuals were homozygous for c at position 455; CT-type individuals were c / t heterozygous at position 455; and TT-type individuals were homozygous for t at position 455. Figure 2 )
[0042] 3. Marker-trait association analysis
[0043] Using the applicant's experimental population as the experimental subjects, a trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:
[0044] The statistical analysis model is: Y ij=μ+G i +e j ;
[0045] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j These are the random residuals corresponding to the observed values;
[0046] 4. Cloning of partial DNA sequence of bovine CRHR1 gene and determination of different genotypes
[0047] The PCR amplification products were detected by 1.5% agarose gel electrophoresis and showed to be specific PCR products, such as... Figure 1 As shown in the image. The PCR product was recovered and sequenced, revealing a product length of 666 bp. Sequencing results showed a ct base mutation at position 455 bp in this fragment, with some sequencing peaks as shown in the image. Figure 2 As shown;
[0048] 5. Perform association analysis on marker traits
[0049] Association analysis of the amplified sequence of the bovine CRHR1 gene at polymorphic site 455 with the superovulation trait showed that among 149 randomly selected individuals, 16 were CC genotype, 89 were CT genotype, and 44 were TT genotype. The results (mean ± standard error) of the analysis of significant differences (mean ± standard error) between individuals with different genotypes in the number of usable embryos per head and the number of total embryos per head are shown in Table 1.
[0050] Table 1. Results of analysis of significant differences in superovulation traits among individuals with different genotypes
[0051]
[0052] Note: In the same row, different groups of data with different letters (a, b, c) under their headings indicate significant differences (P<0.05).
[0053] Average number of usable embryos per head = Total number of usable embryos obtained from multiple superovulation treatments / Number of superovulation treatments;
[0054] Total number of embryos per head = Total number of embryos obtained from multiple superovulation treatments / Number of superovulation treatments.
[0055] The analysis results show that there are significant differences in superovulation traits among individuals corresponding to different genotypes at this SNP locus. Overall, CC-type individuals have better superovulation outcomes than CT or TT-type individuals. When selecting superovulation donors, CC-type individuals should be given priority, while TT-type individuals should be avoided as much as possible.
[0056] Example 2
[0057] Fifty-nine individuals were randomly selected from the superovulation herd of cows at Hebei Tianhe Beef Cattle Breeding Co., Ltd. Blood samples were collected for genomic DNA extraction, and PCR amplification was performed using primers, a PCR reaction system, and conditions designed in this invention. PCR amplification was performed using 2× ChemoHS qPCR premix from MonAmp Biotechnology Co., Ltd. The specific reaction system consisted of: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix, 0.5 μl each of forward and reverse primers (both at a concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 38 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions were: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.
[0058] The amplification products were detected by 1.5% agarose gel electrophoresis, and the results showed that they were specific PCR products. Figure 3 As shown, lane M represents the standard molecular weight marker, and lanes 1-7 contain randomly selected PCR products for testing. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed a ct base mutation at 455 bp in this fragment, with some sequencing peaks as shown... Figure 4 As shown. Of all the individuals examined, 6 individuals belonged to the CC type; 12 individuals belonged to the CT type; and 41 individuals belonged to the TT type.
[0059] Based on the superovulation records of these 59 individuals, correlation analysis was performed using SPSS 22.0 software and a One-Way ANOVA procedure. ij =μ+G i +e j .
[0060] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.
[0061] The association analysis results (least squares values and standard deviations) between different genotypes and the superovulation trait for the number of usable embryos per head and the total number of embryos per head are shown in Table 2.
[0062] Table 2. Results of analysis on significant differences in superovulation traits among individuals with different genotypes
[0063]
[0064] Note: In the same row, different groups of data with different letters (a, b, c) under their headings indicate significant differences (P<0.05).
[0065] Average number of usable embryos per head = Total number of usable embryos obtained from multiple superovulation treatments / Number of superovulation treatments;
[0066] Total number of embryos per head = Total number of embryos obtained from multiple superovulation treatments / Number of superovulation treatments.
[0067] The analysis results show that individuals corresponding to different genotypes at this locus exhibit significant differences in superovulation traits, with the CC genotype showing superior superovulation compared to the CT and TT genotypes. Therefore, this invention provides an important theoretical basis for using this locus as a molecular marker for auxiliary selection of bovine reproductive and production performance and for its application in genetic improvement, and it has promising application prospects.
Claims
1. The use of primers for detecting molecular markers associated with bovine superovulation traits in the preparation of formulations for detecting bovine superovulation traits, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO: 1, which has a ct base mutation at position 455, resulting in differences in superovulation traits.
2. The use according to claim 1, characterized in that, The primer sequences are: The forward primer is shown in SEQ ID NO: 2; The reverse primer is shown in SEQ ID NO:
3.
3. The application of the molecular marker as described in claim 1 in the selection-assisted selection of bovine superovulation traits, characterized in that, Includes the following steps: Genomic DNA was extracted from bovine blood using the forward and reverse primers described in claim 2 and amplified by PCR. A single nucleotide polymorphism (SNP) was generated at position 455 of the DNA sequence of the PCR product fragment due to a ct base mutation. The specific genotype could be identified by sequencing. The association analysis between the different genotypes shown in the test results and the superovulation trait in cattle showed that the superovulation effect of CC-type individuals was better than that of CT-type or TT-type individuals.