Stress inducible virus and application thereof
By using stress-induced viruses to achieve controlled release of therapeutic proteins, the problems of insufficient targeting and systemic side effects in OSCC treatment have been solved, achieving highly efficient and personalized local treatment results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-03-10
AI Technical Summary
Existing OSCC treatment regimens suffer from problems such as insufficient targeting, severe systemic toxicity, and uncontrollable drug release, resulting in poor efficacy and high safety risks.
Develop stress-induced viruses containing specific nucleic acid sequences to achieve controlled release of therapeutic proteins through external physical stimuli (such as temperature), locally activate their expression, and avoid systemic side effects.
This enables personalized, tunable, and precise release of therapeutic proteins, reducing systemic toxicity and improving therapeutic efficacy.
Smart Images

Figure CN121628850A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of medicine and biotechnology, in particular to a stress inducible virus and application thereof. BACKGROUND
[0002] Oral squamous cell carcinoma (OSCC) is one of the most common malignant tumors in the head and neck, accounting for more than 90% of oral malignant tumors. Although surgical techniques have improved in recent years, and radiotherapy and chemotherapy regimens have been continuously optimized, the five-year survival rate of OSCC patients remains around 60-70%, and this figure is significantly lower for patients with advanced or metastatic disease. The current treatment model, which is mainly surgical resection supplemented by radiotherapy and chemotherapy, can control local lesions to some extent, but still faces many challenges such as tumor recurrence, cervical lymph node metastasis, and significant damage to adjacent tissue function and appearance. More seriously, some patients develop resistance to conventional radiotherapy and chemotherapy, leading to treatment failure. Therefore, the existing standard treatment regimen is far from meeting the clinical needs, and exploring and developing new, safe, and efficient treatment strategies has become a pressing task in the field of OSCC research.
[0003] The limitations of existing treatment methods have led to a surge of interest in targeted therapy and immunotherapy. In theory, these emerging therapies can more precisely target tumor cells or their microenvironment, thereby improving efficacy while minimizing damage to normal tissues. However, there is a significant gap between ideal and reality. In terms of targeted drugs, the current research or application targets, such as epidermal growth factor receptor (EGFR) and vascular endothelial growth factor receptor (VEGFR), while overexpressed in some OSCC, are not unique to OSCC and are widely distributed in various normal tissues and cells in the body. This lack of target specificity directly leads to "off-target effects," triggering a series of systemic side effects such as skin rash, diarrhea, and hypertension, which severely limit the clinical application dose and course of the drug, ultimately affecting the anti-tumor effect.
[0004] Immunotherapy, particularly immune checkpoint inhibitors (such as PD-1 / PD-L1 inhibitors), has brought hope to some patients with advanced OSCC, but the overall response rate is still not satisfactory. This is also due to the lack of targeting. Immune checkpoint molecules are key nodes in the normal regulation of the human immune system, and systemic blockade of these pathways can activate anti-tumor immunity, but also can lead to excessive activation of the immune system, attacking normal tissues, and causing severe and even fatal adverse reactions such as immune-related pneumonia, colitis, and hepatitis. In addition, OSCC has high tumor heterogeneity and often presents as an immune "cold" tumor state, and its immunosuppressive microenvironment further weakens the efficacy of immunotherapy.
[0005] In addition to the targeting of the drug itself, the traditional systemic drug delivery system (such as intravenous injection, oral administration) is another bottleneck restricting its efficacy. The drug circulates throughout the body via the blood, and only a small proportion (usually less than 1%) can eventually accumulate in the tumor site. In order to achieve effective local drug concentration, the drug dosage must be increased, which undoubtedly aggravates the aforementioned systemic toxic side effects. At the same time, this mode of administration makes the release of the drug in the body uncontrollable, and cannot achieve precise release of timing, positioning and quantity according to the treatment needs. The drug concentration may produce toxicity at the peak, and be lower than the effective treatment threshold at the trough, providing a window for the survival and drug resistance of tumor cells. Therefore, it is urgent to develop a new, safe and effective drug for the prevention and treatment of oral squamous cell carcinoma. SUMMARY
[0006] The purpose of the present application is to overcome the defects of the prior art and provide a stress-inducible virus and its application to solve the problems raised in the background art.
[0007] To achieve the above-mentioned purpose, the present application provides the following technical solution: a stress-inducible virus, comprising a stress-inducible adenovirus or a stress-inducible lentivirus, the nucleotide sequence of the stress-inducible adenovirus or the stress-inducible lentivirus being shown in SEQ ID NO: 1.
[0008] As a preferred technical solution of the present application, it is prepared by the following steps: S1, construction of a viral vector: having a nucleic acid sequence as shown in SEQ ID NO: 1; S2, virus packaging: using a shuttle plasmid containing SEQ ID NO: 1 and a backbone plasmid containing a viral genome sequence, transfecting HEK293T cells, collecting the virus stock solution, and obtaining the stress-inducible virus.
[0009] A stress-inducible virus as described above is used for preparing a drug for preventing and treating oral tumors.
[0010] As a preferred technical solution of the present application, the protein expression can be induced under stress environment, and the test range is 42-48℃ heat stimulation.
[0011] Compared with the prior art, the present application has the following beneficial effects: 1. Realize the controllable release of exogenous expressed protein; The core of the present application is to provide a stress inducible virus, which comprises a specific nucleic acid sequence as shown in SEQ ID NO: 1. The virus improves the expression mode of the treatment gene in the traditional oncolytic virus or gene therapy, which is "continuous and uncontrollable". By introducing a response element to the external physical stimulus (such as temperature), the present application realizes the controllable release of the exogenous protein under a specific signal. Specifically, after the virus fully infects the tumor cells, the synthesis of the therapeutic protein is started by applying an external stimulus, and the expression level of the protein can be positively correlated with the intensity of the external stimulus, that is, the expression amount is further improved as the stimulation is enhanced. This "dose-effect" relationship makes it possible to realize personalized and tunable precision treatment.
[0012] 2. Local in situ production of potent therapeutic proteins greatly reduces systemic toxic side effects; Many potential anti-cancer proteins (such as the CD47 targeting protein involved in the present application) have a wide range of targets in normal tissues, which can cause serious toxic side effects (for example, anti-CD47 antibodies can cause anemia and thrombocytopenia) when administered systemically, which greatly limits their clinical application. The virus carried by the virus is only activated and expressed in the tumor after infecting oral tumor cells. The therapeutic protein produced by the present application can maximize the efficacy of CD47 targeting proteins and other drugs, while reducing their toxic side effects on other tissues in the body. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 A core plasmid map of the stress-responsive adenovirus A of the present application; Figure 2 A core plasmid map of the stress-responsive adenovirus B of the present application; Figure 3 A flow cytometry analysis showing the proportion of GFP-positive cells in oral tumor cells treated with different MOIs of the present application; Figure 4 A graph showing the proportion of GFP-positive cells in oral tumor cells treated with different MOIs of the present application; Figure 5 A graph showing the proportion of mCherry exogenous protein in oral tumor cells infected with adenovirus A in different temperature treatment groups of the present application; Figure 6 A graph showing the fluorescence intensity of APC in oral tumor cells infected with adenovirus B in different temperature treatment groups of the present application; Figure 7 A core plasmid map of the stress-responsive lentivirus C of the present application; Figure 8 A core plasmid map of the stress-responsive lentivirus D of the present application; Figure 9Fig. 3 is a diagram of the fluorescence intensity of mCherry exogenous protein of oral tumor cells infected by lentivirus C of different temperature treatment groups of the present application; Figure 10 Fig. 4 is a diagram of the fluorescence intensity of APC of oral tumor cells infected by lentivirus D of different temperature treatment groups of the present application under different temperature stimulation. DETAILED DESCRIPTION
[0014] The preferred embodiments of the present application are described in detail below with reference to the accompanying drawings, so that the advantages and features of the present application can be more easily understood by those skilled in the art, and the scope of protection of the present application can be more clearly defined.
[0015] Example 1: In this embodiment, stress-inducible adenovirus A and stress-inducible adenovirus B are constructed and prepared.
[0016] (1) Shuttle plasmid construction and virus packaging; SEQ ID NO: 1 + exogenous protein coding gene sequence (SEQ ID NO: 2 or SEQ ID NO: 3) is cloned into the multiple cloning site of the adenovirus shuttle plasmid, and the map is as follows Figures 1-2 , and the specific sequence is as follows.
[0017] SEQ ID NO: 1 GGCCGCCCACTCCCCCTTCCTCTCAGGGTCCCTGTCCCCTCCAGTGAATCCCAGAAGACTCTGGAGAGTTCTGAGCAGGGGGCGGCACTCTGGCCTCTGATTGGTCCAAGGAAGGCTGGGGGGCAGGACGGGAGGCGAAAACCCTGGAATATTCCCGACCTGGCAGCCTCATCGAGCTCGGTGATTGGCTCAGAAGGGAAAAGGCGGGTCTCCGTGACGACTTATAAAAGCCCAGGGGCAAGCGGTCCGGATAACGGCTAGCCTGAGGAGCTGCTGCGACAGTCCACTACCTTTTTCGAGAGTGACTCCCGTTGTCCCAAGGCTTCCCAGAGCGAACCTGTGCGGCTGCAGGCACCGGCGCGTCGAGTTTCCGGCGTCCGGAAGGACCGAGCTCTTCTCGCGGATCCAGTGTTCCGTTTCCAGCCCCCAATCTCAGAGCGGAGCCGACAGAGAGCAGGGAACCCC SEQ ID NO: 2 ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAA SEQ ID NO: 3 After correct identification, respectively with adenovirus backbone plasmid, co-transfected into 293 cell strain, obtain stress inducible adenovirus A and stress inducible adenovirus B, as follows: Co-transfect shuttle plasmid and adenovirus backbone plasmid into HEK293 cell strain, as follows: a. 24 h before transfection, logarithmically growing HEK293 cells were digested with 0.25% trypsin, and the cell density was adjusted to 30%-40% with DMEM medium containing 10% FBS, and then reseeded in a cell culture flask and cultured in a 37℃, 5% CO2 incubator. About 24 h later, when the cell density reached 50%-60%, it could be used for transfection; b. 2 h before transfection, replace with serum-free medium; c. Mix the DNA solution (shuttle plasmid 5 μg, backbone plasmid 5 μg) evenly without DMEM, adjust the total volume to 50 μl, incubate at room temperature for 5 min; take 10 μl Lipofectamine 2000 reagent and mix with 50 μl DMEM, incubate at room temperature for 5 min; gently mix the diluted DNA solution with Lipofectamine 2000 without shaking, incubate at room temperature for 20 min to form DNA / Lipofectamine 2000 transfection complex; d. Slowly add the transfection complex to the HEK293 cell culture solution, mix well, and incubate at 37℃, 5% CO2 cell incubator; e. After 6 h of culture, discard the culture medium containing the transfection mixture, wash once with 2 ml PBS, gently shake to wash the residual transfection mixture, and then discard; f. Slowly add 5 ml of cell culture medium containing 10% serum, continue to culture in a 37℃, 5% CO2 incubator, observe the growth condition of the cells after transfection every day, if the culture medium is obviously yellow, add appropriate amount of fresh complete culture medium; g. About 10-15 d after transfection, observe whether the HEK 293 cells start to float under the microscope, and cytopathic effect (CPE) appears; h. When most of the cells show typical CPE and 50% of the cells are detached, centrifuge the cells at low speed and resuspend them in 2 ml DMEM, freeze-thaw at -70℃ / 37℃ for 3 times, centrifuge at 4℃, 7000 g for 5 min, and collect the virus supernatant at -70℃.
[0018] (2) Large-scale preparation of virus (virus expansion); a. Transfer healthy HEK293 cells into T25 cell culture flasks. Once the cells have reached 60% confluence, discard the old culture medium and add 2 mL of crude extract of the successfully recombined replication-defective adenovirus. Incubate in a cell culture incubator for 90 min, then add 3 mL of complete culture medium and continue culturing. When most cells show typical CPE and 50% of the cells have detached from the cell wall, collect the cells by low-speed centrifugation and resuspend them in 2 mL of DMEM. Repeat the freeze-thaw cycle at -70℃ / 37℃ with shaking three times, then centrifuge at 4℃ and 7000 g for 5 min. Collect the viral supernatant and store it at -70℃. b. Transfer healthy HEK293 cells into T25 cell culture flasks. When the cells reach 90% confluence, discard the old culture medium, add 2 ml of the virus solution obtained from the first round of amplification, incubate in a cell culture incubator for 90 min, then add 10 mL of complete culture medium and continue culturing. When most cells show typical CPE and 50% of the cells detach from the cell wall, collect the cells by low-speed centrifugation and resuspend them in 10 ml of DMEM. Repeat the freeze-thaw cycle at -70℃ / 37℃ and shake 3 times, centrifuge at 4℃ and 7000 g for 5 min, collect the virus supernatant and store it at -70℃.
[0019] (3) Virus purification; a. Remove the BD Adeno-X purification device, filter 10 ml of crude virus extract through a 0.45 μm filter membrane, and store the filtrate in a collection bottle; b. Add 4 μl of 25 U / μl Benzonase to the virus filtrate, mix well, incubate at 37°C for 30 min, then add 10 ml of 1×dilution buffer and mix well. c. Assemble the filtration device. After using sterile PBS to purge the air from the filter and the cannula, insert the cannula into the virus filtrate in the collection bottle and pull the syringe outward at a speed of 5 ml / min to allow the virus filtrate to flow through the filter. d. Use 1×Wash Buffer to wash the filter device; e. Elute adenovirus using a 5 ml BD Luer-Lok syringe: Draw 3 ml of 1×Eultion Buffer into the syringe; connect the syringe and filter notch, push 1 ml of Elution Buffer through the filter into a 5 ml sterile centrifuge tube; incubate the filter at room temperature for 5 min, then push the remaining Elution Buffer through the filter to collect the remaining adenovirus; f. Aliquot the purified adenovirus and store at -70°C.
[0020] (4) Virus titer determination; a. 24 hours before the experiment, seed 96-well plates and transfer 100 μl of HEK293 cell suspension (approximately 1 x 10⁻⁶ cells) to each well. 3 One cell; b. Prepare 12 sterile EP tubes. Add 990 μl of complete culture medium to the first EP tube and 900 μl of complete culture medium to each of the remaining 11 EP tubes. c. Dilution of the virus solution to be tested: Take 10 μl of adenovirus stock solution and add it to the first EP tube for a 1:100 dilution; then, starting from this point, take 100 μl of virus dilution and add it to the next EP tube for a 1:10 dilution, until the solution is diluted to 10. -13 ; d. Discard the old culture medium in the 96-well plate and add virus solution at dilutions of 10⁻¹³ to 10⁻⁶ in sequence. Each dilution occupies one row. Add 90 μl of virus dilution to each of the first 10 wells of each row, and add 90 μl of virus-free complete culture medium to the 11th and 12th wells as a control. e. Continue culturing the 96-well plate in a 37°C, 5% CO2 cell culture incubator; f. After 10 days, observe the cytopathic phenomena, count the cell pores with CPE, calculate the CPE positivity rate after treatment with virus solution of each dilution, and calculate the virus titer.
[0021] Example 2: (1) Adenovirus infection of oral tumor cells; a. Sixteen hours before the experiment, seed 24-well plates and transfer 100 μl of Cal27 oral tumor cell suspension (approximately 1 x 10⁻⁶ cells) to each well. 5 One cell; b. Adenoviruses with MOIs of 0, 100, 1000 and 10000 were added to pre-prepared well plates containing oral tumor cells, with 3 replicates per group; c. After culturing for 48 hours, the virus-containing culture medium was removed, and the cells were digested with trypsin to obtain a single-cell suspension. The proportion of cells expressing green fluorescent protein was detected by flow cytometry. Figure 3 The efficiency of viral infection of oral tumor cells was obtained, see [reference needed]. Figure 4 .
[0022] (2) Temperature gradient treatment of fluorescent protein expression in oral tumor cells infected with adenovirus; a. Sixteen hours before the experiment, seed 24-well plates and transfer 100 μl of Cal27 oral tumor cell suspension (approximately 1 x 10⁻⁶ cells) to each well. 5 One cell; b. Add the adenovirus with an MOI of 1000 to a pre-prepared 24-well plate containing oral tumor cells, incubate for 48 h, and then replace with fresh culture medium; c. Apply gradient temperature stimulation of 37℃, 42℃, 46℃ and 48℃ for 10 min using local heating method, with three repetitions for each group; d. After 24 h, images of the 37℃ control group and the 48℃ treatment group were acquired using a fluorescence microscope. All groups were digested with trypsin to obtain single-cell suspensions. The proportion of cells expressing exogenous mCherry fluorescent protein was detected by flow cytometry. (See figure) Figure 5 The results showed that the expression level of exogenous protein increased with increasing temperature in the range of 42°C to 48°C, and there were statistically significant differences between the 46°C and 48°C control groups and the 37°C control group.
[0023] In summary, the expression of exogenous proteins in oral tumor cells infected with stress-induced adenovirus A increases with increasing temperature stimulation.
[0024] Example 3: (1) Oral tumor cells infected with adenovirus after temperature gradient treatment can be labeled with exogenous therapeutic protein (CV1-Fc); a. Sixteen hours before the experiment, seed 24-well plates and transfer 100 μl of Cal27 oral tumor cell suspension (approximately 1 x 10⁻⁶ cells) to each well. 5 One cell; b. Add the adenovirus with an MOI of 1000 to a pre-prepared 24-well plate containing oral tumor cells, incubate for 48 h, and then replace with fresh culture medium; c. Apply gradient temperature stimulation of 37℃, 42℃, 44℃, 46℃, 48℃ and 50℃ for 10 min using local heating method, with three repetitions for each group; d. After 24 hours, the cells were digested with trypsin to obtain a single-cell suspension. The cells were stained with APC-antihIgG1 antibody, and the proportion of APC-positive cells was detected by flow cytometry. (See attached table). Figure 6 According to the image results, 48℃ is the optimal temperature.
[0025] In summary, oral tumor cells infected with this stress-induced adenovirus B were labeled in situ with therapeutic proteins.
[0026] Example 4: In this example, stress-induced lentivirus C and stress-induced lentivirus D were constructed and prepared.
[0027] (1) Construction and packaging of lentiviral vectors: a. The CMV promoter sequence of the vector pCDH-CMV-MCS-EF1a-copGFP was excised using restriction endonucleases SbfI and NotI, resulting in a linearized vector. A gene fragment containing the nucleic acid sequence of SEQ ID NO:1 was obtained through gene synthesis. This fragment, along with the foreign protein-coding gene sequence (SEQ ID NO:2 or SEQ ID NO:3), was cloned into the multiple cloning site of a lentiviral plasmid. The diagram is shown below. Figures 7-8 The fragment was inserted into the vector plasmid using enzyme digestion and ligation. The target plasmid was then transformed into *E. coli* DH5alpha competent cells via chemical transformation. The competent cells were plated on LB agar plates containing 100 μg / mL ampicillin sodium and incubated at 37˚C for 24 h. Single clones were selected for liquid amplification; plasmid extraction was performed using an Omega plasmid extraction kit, and Sanger sequencing was performed for verification.
[0028] b. Culture HEK-293T cells in 6-well plates using DMEM complete medium (10% FBS, 1% PS), 2.5 × 10⁶ cells per well. 5 Cells were cultured overnight at 37 °C with 5% CO2 until the logarithmic growth phase (cell adhesion density was 70-80%).
[0029] The target plasmid and lentiviral packaging helper plasmids (psPAx2, pMD2.G) were mixed at a ratio of 3:2:1 using the calcium phosphate method. The transfection reagent mixture was then added dropwise to 100 μL of 2X HBS salt solution in another tube and vortexed to mix. The mixture was allowed to stand at room temperature for 1 min. The mixture was then steadily added dropwise to the cells, the culture medium was gently shaken, and incubated for 8–10 h. The culture medium was then replaced with fresh DMEM complete medium. After 48 h, the viral culture was collected in an EP tube, centrifuged (2000 g, 5 min), and the supernatant was collected and stored at -80 °C.
[0030] Example 5: (1) The expression of exogenous proteins in oral tumor cells infected by lentiviruses increases with increasing temperature stimulation. a. Cal27 cells were cultured in 6-well plates using DMEM complete medium (10% FBS, 1% PS), with 5 × 10⁶ cells per well. 5 Cells were cultured overnight at 37 ℃ with 5% CO2 until the logarithmic growth phase (cell adhesion density of 70-80%). b. Viral infection of tumor cells: Human oral squamous cell carcinoma cell line Cal27 expressing luciferase was infected with 0.3 mL of lentivirus stock solution and polybrene transfection reagent. The viral infection solution was removed after 48 h. c. Infected tumor cells were subjected to a gradient temperature stimulation of 37℃, 42℃, 44℃ and 46℃ for 10 min using local heating, with three replicates per group, and cultured overnight at 37℃ in 5% CO2. d. After 24 hours, the cells were digested with trypsin to obtain a single-cell suspension. The expression intensity of mCherry fluorescent protein was detected by flow cytometry. Figure 9 The fluorescence expression intensity increases with increasing temperature, and at 46℃, the expression intensity is comparable to that of the CMV promoter.
[0031] In summary, the expression of exogenous proteins in oral tumor cells infected with stress-induced lentivirus C increases with increasing temperature stimulation.
[0032] Example 6: (1) Oral tumor cells infected with lentiviruses after temperature gradient treatment can be labeled with exogenous therapeutic protein (CV1-Fc); a. Sixteen hours before the experiment, seed 24-well plates and transfer 100 μl of Cal27 oral tumor cell suspension (approximately 1 x 10⁻⁶ cells) to each well. 5 For each cell, add DMEM complete culture medium to 0.5 mL; b. Infect the human oral squamous cell carcinoma line Cal27, which expresses luciferase, with 75 μl of viral lentivirus stock solution and polybrene transfection reagent, incubate for 48 h, and then replace with fresh culture medium; c. Apply gradient temperature stimulation of 37℃, 42℃, 44℃ and 46℃ for 10 min using local heating method, with three repetitions for each group; d. After 24 hours, the cells were digested with trypsin to obtain a single-cell suspension. The cells were stained with APC-antihIgG1 antibody, and the proportion of APC-positive cells was detected by flow cytometry. (See attached table). Figure 10 According to the image results, 46℃ is the optimal temperature for achieving the best results.
[0033] In summary, oral tumor cells infected with this stress-induced lentivirus D were labeled in situ with therapeutic proteins.
[0034] The above embodiments merely illustrate implementation methods of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.
Claims
1. A stress-inducible virus, characterized in that: The stress inducible adenovirus or stress inducible lentivirus comprises a nucleotide sequence as shown in SEQ ID NO:
1.
2. The stress inducible virus of claim 1, wherein, Preparation is carried out by the following steps: S1, construction of the virus vector: having a nucleic acid sequence as shown in SEQ ID NO: 1; S2, virus packaging: using a shuttle plasmid comprising SEQ ID NO: 1 and a backbone plasmid containing a viral genome sequence, transfecting HEK293T cells, collecting the virus stock, and obtaining the stress inducible virus.
3. Use of the stress inducible virus according to any one of claims 1-2 in the preparation of a drug for preventing and treating oral tumors.
4. Use according to claim 3, characterized in that: The protein expression can be induced under a stress environment, and the test range is 42-48℃ heat stimulation.