Primer group for simultaneously detecting eight pet dermatophytes and application thereof

By designing specific primer sets using multiplex PCR detection technology and the SYBR Green I dye-based quantitative qPCR method, the problems of low efficiency and high cost in pet skin fungal detection have been solved, achieving rapid, accurate, and low-cost multiplex detection, which is suitable for commercial promotion.

CN121610595APending Publication Date: 2026-03-06NANJING ZHUOYI BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511989019.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-03-06

Smart Images

  • Figure CN121610595A_ABST
    Figure CN121610595A_ABST
Patent Text Reader

Abstract

The invention discloses a primer group for simultaneously detecting eight pet dermatophytes and application of the primer group. The primer group comprises a forward PCR (Polymerase Chain Reaction) amplification primer, a reverse PCR amplification primer and a control primer sequence and a template of eight pet skin fungi, wherein the eight pet skin fungi comprise microsporum canine, microsporum gypsiformis, malassezia, megasporum, trichophyton mentagrophytes, trichophyton fibraureae, histoplasma capsulatum and globularia; the sequences of the primers are respectively shown as SEQ ID NO.1-SEQ ID NO.19. The primers can detect eight pet dermatomycosis, have very high sensitivity and specificity, have certain development, utilization and popularization values, and can provide technical support for clinical diagnosis of pet dermatomycosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a primer set for the simultaneous detection of eight pet skin fungi and its application. Background Technology

[0002] Fungal dermatitis in pets is a common health problem in clinical veterinary medicine, caused by pathogens such as *Microsporum canis*, *Microsporum gypseum*, *Malassezia*, *Macrosporum*, *Trichophyton mentagrophytes*, *Trichophyton tonsurans*, *Histoplasma capsulatum*, and *Coccidioides*. These infections not only cause skin inflammation, hair loss, itching, and secondary bacterial infections in pets, seriously affecting animal welfare, but some pathogens (such as *Microsporum canis* and *Trichophyton mentagrophytes*) can also be transmitted through zoonotic routes, threatening public health. Especially in immunocompromised individuals, *Histoplasma capsulatum* and *Coccidioides* can cause disseminated systemic infection, endangering life. Therefore, rapid and accurate pathogen identification is crucial for clinical diagnosis and infection control.

[0003] Currently, the diagnosis of fungal infections in pets mainly relies on the following methods: direct microscopy and fungal culture, which involves observing hyphae / spores in dander or hair samples under a microscope, or isolating pathogens based on culture media. These methods are simple to perform, but have low sensitivity (false negative rate >30%), and fungal culture takes 2-4 weeks, making them unsuitable for rapid clinical diagnosis. Biochemical and immunological tests, including carbohydrate assimilation tests or antigen-antibody detection, are also used, but some fungi have overlapping biochemical characteristics (e.g., Trichophyton), resulting in insufficient specificity. Immunological methods carry the risk of cross-reactivity and cannot distinguish between active infection and previous exposure. Singleton PCR technology, while improving sensitivity, can only detect a single pathogen per reaction, requiring multiple tests for mixed infections, leading to high costs and low efficiency.

[0004] Compared with traditional methods, detection technology based on multiplex real-time quantitative PCR has significant advantages: High throughput and specificity: By designing specific primer sets, eight target fungi can be detected simultaneously in a single tube reaction, avoiding cross-amplification and achieving efficient identification of mixed infections. Rapid and accurate: Detection is completed within 2-3 hours, with a sensitivity of 1-10 copies / reaction, significantly shortening the diagnostic cycle and reducing the risk of missed detection. Quantitative analysis: Pathogen load is quantified through Ct values, providing a basis for assessing infection severity and monitoring treatment efficacy. Automated compatibility: Adaptable to conventional qPCR platforms, requiring no complex post-processing, suitable for clinical application.

[0005] In summary, existing methods for detecting dermal fungi need improvement. These methods should possess high sensitivity, strong specificity, and speed, while also being cost-effective and easy to operate. This invention employs a dye-based quantitative qPCR method for detecting pet dermal fungi, capable of simultaneously detecting eight different species. This method is simple to operate, low in cost, and highly efficient, effectively overcoming the limitations of traditional techniques and providing a highly efficient tool for the accurate diagnosis and prevention of fungal infections in pets. Summary of the Invention

[0006] The purpose of this invention is to solve the problems of difficulty in comprehensive screening, low detection efficiency and high detection cost in existing pet skin fungal detection technologies, and to provide a new primer set and method for pet skin fungal detection, so as to improve the problems of low detection efficiency and high detection cost in related detection technologies.

[0007] To achieve the above objectives, this invention provides a multiplex PCR primer set for the simultaneous detection of genes from eight pet dermatophytes. The primer set includes the primers shown in Table 2 below. The eight pet dermatophytes include *Microsporosis canins*, *Microsporon gypseum*, *Malassezia*, *Adiaspiromycosis*, *Trichophyton mentagrophytes*, *Trichophyton tonsurans*, *Histoplasma capsulatum*, and *Coccidioides immitis*.

[0008] This invention provides a primer set for multiplex PCR detection of dermatophytes. The primer set includes primers for detecting conserved regions of the following gene sequences: Microsporum canis ITS-1 rRNA gene, Microsporum gypseum ITS-1 rRNA gene, Malassezia 26S rDNA gene, Megasporum megaterium 5.8S rRNA gene, Trichophyton mentagrophytes ITS-1 rRNA gene, Trichophyton truncatum 18S rRNA gene, Histoplasma capsulatum mtSSU gene, and Coccidioides WD protein gene.

[0009] The primer set includes primer sequences as shown in SEQ ID NO. 1~19.

[0010] The use of the primer set described above for multiplex PCR detection of dermatophytes in the preparation of reagents for detecting dermatophytes in pets.

[0011] A kit for the simultaneous detection of eight pet dermatophytes, the kit comprising primer sets as shown in SEQ ID NO. 1~19.

[0012] It also includes nucleic acid extraction reagents for the sample to be tested, 2×Universal SYBR qPCR Mix, control primers and corresponding templates.

[0013] The control primers are shown in SEQ.ID.NO.17-18:

[0014] Control primer F: GAAGGTGAAGAAGAAATGATCGAATTAGTT (SEQ.ID.NO.17).

[0015] Control primer R: GAAGGTGAAGAAGAAATGATCGAATTAGTT (SEQ.ID.NO.18).

[0016] The template sequence is shown in SEQ.ID.NO.19:

[0017] GATACCGCCGGCGCGACGCCGTTTTCCATCAAGCTGCAGAACTGCCCCGAATCGCTGGGCAGAAGGTGAAGAAGAAATGATCGAATTAGTTGAATTAGAAATTCGTGTCTTCTTTCAGAATACGGATTTGACGGAGATAACGCTCCAATTATCCGTGGATCAGCT TCAGAAGCTTTAGCTGGAAATGAAAAATATGAAGCTAAAATTATGGAATTAATGGATGCTGATGGCGTGAAGCTGTACTTCGAGCCCGGTCCGACCACCGACTACAGCACCAGGGACCTGACCGCCTACAAGCTGGCCTACACCGCCAACAGCACGACCAATTGT.

[0018] In the reaction system, there is a 2 μL control primer mixture (upstream and downstream primers mixed, final concentration 0.5 μmol / L, the final concentration refers to the final concentration of the primers in the reaction system).

[0019] This invention provides a method for detecting skin fungi in pets, the method comprising the following steps:

[0020] (1) Total DNA was extracted from the sample to be tested using a centrifuge column method nucleic acid extraction kit;

[0021] (2) Using the total DNA as a template and the primer set or kit of the present invention, perform multiplex PCR reaction. The reaction system includes 10 μL of 2×Universal SYBR qPCR Mix, 2 μL of the above-mentioned 8-pet-skin-fungus primer mixed solution, and 8 μL of the DNA template of the sample to be detected; the 8 primers are mixed in equal volume (the initial concentration of each primer is 100 umol / L) to prepare the primer mixed solution.

[0022] (3) The reaction amplification conditions are pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing / extension (collecting fluorescence signals) at 60 °C for 30 s, and reacting for 40 cycles to obtain the amplification curve after multiplex PCR amplification; The 8 primers are first mixed in equal volume (the concentration of each primer is 100 umol / L), and 2 μL of the mixed primers is added to each reaction system.

[0023] If the Ct value of the control primer > 30, re-detection is required;

[0024] If the Ct value of the amplification curve of the sample to be detected, if the Ct value > 38 or NoCt, and the Ct value of the control primer < 30, the judgment result is negative, indicating that there is no above-mentioned skin fungus in the sample to be detected;

[0025] If the Ct value of the amplification curve of the sample to be detected is: 0 < Ct < 38, and the Ct value of the control primer < 30, the judgment result is positive, indicating that the sample to be detected contains one or more of the above skin fungi, and the specific fungal species in the sample is detected for the second time;

[0026] (4) Using the DNA of the sample to be detected with a positive result in the first detection as a template and the primers of the present invention, perform single qPCR reaction according to the above reaction system and reaction amplification conditions to obtain the amplification curve after qPCR amplification;

[0027] If the Ct value of the control primer > 30, re-detection is required;

[0028] If the Ct value of the amplification curve of the sample to be detected is: 0 < Ct < 35, and the Ct value of the control primer < 30, the judgment result is positive,

[0029] If the Ct value of the amplification curve of primer pair A1 / A2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Microsporum canis;

[0030] If the Ct value of the amplification curve of primer pair B1 / B2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Microsporum gypseum;

[0031] If the Ct value of the amplification curve of primer pair C1 / C2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Malassezia;

[0032] If the Ct value of the amplification curve of primer pair D1 / D2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Microsporum;

[0033] If the Ct value of the amplification curve of primer pair E1 / E2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Trichophyton mentagrophytes;

[0034] If the Ct value of the amplification curve of primer pair F1 / F2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Trichophyton tonsurans;

[0035] If the Ct value of the amplification curve of primer pair G1 / G2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Histoplasma capsulatum;

[0036] If the Ct value of the amplification curve of primer pair H1 / H2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the test sample contains Coccidioides;

[0037] This method uses a centrifugal column nucleic acid extraction kit to extract nucleic acids from skin swab samples, and the PCR inhibitors in the obtained DNA samples have been basically removed; the primer sets provided by this method have been carefully designed and tested many times, there will be no cross-amplification reaction between primer sets, and there is no dimer formation between primers. Positive and negative controls are added during detection to ensure the credibility of the detection results.

[0038] The present invention has established a detection method for simultaneously detecting 8 fungi on pet skin, which can solve the deficiencies of other detection methods. Compared with the prior art, the present invention has the following advantages and effects:

[0039] (1) Multiple detections cover comprehensively

[0040] The detection method established by the present invention can simultaneously screen five genera of fungi in one PCR reaction: Microsporum, Malassezia, Trichophyton, Histoplasma, Coccidioides, specifically including 8 commonly infected fungi on pet skin: Microsporum canis, Microsporum gypseum, Malassezia, Microsporum, Trichophyton mentagrophytes, Trichophyton tonsurans, Histoplasma capsulatum, Coccidioides. It comprehensively covers pet skin fungal infections mainly manifested by hair loss, skin redness, scales or scabs, accompanied by different degrees of itching, and quickly obtains detection results, saving time, manpower and material costs.

[0041] (2) High detection efficiency

[0042] The specificity of the detection method established in this invention is mainly reflected in the specificity of the entire primer set. All primers have undergone BLAST comparison analysis, demonstrating high conservation and specificity. Compared with commonly used methods for examining fungal skin infections in pets, such as Wood's lamp examination, fungal culture, and microscopic examination, this method has a detection rate four times higher and can accurately distinguish the detected fungal species. Both the detection rate and accuracy are higher than traditional examination methods. Existing qPCR detection generally uses the TaqMan probe method, which has high accuracy and detection efficiency, but the high cost of probe and primer synthesis increases the detection cost. This method uses the SYBR Green I dye method, which has a much lower detection cost than the TaqMan probe method, while maintaining consistent accuracy, sensitivity, and high detection efficiency. It is also simple to operate and more conducive to commercialization.

[0043] (3) High sensitivity

[0044] The detection method established in this invention can simultaneously screen for nucleic acids of eight target fungi, and the detection sensitivity of each target fungus in each reaction system can reach 7 bacteria / mL.

[0045] (4) Lower cost

[0046] The multiplex PCR detection method established in this invention reduces labor and time costs in terms of operability. Single-sample detection requires 8 manual operations and 8 times the operation time. Furthermore, the increase in the number of detection types means an increase in primer sets, and the more primer sets in the multiplex PCR amplification system, the more difficult primer design becomes. To ensure the reliability of the detection results (false positives), primers need to be optimized multiple times, and the amount of each primer and component added to the PCR reaction system, as well as the reaction annealing temperature, need to be optimized to ensure the amplification efficiency of each primer set (close to 100%). Using the multiplex PCR method of this invention only requires 2 manual operations and 2 operation times. At the same time, this multiplex detection method saves reagent consumption by repeatedly testing the same sample, saving up to 70% of reagent costs.

[0047] (5) High accuracy

[0048] In order to prevent false negative and false positive results, the positive internal control primer and corresponding template added to the detection method of this invention can effectively indicate false negative test results; the template-free negative control is set in the system to effectively indicate false positive test results.

[0049] This invention provides a complete solution for the rapid detection of eight common skin fungi in pets, enabling rapid detection of skin fungal sources in pets, while promoting the transformation of the pet medical industry from a "treatment-oriented" to a "prevention-first" sustainable development model.

[0050] Beneficial Effects: This invention integrates efficient detection technologies to provide a rapid, accurate, and convenient solution for pet skin fungal infections: it overcomes the limitations of traditional culture methods (1-3 weeks), delivering results within 2-3 hours, allowing time for early treatment; it can simultaneously detect 8 common fungi (covering Microsporum, Trichophyton, Malassezia, etc.) with an accuracy rate exceeding 95%, avoiding cross-infection or missed detection; it uses non-invasive sample collection (such as hair, dander, or skin swabs), requiring no complex pretreatment, making it suitable for promotion by primary care veterinarians or pet hospitals; by clearly identifying fungal species (such as distinguishing between Microsporum canis and Microsporum gypseum), it guides precise medication, reducing the risk of antifungal drug abuse; it quickly identifies the source of infection (such as Malassezia and Coccidioides), aiding in environmental disinfection and contact protection, reducing zoonotic transmission; the cost per sample is reduced by approximately 30% compared to traditional PCR, and it is compatible with multiple detection platforms, adapting to different medical resource scenarios, significantly improving diagnostic efficiency and providing a powerful tool for epidemiological monitoring and public health control. Attached Figure Description

[0051] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0052] Figure 1 This invention presents the experimental results for detecting eight common intestinal fungi, where 1-4 are Microsporum canis, Microsporum gypseum, Malassezia, and Megasporum, respectively; 5 is a positive internal control; and 6 is a negative control.

[0053] Figure 2 This invention presents the experimental results for detecting eight common intestinal fungi, of which 1-4 are Trichophyton mentagrophytes, Trichophyton truncatum, Histoplasma capsulatum, and Coccidioides immitis; 5 is a positive internal control; and 6 is a negative control.

[0054] Figure 3 The results are the primer-specific detection results of this invention, where 1 is a sample containing fungi, 2-6 are Salmonella, Vibrio parahaemolyticus, Yersinia enterocolitica, Enterobacter escherichia coli, and Vibrio cholerae, respectively, 7 is a mixed sample of five unrelated pathogens, and 8 is a negative control;

[0055] Figure 4 These are the primer sensitivity test results of this invention, where 1-5 are mixed templates of 8 fungi at different concentrations (7×10⁻⁶). 4 bacteria / mL, 7×10 3 bacteria / mL, 7×10 2 bacteria / mL, 7×10 1 1 bacteria / mL and 7 bacteria / mL), 6 is the negative control. Detailed Implementation

[0056] To better understand the present invention, the following embodiments further illustrate its content, but should not be construed as limiting the scope of protection of the present invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above-described invention are within the scope of protection of the present invention.

[0057] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the invention. The embodiments include the following steps:

[0058] 1. DNA extraction from the sample to be tested

[0059] Sampling swabs collected from affected areas of pet skin contain dermatophytes. This detection method obtains DNA from pet skin swab samples. DNA extraction is performed using a commercial centrifuge column nucleic acid extraction kit, following the kit's instructions. Extracted DNA samples can be stored in 1.5 mL centrifuge tubes at 4 °C for later use.

[0060] 2. Primer design and synthesis

[0061] This invention provides a primer set for multiplex PCR detection of diarrheal fungi, wherein the primer set includes primers for detecting the genes shown in Table 1; the dermatophytes include Microsporum canis, Microsporum gypseum, Malassezia, Megasporum, Trichophyton mentagrophytes, Trichophyton truncatum, Histoplasma capsulatum, and Coccidioides.

[0062] Based on the conserved regions of the ITS-1 rRNA genes of *Microsporum canis*, *Microsporum gypseum*, *Malassezia* 26S rDNA, *Macrosporidium* 5.8S rRNA, *Trichophyton mentagrophytes* ITS-1 rRNA, *Trichophyton tonsurans* 18S rRNA, *Histoplasma capsulatum* mtSSU, and *Coccidioidomyces* WD protein gene sequences published in GenBank, specific primers were designed using Primer Premier 6 software. The designed primers were preliminarily validated using BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and Primer-LAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). All primers were synthesized by Suzhou Genewise Biotechnology Co., Ltd., and were designed to simultaneously detect the nucleic acids of eight fungi in a single reaction, i.e., primers for multiplex PCR amplification of multiple target genes. This method compares the target gene with that of closely related fungal species and selects conserved regions for primer design. The eight designed primer sets are subjected to dimer analysis and amplicon analysis to ensure that there is no cross-amplification between different primer sets, thereby avoiding false positive results.

[0063] Table 1 Target genes for multiplex PCR detection of eight dermatophytes

[0064]

[0065] Table 2 Primers for multiplex PCR reaction of eight dermatophytes

[0066]

[0067] 3. Multiplex PCR reaction

[0068] Mix 8 primers in equal volume (initial concentration of each primer is 100 μmol / L) to prepare a primer mixture solution. The reaction system is prepared as follows. The reaction system includes 10 μL of 2×Universal SYBR qPCR Mix, 2 μL of the above-mentioned 8 primer mixture solutions for pet dermatophytes, and 8 μL of the DNA template of the sample to be detected.

[0069] The amplification conditions of the multiplex PCR reaction include the following steps: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing / extension (collecting fluorescence signals) at 60 °C for 30 s, and reacting for 45 cycles to obtain the amplification curve after multiplex PCR amplification.

[0070] 4. Judgment of detection results

[0071] In the present invention, the method for judging the results of the detection method for multiplex PCR detection of dermatophytes is as follows:

[0072] (1) Using the total DNA as a template and using the primer set of the present invention, perform a multiplex PCR reaction to obtain the amplification curve after multiplex PCR amplification;

[0073] If the Ct value of the control primer > 30, re-detection is required;

[0074] If the Ct value of the amplification curve of the sample to be detected, if the Ct value > 38 or NoCt, and the Ct value of the control primer < 30, the judgment result is negative, indicating that there is no above-mentioned dermatophyte in the sample to be detected;

[0075] If the Ct value of the amplification curve of the sample to be detected is: 0 < Ct < 38, and the Ct value of the control primer < 30, the judgment result is positive, indicating that the sample to be detected contains one or more of the above-mentioned dermatophytes, and the specific fungal species in the sample are detected for the second time;

[0076] (2) Using the DNA of the sample to be detected with a positive result in the first detection as a template and using the primer of the present invention, perform a single qPCR reaction to obtain the amplification curve after qPCR amplification. The results are as Figure 3 、 Figure 4 As shown in the figure; the reaction system includes 10 μL of 2×Universal SYBR qPCR Mix, 2 μL of single-group fungal primer mixture (upstream and downstream primers are mixed, final concentration 0.5 μmol / L), and 8 μL of DNA template of the sample to be detected;

[0077] The amplification conditions are as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing / extension (fluorescence signal collection) at 60 °C for 30 s, and 45 cycles of reaction to obtain the amplification curve after qPCR amplification.

[0078] If the Ct value of the control primer > 30, re-detection is required;

[0079] If the Ct value of the amplification curve of primer pair A1 / A2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Microsporum canis;

[0080] If the Ct value of the amplification curve of primer pair B1 / B2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Microsporum gypseum;

[0081] If the Ct value of the amplification curve of primer pair C1 / C2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Malassezia;

[0082] If the Ct value of the amplification curve of primer pair D1 / D2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Macros pora;

[0083] If the Ct value of the amplification curve of primer pair E1 / E2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Trichophyton mentagrophytes; <00001x89>

[0084] If the Ct value of the amplification curve of primer pair F1 / F2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Trichophyton tonsurans;

[0085] If the Ct value of the amplification curve of primer pair G1 / G2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Histoplasma capsulatum;

[0086] If the Ct value of the amplification curve of primer pair H1 / H2 is: 0 < Ct < 35, and the Ct value of the control primer < 30, it indicates that the sample to be detected contains Coccidioides; [[ID=X2]] <0X00196>The amplification curve of the clinical sample is as Figure 1-2 shown.

[0088] The multiplex PCR detection method of the present invention is not for diagnosis. The test results are not directly correlated with the occurrence of disease and are not diagnostic results. However, the test results can serve as intermediate information for clinicians to refer to.

[0089] Example 1

[0090] 1. Primer design and synthesis Based on the conserved regions of the gene sequences of the dermatophytes Microsporum canis, Microsporum gypseum, Malassezia, Megasporium, Trichophyton mentagrophytes, Trichophyton truncatum, Histoplasma capsulatum, and Coccidioides spp. published in GenBank, specific primers were designed using PrimerPremier 6 software. The designed primers were initially validated using BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and Primer-LAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). After optimization, the primer sequences are shown in Table 2.

[0091] 2. Optimization of conditions and establishment of methods for multiplex PCR reaction of dermatophytes

[0092] (1) Optimization of annealing temperature: Three annealing temperatures were set: 58 ℃, 60 ℃ and 62 ℃. The results showed that the amplification effect of the system was best when the annealing temperature was 60 ℃.

[0093] (2) Optimization of multiplex PCR amplification system: The amount of each component and the number of cycles in the real-time quantitative PCR amplification system were optimized. The results showed that the optimal PCR amplification system was as follows: The reaction system included 10 μL of 2×Universal SYBR qPCR Mix, 2 μL of primer mixing solution (8 primers were first mixed in equal volumes (each primer concentration was 100 μol / L), and 2 μL of the mixed primers were added to each reaction system) and 8 μL of DNA template from the sample to be tested. Real-time quantitative amplification conditions: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 15 s, 60 ℃ annealing for 30 s, and 45 cycles of amplification.

[0094] 3. Specific detection

[0095] The samples used in this invention are pet skin swabs. Total nucleic acid was extracted from the skin swabs using a kit (the kit used in this embodiment is the "Centrifugation Column Nucleic Acid Extraction Kit," catalog number TL-NEK01, purchased from TianSai (Shanghai) Technology Co., Ltd.). These samples may contain nucleic acids from various microorganisms. To test the primer specificity in this invention, five irrelevant pathogens were selected as simulated interference samples: Salmonella, Vibrio parahaemolyticus, Yersinia enterocolitica, Escherichia coli, and Vibrio cholerae. Based on the optimized amplification conditions for multiplex qPCR, a mixture of eight fungal primers was used to detect Salmonella, Vibrio parahaemolyticus, Yersinia enterocolitica, Escherichia coli, Vibrio cholerae, the mixture of the five irrelevant pathogens, and samples containing fungi. The results showed that only samples containing fungi exhibited a typical S-shaped amplification curve; the others did not show an amplification curve. The results are as follows: Figure 3 As shown, the established detection method has good specificity.

[0096] 4. Sensitivity Testing

[0097] Evaluation samples: Eight fungi were selected. Sample 1 (template 1) was *Microsporum canis*, Sample 2 (template 2) was *Microsporum gypseum*, Sample 3 (template 3) was *Malassezia*, Sample 4 (template 4) was *Macrosporium*, Sample 5 (template 5) was *Trichophyton mentagrophytes*, Sample 6 (template 6) was *Trichophyton tonsurans*, Sample 7 (template 7) was *Histoplasma capsulatum*, Sample 8 (template 8) was *Cochloa crus-galli*, and Sample 9 (template 9) was a mixed template of the eight fungi. The bacterial suspension of template 9 was adjusted to 7 × 10⁻⁶. 5 CFU / mL, serially diluted to 7×10⁻⁶ cells / mL. 4 bacteria / mL, 7×10 3 bacteria / mL, 7×10 2 bacteria / mL, 7×10 1 Detection samples of 1 CFU / mL and 7 CFU / mL were tested. The primer set of this invention was used to detect templates at different dilutions. The limit of detection (LOD) results for the eight target genes detected by the method of this invention are as follows: Figure 4 As shown. From Figure 4 It can be seen that the limit of detection for the mixture of 8 primers is 7 bacteria / mL per reaction.

[0098] The above experiments fully demonstrate that this invention, as a highly sensitive, specific, and easy-to-operate multiplex qPCR detection method, can efficiently detect Microsporum canis, Microsporum gypseum, Malassezia, Megasporum canis, Trichophyton mentagrophytes, Trichophyton tonsurans, Histoplasma capsulatum, and Coccidioides in pet skin swab samples. It has certain development, utilization, and promotion value and can provide technical support for the clinical diagnosis of pet dermatophyte diseases.

[0099] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A primer set for simultaneous detection of 8 kinds of pet skin fungi, characterized by, The primer set comprises primer sequences as shown in SEQ. ID. NO. 1-19, and the eight pet skin fungi are Microsporum canis, Microsporum gypseum, Malassezia, Microsporum, Trichophyton mentagrophytes, Trichophyton tonsurans, Candida, Coccidioides.

2. Use of the primer set of claim 1 in the preparation of a reagent for simultaneously detecting eight pet skin fungi.

3. A kit for simultaneous detection of 8 pet skin fungi, characterized by, The kit comprises the primer set as shown in SEQ. ID. NO. 1-19.

4. The kit for simultaneously detecting 8 kinds of pet skin fungi according to claim 3, characterized in that, It also comprises a nucleic acid extraction reagent for the sample to be tested, and 2x Universal SYBR qPCR Mix.

5. The kit for simultaneously detecting 8 kinds of pet skin fungi according to claim 3, characterized in that, It also comprises control primers and corresponding templates.

6. A method for the detection of pet skin fungi for non-diagnostic purposes, characterized in that, The method comprises the following steps: (1) extracting total DNA of the sample to be tested; (2) using the primer set of claim 1 or the kit of claim 3, performing multiplex qPCR reaction with the total DNA as a template to obtain an amplification curve after multiplex qPCR amplification.

7. The method for the detection of fungi on the skin of a pet for non-diagnostic purposes according to claim 6, characterized in that, The reaction system comprises 2x Universal SYBR qPCR Mix 10 μL, 8 pet skin fungi upper and lower primer mixed solution 2 μL, and sample DNA template 8 μL to be detected.

8. The method for detecting pet skin fungus for non-diagnostic purposes according to claim 6, characterized in that, The reaction amplification condition is 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing / elongation for 30 s, and 45 cycles of reaction.

9. The method for detecting pet skin fungus for non-diagnostic purposes according to claim 6, characterized in that, An amplification curve after multiplex qPCR amplification is obtained, and whether the sample contains skin fungi is determined according to the Ct value of the amplification curve; if the Ct value of the amplification curve of the sample to be tested is >38 or NoCt, and the Ct value of the control primer is <30, the result is negative, indicating that the sample to be tested does not contain the above-mentioned skin fungi; If the Ct value of the amplification curve of the sample to be tested is 0