A method and kit for simultaneous detection of four genes

By combining multiplex PCR amplification and single-base extension technology with nucleic acid mass spectrometry detection, the problems of cumbersome, time-consuming, and costly HLA allele typing in existing technologies have been solved, achieving rapid, accurate, low-cost, and high-throughput HLA genotyping detection.

CN122128410APending Publication Date: 2026-06-02SHANGHAI ENYUAN BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI ENYUAN BIOTECHNOLOGY CO LTD
Filing Date
2026-04-13
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing HLA allele typing techniques are cumbersome, time-consuming, and costly, making it difficult to meet the needs for rapid and convenient clinical procedures. In particular, the cost increases significantly and throughput is low when screening multiple targets.

Method used

Multiplex PCR amplification combined with single-base extension technology was employed to design specific primer pairs to amplify the HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801 genes. Nucleotide differences were distinguished by single-base extension reaction, and nucleic acid mass spectrometry was combined to achieve simultaneous detection of the four genes.

Benefits of technology

It enables rapid, accurate, low-cost, and high-throughput HLA genotyping, significantly improving testing efficiency, reducing costs, and ensuring the accuracy and reliability of test results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128410A_ABST
    Figure CN122128410A_ABST
Patent Text Reader

Abstract

This application relates to the fields of biomedicine and molecular diagnostics, specifically disclosing a method and kit for simultaneously detecting four genes. The method includes the following steps: extracting genomic DNA from the sample to be tested; using the extracted genomic DNA as a template, performing multiplex PCR amplification using a specific amplification primer set to obtain amplification products; digesting the amplification products, using the digested products as template, performing a single-base extension reaction using a specific single-base extension primer set to obtain extension products; desalting and purifying the extension products, and then detecting them using a nucleic acid mass spectrometer; analyzing and determining the genotyping results of the four genes based on the nucleic acid mass spectrometry detection results. This application achieves rapid detection of four genes at low cost and with simple operation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of biomedicine and molecular diagnostics, and in particular to a method and kit for the simultaneous detection of four genes. Background Technology

[0002] Mental illness has become a prevalent health problem worldwide. Taking epilepsy as an example, it is estimated that there are about 50 million people with epilepsy worldwide, while the prevalence of active epilepsy in my country is 4.6‰.

[0003] Currently, traditional antiepileptic drugs such as carbamazepine, oxcarbazepine, phenytoin, lamotrigine, and phenobarbital remain first-line treatments for epilepsy. These drugs are highly effective in controlling tonic-clonic seizures and partial seizures. However, these drugs may also cause adverse skin reactions.

[0004] Recent pharmacogenomics studies have confirmed that serious adverse reactions caused by certain antiepileptic drugs are closely related to specific human leukocyte antigen (HLA) alleles carried by patients. HLA genes are located on the short arm of human chromosome 6, and their products play a crucial role in immune responses. Studies have shown that the HLA-B*1502 allele is highly associated with SJS / TEN induced by carbamazepine, oxcarbazepine, lamotrigine, and phenytoin; the HLA-A*3101 allele is associated with hypersensitivity reactions such as DRESS and SJS / TEN induced by carbamazepine; the HLA-B*5801 allele is associated with hypersensitivity reactions to drugs such as lamotrigine; and the HLA-B*5101 allele is associated with drug responses to phenobarbital.

[0005] Therefore, rapid and accurate typing of the four key alleles (HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801) in high-risk individuals before initiating antiepileptic drug treatment is of paramount clinical significance for comprehensively assessing medication risks and ensuring patient safety.

[0006] Currently, the main technologies available for HLA allele typing include polymerase chain reaction direct sequencing (PCR-SBT) and the TaqMan probe method. PCR-SBT offers advantages such as high accuracy and specificity. However, it is cumbersome, time-consuming, and costly, making it difficult to meet the urgent clinical need for rapid and convenient methods. While the TaqMan probe method boasts high specificity, its experimental costs increase significantly when multiple allele loci need to be detected simultaneously, and its throughput is low, making it unsuitable for multi-target combined screening.

[0007] Therefore, developing a detection method that can simultaneously detect four key genes—HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801—and has the advantages of being simple to operate, fast to detect, low in cost, and high in throughput has become an urgent need in this field. Summary of the Invention

[0008] To rapidly detect four key genes—HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801—at low cost and with simple operation, this application provides a method and kit for simultaneously detecting these four genes.

[0009] In this application, the design of specific primers for the four alleles HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801 follows these principles: The HLA gene is the most polymorphic region in the human body, with alleles often differing by only a single nucleotide. To avoid cross-amplification between primers and non-target alleles, the 3' end of the amplification primers is designed on the unique sequence of the target allele, ensuring that only the target locus can be effectively amplified. Simultaneously, single-base extension primers further distinguish specific single nucleotide sites in the amplification product, forming a dual-specific recognition mechanism of amplification and extension, thereby ensuring that the detection results accurately reflect the genetic information of the target genotype.

[0010] Firstly, this application provides a method for simultaneously detecting four genes, employing the following technical solution: A method for simultaneously detecting four genes includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, perform multiplex PCR amplification using a specific amplification primer set to obtain amplification products; the specific amplification primer set includes primer pairs for amplifying the HLA-A*3101 gene, primer pairs for amplifying the HLA-B*1502 gene, primer pairs for amplifying the HLA-B*5101 gene, and primer pairs for amplifying the HLA-B*5801 gene; S3. Digest the amplification product from step S2 to remove excess primers and dNTPs; S4. Using the product digested in step S3 as a template, perform a single-base extension reaction using a specific single-base extension primer set to obtain the extension product; the specific single-base extension primer set includes extension primers for the HLA-A*3101 gene, extension primers for the HLA-B*1502 gene, extension primers for the HLA-B*5101 gene, and extension primers for the HLA-B*5801 gene. S5. After desalting and purifying the extended product from step S4, it is detected by nucleic acid mass spectrometry. S6. Based on the nucleic acid mass spectrometry detection results, analyze and determine the genotyping results of the HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes.

[0011] By adopting the above technical solution, combining multiplex PCR amplification, single base extension and nucleic acid mass spectrometry detection technology, the simultaneous detection of four key HLA genes in one reaction system is achieved, avoiding the cumbersome process of separate detection or parallel operation of multiple reaction systems required by traditional methods, which significantly improves detection efficiency and reduces costs.

[0012] Optionally, in step S2, the nucleotide sequences of the specific amplification primer set are shown in SEQ ID NO.01-SEQ ID NO.22.

[0013] Optionally, in step S4, the nucleotide sequences of the specific single-base extension primer set are shown in SEQ ID NO.23-SEQ ID NO.33.

[0014] Specifically, the primer pairs used to amplify the HLA-A*3101 gene include three forward primers (SEQ ID No. 01, SEQ ID No. 03, SEQ ID No. 05) and three reverse primers (SEQ ID No. 02, SEQ ID No. 04, SEQ ID No. 06). The sequence of the forward primer (SEQ ID No. 01) is: CCTTTGCACTTGGGGATTG; the sequence of the forward primer (SEQ ID No. 03) is: TTCGAGGAAAGGAAGGGAGA; the sequence of the reverse primer (SEQ ID No. 05) is: GATAGGAGCAGGAGAGGCCTG; the sequence of the reverse primer (SEQ ID No. 02) is: TTTCAGCTGGGTCTTAAAAGGA; the sequence of the reverse primer (SEQ ID No. 04) is: GCCGTCCACTCGGTCAAT.

[0015] The primer pair used to amplify the HLA-B*1502 gene includes two forward primers (SEQ ID No. 07 and SEQ ID No. 09) and two reverse primers (SEQ ID No. 08 and SEQ ID No. 10). The sequence of the forward primer (SEQ ID No. 07) is TTGGAAAGGTGCCTGTCAAG, the sequence of the reverse primer (SEQ ID No. 09) is TCCCTGACTCATGAATGCT, the sequence of the reverse primer (SEQ ID No. 08) is TCTAGTGCATTTTTCAAAATATCTCA, and the sequence of the reverse primer (SEQ ID No. 10) is GCCCCAGGTAGAAGTGTTCC.

[0016] The primer pair used to amplify the HLA-B*5101 gene includes two forward primers (SEQ ID No. 11 and SEQ ID No. 13) and two reverse primers (SEQ ID No. 12 and SEQ ID No. 14). The sequence of the forward primer (SEQ ID No. 11) is: TTTGGATTTTAGAATTGAGCACAT, the sequence of the reverse primer (SEQ ID No. 13) is: TCCCGGTTTTTGTTTCTCTG, the sequence of the reverse primer (SEQ ID No. 12) is: CCCTGCTGAAACCACGTAAG, and the sequence of the reverse primer (SEQ ID No. 14) is: CTTGAAGGACATCTATGCTGGA.

[0017] The primer pairs used to amplify the HLA-B*5801 gene include four forward primers (SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21) and four reverse primers (SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22). The sequence of the forward primer SEQ ID No. 15 is: TGGGACCACCACAGCTTC; the sequence of SEQ ID No. 17 is: ATGCATGGGTTAAGGGCTTT; the sequence of SEQ ID No. 19 is: TTTGCCAGTGGTTATATCTGTGG; and the sequence of SEQ ID No. 21 is: CCAGGGAAACATATCAAGACCA. The sequence of the reverse primers SEQ ID No. 16 is: AGCCTGCAGTAGAGGTGACG; the sequence of SEQ ID No. 18 is: AAGCCAGCTAGTTCCAGGTCAGA; and the sequence of SEQ ID No. 20 is: TTGGCATCTGCTATGCTCAC. The sequence for No. 22 is: TGCCTGTGATGTGTGGAATG.

[0018] The single-base extension primers for the HLA-A*3101 gene include SEQ ID No. 23, SEQ ID No. 24, and SEQ ID No. 25. The sequence of primer SEQ ID No. 23 is: GACCGTCCTGGAGAGGGA, the sequence of primer SEQ ID No. 24 is: AGAGAGGGAGAAAAGGGGAGAG, and the sequence of primer SEQ ID No. 25 is: CTCGGAATGTGAAGGCCCA.

[0019] The single-base extension primers for the HLA-B*1502 gene include SEQ ID No. 26 and SEQ ID No. 27. The sequence of primer SEQ ID No. 26 is: CCTCAAAATTTATGGATTTACTTCATTG, and the sequence of primer SEQ ID No. 27 is: GCTGCGTTAGCCCCTGTG.

[0020] The single-base extension primers for the HLA-B*5101 gene include SEQ ID No. 28 and SEQ ID No. 29. The sequence of primer SEQ ID No. 28 is: AACTGCCATCTCAAAACTTCTGTG, and the sequence of primer SEQ ID No. 29 is: CAAAAGAAAGTAGAATAACATCTTTAAAGT.

[0021] The single-base extension primers for the HLA-B*5801 gene include SEQ ID No. 30, SEQ ID No. 31, SEQ ID No. 32, and SEQ ID No. 33. The sequence of primer SEQ ID No. 30 is: GGGCAGGCTCTGAGACCACTACA, the sequence of SEQ ID No. 31 is: CTTTTTGCTCTGGGGTCAGACTGC, the sequence of SEQ ID No. 32 is: TAAATGCCTTATGTGGTACATTCTTC, and the sequence of SEQ ID No. 33 is: AAATCCAGGTTTGCTTGTGG.

[0022] By adopting the above technical solution, 11 pairs of specific amplification primers, as shown in SEQ ID NO.01-SEQ ID NO.22, were designed for the specific sequences of HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes. These primers can simultaneously and efficiently amplify the target gene fragments in a multiplex PCR system without producing non-specific amplification or primer dimers, thus ensuring the accuracy and reliability of subsequent detection. Meanwhile, 11 specific single-base extension primers, as shown in SEQ ID NO.23-SEQ ID NO.33, were designed. These extension primers can bind precisely upstream of the target site of the amplification product and distinguish individual nucleotide differences through single-base extension reaction, thereby accurately determining the HLA gene typing results and providing a highly specific recognition basis for nucleic acid mass spectrometry detection.

[0023] Optionally, in step S2, the reaction program for multiplex PCR amplification includes: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, and after 45 cycles of the above steps, a final extension at 72°C for 5 min.

[0024] Optionally, in step S3, the digestion process uses exonuclease I and shrimp alkaline phosphatase.

[0025] Optionally, in step S4, the extension enzyme used for the single-base extension reaction is Therminator DNA polymerase.

[0026] By adopting the above technical solution, the product is digested with exonuclease I and shrimp alkaline phosphatase after amplification, which effectively removes residual amplification primers and dNTPs in the system and avoids interference from these substances in the subsequent single-base extension reaction. Therminator DNA polymerase is used for single-base extension. This enzyme has good strand substitution activity and the ability to incorporate modified nucleotides, ensuring the high efficiency and accuracy of the extension reaction.

[0027] Secondly, this application provides a kit for simultaneously detecting four genes, employing the following technical solution: A kit for simultaneously detecting four genes includes a specific amplification primer set and a specific single-base extension primer set. The specific amplification primer set includes specific primer pairs for amplifying the HLA-A*3101 gene, specific primer pairs for amplifying the HLA-B*1502 gene, specific primer pairs for amplifying the HLA-B*5101 gene, and specific primer pairs for amplifying the HLA-B*5801 gene. The specific single-base extension primer set includes specific extension primers for the HLA-A*3101 gene, specific extension primers for the HLA-B*1502 gene, specific extension primers for the HLA-B*5101 gene, and specific extension primers for the HLA-B*5801 gene.

[0028] By adopting the above technical solution, the kit integrates the core primer components required for detection, which users can use directly for detection without having to design and screen primers themselves. This greatly simplifies the experimental preparation process and ensures the stability and reproducibility of the detection results.

[0029] Optionally, the nucleotide sequences of the specific amplification primer set are shown in SEQ ID NO.01-22; the nucleotide sequences of the specific single-base extension primer set are shown in SEQ ID NO.23-33.

[0030] Optionally, it also includes a PCR amplification system, which comprises PCR buffer, PCR enzyme, MgCl2 and dNTPs; A digestive system comprising exonuclease I, shrimp alkaline phosphatase, and a buffer solution; A single-base extension system, comprising an extension buffer, an extension stop solution, and an extension enzyme.

[0031] Optionally, in the specific amplification primer set, the primer pairs for amplifying the HLA-A*3101 gene are the three primer pairs shown in SEQ ID NO.01-SEQ ID NO.02, SEQ ID NO.03-SEQ ID NO.04, and SEQ ID NO.05-SEQ ID NO.06; the primer pairs for amplifying the HLA-B*1502 gene are the two primer pairs shown in SEQ ID NO.07-SEQ ID NO.08 and SEQ ID NO.09-SEQ ID NO.10; the primer pairs for amplifying the HLA-B*5101 gene are the two primer pairs shown in SEQ ID NO.11-SEQ ID NO.12 and SEQ ID NO.13-SEQ ID NO.14; and the primer pairs for amplifying the HLA-B*5801 gene are SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20, and SEQ ID NO.16. The four pairs of primers shown in ID NO.21-SEQ ID NO.22; The specific single-base extension primer set includes the primers shown in SEQ ID NO. 23, SEQ ID NO. 24, and SEQ ID NO. 25 for the HLA-A*3101 gene; the primers shown in SEQ ID NO. 26 and SEQ ID NO. 27 for the HLA-B*1502 gene; the primers shown in SEQ ID NO. 28 and SEQ ID NO. 29 for the HLA-B*5101 gene; and the primers shown in SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, and SEQ ID NO. 33 for the HLA-B*5801 gene.

[0032] In summary, this application includes at least one of the following beneficial technical effects: 1. By combining multiplex PCR amplification, single-base extension and nucleic acid mass spectrometry detection technology, the simultaneous detection of four key HLA genes in one reaction system is achieved, avoiding the cumbersome process of separate detection or parallel operation of multiple reaction systems required by traditional methods, which significantly improves detection efficiency and reduces costs. 2. Eleven pairs of specific amplification primers, as shown in SEQ ID NO.01-SEQ ID NO.22, were designed to target the specific sequences of the HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801 genes. These primers can simultaneously and efficiently amplify the target gene fragments in a multiplex PCR system without generating non-specific amplification or primer dimers, thus ensuring the accuracy and reliability of subsequent detection. 3. Eleven specific single-base extension primers, as shown in SEQ ID NO.23-SEQ ID NO.33, were designed. These extension primers can bind precisely upstream of the target site of the amplification product and distinguish individual nucleotide differences through single-base extension reaction, thereby accurately determining the HLA gene typing results and providing a highly specific recognition basis for nucleic acid mass spectrometry detection. Attached Figure Description

[0033] Figure 1 This is a nucleic acid spectrum analysis diagram of the H04 site.

[0034] Figure 2 This is a nucleic acid spectrum analysis diagram of the H05 site.

[0035] Figure 3 This is a nucleic acid spectrum analysis diagram of the H06 site.

[0036] Figure 4 This is a nucleic acid spectrum analysis diagram of the H07 site.

[0037] Figure 5 This is a nucleic acid spectrum analysis diagram of the H08 site.

[0038] Figure 6 This is a nucleic acid spectrum analysis diagram of the H09 site.

[0039] Figure 7 This is a nucleic acid spectrum analysis diagram of the H10 site.

[0040] Figure 8 This is a nucleic acid spectrum analysis diagram of the H11 site.

[0041] Figure 9 This is a nucleic acid spectrum analysis diagram of the H12 site.

[0042] Figure 10 This is a nucleic acid spectrum analysis diagram of the H13 site.

[0043] Figure 11 This is a nucleic acid spectrum analysis diagram of the H14 site. Detailed Implementation

[0044] Example

[0045] Example 1 This embodiment discloses a kit and detection method for simultaneously detecting HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes.

[0046] This kit contains the following components: Amplification primer set: Contains 11 pairs of specific amplification primers for amplifying the HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes, and their nucleotide sequences are shown in Table 1 below.

[0047] Table 1

[0048] Single-base extension primer set: contains 11 specific extension primers for the HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes, and their nucleotide sequences are shown in Table 2 below.

[0049] Table 2

[0050] PCR amplification system: contains PCR buffer, PCR enzyme, MgCl2 and dNTPs.

[0051] Digestion system: contains exonuclease I, shrimp alkaline phosphatase (SAP), and its buffer solution.

[0052] Single-base extension system: includes extension buffer, extension stop solution and extension enzyme (Therminator DNA polymerase).

[0053] Tests have shown that this kit can be stably stored at -20℃ for at least 6 months, and its detection performance remains stable even after no more than 5 freeze-thaw cycles. It can stably detect both standards and quality control samples.

[0054] A method for simultaneously detecting HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes includes the following steps: P1. Sample preparation: The sample to be tested is a biological sample containing genomic DNA, selected from whole blood, dried blood spots or exfoliated cells from oral mucosa. Genomic DNA is extracted from the sample as a template, and the DNA concentration is identified using an ultraviolet spectrophotometer or a fluorescence spectrophotometer. The DNA is diluted with ddH2O to 2-50 ng / μL.

[0055] P2. Preparation of amplification primer working solution: Prepare amplification primer working solution according to Table 3 below.

[0056] Table 3

[0057] P3. Multiplex PCR Amplification: Target fragments containing the HLA-A*3101, HLA-B*1502, HLA-B*5101, and HLA-B*5801 genes were amplified using specific PCR technology. The amplification reaction system was prepared according to Table 4 below, and amplification was performed according to the reaction procedure in Table 5 below.

[0058] Table 4

[0059] Table 5

[0060] P4. Digestion Reaction: Multiplex PCR products are digested using shrimp alkaline phosphatase and exonuclease I to remove excess dNTPs and amplification primers. Prepare the digestion reaction system according to Table 6 below, and then proceed with the reaction according to the procedure in Table 7 below.

[0061] Table 6

[0062] Table 7

[0063] P5. Single base extension reaction: Prepare extension primer working solution according to Table 8 below, prepare single base extension reaction system according to Table 9 below, and carry out reaction according to the reaction procedure in Table 10 below after the reaction system is prepared.

[0064] Table 8

[0065] Table 9

[0066] Table 10

[0067] P6. Product desalting, purification, and nucleic acid mass spectrometry detection: Add 16 μL of nuclease-free water to each sample reaction well. Seal with sealing film, vortex and briefly centrifuge, then detect using a nucleic acid mass spectrometer.

[0068] P7. Result Processing: The mass analysis software built into the nucleic acid mass spectrometer is used. The software automatically determines the type of extended base based on the mass difference between the molecular weight of the product and the extension primer. If two extension product peaks appear, it indicates a heterozygous mutation or gene mutation, which can be determined based on the peak height ratio or peak area ratio. The rules for determining the genotyping results of the sample are shown in Table 11 below.

[0069] Table 11

[0070] Comparative Example Comparative Example 1 This comparative example compares the results of using the kit and detection method described in Example 1 of this application on epilepsy patient samples with the PCR-SBT method, which is considered the gold standard.

[0071] Experimental samples: 52 epilepsy patients (numbered S1-S52) were selected, and the sample type was genomic DNA extracted from whole blood.

[0072] Detection methods: The HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genotyping of the samples were performed using the detection kit and method provided in Example 1, as well as the commercially available PCR-SBT kit.

[0073] Test results: The genotyping test results are shown in Table 12 below.

[0074] Table 12

[0075] Results analysis: As can be seen from the results in Table 12, the genotyping results obtained by using the kit and detection method in Example 1 are 100% consistent with the genotyping results obtained by the gold standard PCR-SBT kit.

[0076] Taking sample S2 as an example, the test results from the kit in Example 1 showed that A31:01 was positive and B51:01 was positive. The PCR-SBT results confirmed that the sample was A*02:07 / A*31:01 and B*51:01 / B*67:01, which were completely consistent. The test results for sample S3 showed that B*15:02 was positive, and the PCR-SBT results confirmed that it was B*15:02 / B*44:02, which were also completely consistent.

[0077] The above verification results show that the detection kit and detection method provided in Example 1 of this application have extremely high accuracy and reliability, and can accurately perform genotyping detection of HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes.

[0078] As can be seen from Example 1 and Comparative Example 1, and in conjunction with Tables 1-12, the amplification primers designed in Example 1 of this application target the specific sequences of each gene, specifically amplifying the corresponding genomic DNA; the single-base extension primers can effectively distinguish single nucleotide differences, avoiding interference from non-specific products. Using a nucleic acid mass spectrometry platform, a single chip (384-well plate) can simultaneously detect 384 samples, and a single run can simultaneously detect four gene loci, increasing throughput by 4 times compared to the 96-well plate format typically used in PCR-SBT; significantly improving detection throughput. Compared to the TaqMan method, which requires separate reactions for each locus, the multiplex detection capability of this application significantly improves overall detection efficiency. The experimental process is highly automated, with short manual operation time and low difficulty. The amplification and extension primers used are all common synthetic primers, requiring no additional modification such as fluorescent groups, significantly reducing the detection cost per sample. Comparative verification with the PCR-SBT method shows that the detection results of this invention achieve 100% consistency with the gold standard, demonstrating extremely high accuracy and reliability.

[0079] In summary, the method and kit for simultaneous detection of HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes provided in this application can rapidly, accurately, cost-effectively and with high throughput complete the simultaneous genotyping of four key HLA genes, providing reliable technical support for precise medication guidance of antiepileptic drugs.

[0080] The above are all preferred embodiments of this application, and are not intended to limit the scope of protection of this application. Therefore, all equivalent changes made in accordance with the structure, shape and principle of this application should be covered within the scope of protection of this application.

Claims

1. A method for simultaneously detecting four genes, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, perform multiplex PCR amplification using a specific amplification primer set to obtain amplification products; the specific amplification primer set includes primer pairs for amplifying the HLA-A*3101 gene, primer pairs for amplifying the HLA-B*1502 gene, primer pairs for amplifying the HLA-B*5101 gene, and primer pairs for amplifying the HLA-B*5801 gene; S3. Digest the amplification product from step S2 to remove excess primers and dNTPs; S4. Using the product digested in step S3 as a template, a single-base extension reaction is carried out using a specific single-base extension primer set to obtain the extension product. The specific single-base extension primer set includes extension primers for the HLA-A*3101 gene, extension primers for the HLA-B*1502 gene, extension primers for the HLA-B*5101 gene, and extension primers for the HLA-B*5801 gene. S5. After desalting and purifying the extended product from step S4, it is detected by nucleic acid mass spectrometry. S6. Based on the nucleic acid mass spectrometry detection results, analyze and determine the genotyping results of the HLA-A*3101, HLA-B*1502, HLA-B*5101 and HLA-B*5801 genes.

2. The method for simultaneously detecting four genes according to claim 1, characterized in that: In step S2, the nucleotide sequences of the specific amplification primer set are shown in SEQ ID NO.01-SEQ ID NO.

22.

3. The method for simultaneously detecting four genes according to claim 1, characterized in that: In step S4, the nucleotide sequences of the specific single-base extension primer set are shown in SEQ ID NO.23-SEQ ID NO.

33.

4. The method for simultaneously detecting four genes according to claim 1, characterized in that: In step S2, the reaction program for multiplex PCR amplification includes: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, and after 45 cycles of the above steps, a final extension at 72°C for 5 min.

5. The method for simultaneously detecting four genes according to claim 1, characterized in that: In step S3, the digestion process uses exonuclease I and shrimp alkaline phosphatase.

6. The method for simultaneously detecting four genes according to claim 1, characterized in that: In step S4, the extension enzyme used in the single-base extension reaction is Therminator DNA polymerase.

7. A kit for simultaneously detecting four genes, characterized in that: It includes a specific amplification primer set and a specific single-base extension primer set. The specific amplification primer set includes specific primer pairs for amplifying the HLA-A*3101 gene, specific primer pairs for amplifying the HLA-B*1502 gene, specific primer pairs for amplifying the HLA-B*5101 gene, and specific primer pairs for amplifying the HLA-B*5801 gene. The specific single-base extension primer set includes specific extension primers for the HLA-A*3101 gene, specific extension primers for the HLA-B*1502 gene, specific extension primers for the HLA-B*5101 gene, and specific extension primers for the HLA-B*5801 gene.

8. The kit for simultaneously detecting four genes according to claim 7, characterized in that: The nucleotide sequences of the specific amplification primer set are shown in SEQ ID NO.01-22; the nucleotide sequences of the specific single-base extension primer set are shown in SEQ ID NO.23-33.

9. A kit for simultaneously detecting four genes according to claim 7, characterized in that, Also includes: A PCR amplification system, wherein the PCR amplification system comprises PCR buffer, PCR enzyme, MgCl2 and dNTPs; A digestive system comprising exonuclease I, shrimp alkaline phosphatase, and a buffer solution; A single-base extension system, comprising an extension buffer, an extension stop solution, and an extension enzyme.

10. A kit for simultaneously detecting four genes according to claim 7, characterized in that: The specific amplification primer set includes the three primer pairs used to amplify the HLA-A*3101 gene, as shown in SEQ ID NO.01-SEQ ID NO.02, SEQ ID NO.03-SEQ ID NO.04, and SEQ ID NO.05-SEQ ID NO.

06. The primer pairs used to amplify the HLA-B*1502 gene are the two primer pairs shown in SEQ ID NO.07-SEQ ID NO.08 and SEQ ID NO.09-SEQ ID NO.10; The primer pairs used to amplify the HLA-B*5101 gene are the two primer pairs shown in SEQ ID NO.11-SEQ ID NO.12 and SEQ ID NO.13-SEQ ID NO.14; The primer pairs used for amplifying the HLA-B*5801 gene are the four primer pairs shown in SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20 and SEQ ID NO.21-SEQ ID NO.22; In the specific single-base extension primer set, the extension primers for the HLA-A*3101 gene are the primers shown in SEQ ID NO.23, SEQ ID NO.24 and SEQ ID NO.25; The extension primers for the HLA-B*1502 gene are the primers shown in SEQ ID NO. 26 and SEQ ID NO. 27; The extension primers for the HLA-B*5101 gene are the primers shown in SEQ ID NO.28 and SEQ ID NO.29; The extension primers for the HLA-B*5801 gene are those shown in SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32 and SEQ ID NO.33.