Nucleic acid hybridization capture method and kit
By hybridizing a 5' phosphorylated probe with a nucleic acid sample, and combining the synergistic effects of nucleic acid polymerase, ligase, and recombinase, a circular probe is formed, which solves the problems of specificity and accuracy in nucleic acid hybridization capture in existing technologies, and achieves efficient and rapid nucleic acid enrichment and detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-28
- Publication Date
- 2026-03-10
AI Technical Summary
Existing nucleic acid hybridization capture technologies are inadequate in terms of specificity, accuracy, and detection time and cost, making it difficult to effectively enrich and identify target nucleic acids.
The 5' phosphorylated probe is hybridized with the nucleic acid sample, and a circular probe is formed through the synergistic action of nucleic acid polymerase, nucleic acid ligase and nucleic acid recombinase. This circular probe is then combined with exonuclease and PCR amplification to achieve highly specific and sensitive nucleic acid capture.
It improves the specificity and sensitivity of nucleic acid capture, shortens the detection time, enhances the ease of operation, and can reliably detect all variant sites of the target nucleic acid, making it suitable for full-coverage detection from low-throughput to high-throughput.
Smart Images

Figure CN121629015A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid enrichment technology, specifically relating to a method and kit for nucleic acid hybridization capture. Background Technology
[0002] Targeted enrichment of specific nucleic acids of interest is an important molecular biology technique that can specifically separate and accumulate target nucleic acids from samples. Enrichment techniques can be further combined with other detection methods to identify the enriched products, and are widely used in gene research, gene function research, variation / polymorphism analysis, genetic disease diagnosis, drug development, crop breeding, and other fields.
[0003] Hybrid capture is one of the main techniques for enriching target nucleic acids. Conventionally, oligonucleotides (i.e., probes) complementary to the target nucleic acid are designed and annealed to the denatured single-stranded sample nucleic acid. Hydrogen bonds formed through base pairing enable the oligonucleotides to specifically bind to the target nucleic acid. Biotin is typically added to the oligonucleotides, allowing them to bind to streptavidin-modified magnetic beads or various streptavidin-modified molecules anchored to a matrix surface, thus achieving the capture and enrichment of the target nucleic acid. Compared to PCR amplification, another major technique for enriching target nucleic acids, hybrid capture technology more accurately reflects the original state of the target nucleic acid and has better enrichment effects on structurally complex regions and regions containing structural variations.
[0004] However, hybrid capture technology still faces challenges in terms of specificity, accuracy, and detection time and cost. Summary of the Invention
[0005] In view of this, the present invention aims to provide a new method for nucleic acid hybridization capture to improve the capture effect.
[0006] The specific technical solution of the present invention is as follows: The first aspect of this invention provides a method for nucleic acid hybridization capture, comprising the following steps: a) Construct a hybridization reaction system to hybridize the 5' phosphorylated probe with the nucleic acid sample; the probe used consists of a 5' part, a backbone part and a 3' part in sequence, the 5' part and the 3' part are complementary to the first and second non-adjacent regions in the nucleic acid sample, respectively, and the backbone part is not complementary to the nucleic acid sample; b) The hybridization product is reacted with nucleic acid polymerase and / or polymerase active fragment, nucleic acid ligase and / or ligase active fragment to obtain a circulated probe; c) Enrich the ring-forming probe.
[0007] In the method of this invention, the hybridization reaction system contains at least one probe. Specifically, one probe, two probes, dozens of probes, hundreds of probes, thousands of probes, tens of thousands of probes, hundreds of thousands of probes, millions of probes, etc., can be added. For example, in one embodiment of this invention, 12,756 probes were added. It is understood that each probe includes a 5' portion, a 3' portion, and a backbone portion connecting the 5' portion and the 3' portion.
[0008] The 5' and 3' portions of the probe are complementary to the first and second non-adjacent regions in the nucleic acid sample, respectively. There are no restrictions on the length or matching degree of the complementary sequences, as long as stable binding is ensured. It is understood that the longer the complementary sequence and the higher the matching degree, the better the binding stability and thus the higher the capture specificity. Similarly, it is understood that hybridization of the probe with denatured nucleic acid samples will be more conducive to probe binding. Furthermore, there is no restriction on the length of the spacer region between the first and second regions; it can be 1 nt, several nt, tens of nt, or hundreds of nt, which can be flexibly adjusted by technicians based on the sequence specificity of the 5' and 3' portions of the probe.
[0009] The probe's backbone should be non-homogeneous and non-complementary to the nucleic acid sample. Preferably, the backbone may include a barcode sequence to distinguish the origin of nucleic acids from different samples, and / or a universal primer-binding sequence to facilitate PCR enrichment using universal primers, and / or an index sequence and adapter sequence to facilitate downstream sequencing reactions. More preferably, the backbone sequence may be artificially modified, including but not limited to biotinylation, acetylation, phosphorylation, methylation, deletion of one or more existing chemical groups, and covalently linking any other type of molecule to an oligonucleotide.
[0010] In the method of this invention, the source of nucleic acid samples includes, but is not limited to, animals (humans and other animals), plants, bacteria, fungi, viruses, etc. The composition of nucleic acid samples includes, but is not limited to, DNA, RNA, DNA and / or RNA analogs, and may also be modified derivatives of the above-mentioned nucleic acids. The separation, extraction, and / or purification of nucleic acid samples can be achieved using methods known in the art, such as enzymatic digestion, SDS method, CTAB method, phenol extraction method, guanidine isothiocyanate method, or combinations thereof. Alternatively, the purification of nucleic acid samples can be achieved using magnetic beads, permeation membrane method, ethanol or isopropanol precipitation method, or combinations thereof.
[0011] In the method of this invention, the reactions in steps a) and b) can be carried out in different reaction tubes or in the same reaction tube. Preferably, both steps a) and b) are carried out at a constant temperature of 45-85°C, and the nucleic acid polymerase and / or polymerase active fragments, nucleic acid ligase and / or ligase active fragments required for the reaction should have enzymatic activity at an environment not lower than 45°C. Under this temperature condition, complementary binding between the probe and the nucleic acid sample can be ensured, and the formation of secondary structures in the nucleic acid sample can be effectively avoided, thereby improving the binding efficiency.
[0012] Preferably, in the method of the present invention, the hybridization reaction system in step a) contains a nucleic acid recombinase and / or an active fragment of the nucleic acid recombinase. It is understood that when the reaction in step a) is carried out at a constant temperature of 45-85°C, the nucleic acid recombinase and / or the active fragment of the nucleic acid recombinase should maintain its activity at an environment not lower than 45°C. Therefore, those skilled in the art can screen, sequence-optimize, and sequence-mutate thermophilic microorganisms to prepare nucleic acid recombinases and / or active fragments of the nucleic acid recombinase suitable for the method of the present invention.
[0013] Experimental data show that suitable recombinases and / or recombinase active fragments can significantly improve the specificity of probe binding to nucleic acid samples while significantly reducing the amount of probe required. In some embodiments of the present invention, the recombinase and / or recombinase active fragment is a RecA family protein. RecA family proteins are central recombinases for homologous recombination, and members of this family include, but are not limited to, prokaryotic RecA, archaea RadA, and eukaryotic Rad51 and Dmc1.
[0014] More preferably, in the method of the present invention, the hybridization reaction system in step a) further contains adenosine triphosphate (ATP). ATP is obtained by directly adding ATP to the reaction system, or by adding a raw material capable of generating ATP to the reaction system. For example, in some embodiments of the present invention, at least one pyruvate kinase and / or pyruvate kinase active fragment is added to the reaction system. Pyruvate kinase and / or pyruvate kinase active fragment can catalyze the reaction of phosphoenolpyruvate (PEP) with adenosine diphosphate (ADP) to generate pyruvate and ATP. The ADP generated after ATP provides energy can then directly serve as a reaction substrate for pyruvate kinase and / or pyruvate kinase active fragment, thus generating ATP through an enzymatic reaction cycle. It is understood that when the reaction in step a) is carried out in a constant temperature environment of 45-85°C, pyruvate kinase and / or pyruvate kinase active fragments should remain active in an environment of not less than 45°C. Therefore, those skilled in the art can screen, optimize, and mutate sequences from thermophilic microorganisms to prepare pyruvate kinase and / or pyruvate kinase active fragments suitable for the method of the present invention.
[0015] In a preferred embodiment of the present invention, the hybridization reaction system in step a) simultaneously contains a nucleic acid recombinase and / or a nucleic acid recombinase active fragment, and pyruvate kinase and / or pyruvate kinase active fragment. Experimental data show that, compared to directly adding ATP to the reaction system, the enzymatic reaction to generate ATP via pyruvate kinase and / or pyruvate kinase active fragment has better sustainability and stability, and the technical effect is significantly superior. However, it should be noted that the source of the two enzymes in the above reaction system is a key factor determining the above technical effect. Under unsuitable enzyme combination conditions, pyruvate kinase and / or pyruvate kinase active fragment have no significant positive effect on cyclization efficiency, and may even be inferior to the case of adding only nucleic acid recombinase and / or nucleic acid recombinase active fragment. Through repeated verification by the inventors, the following sources of nucleic acid recombinase and / or nucleic acid recombinase active fragment, and pyruvate kinase and / or pyruvate kinase active fragment can realize the concept of the present invention: Nucleotide recombinase and / or nucleotide recombinase active fragment derived from Pyrococcus woesei , Desulfurococcus amylolyticus , Pyrobaculumislandicum , Sulfolobus tokodaii , Archaeoglobus fulgidus , Pyrococcus abyssi , Pyrococcus furiosus , Waterman Aeolian , Thermococcus gammatolerans , Red-bellied toad , Thermus thermophilus , Aquatic Thermus , Sea-dwelling thermotoga , Thermococcus kodakarensis , Pseudomonas aeruginosa , Escherichia coli , Sulfolobus solfataricus , Deinococcus radiodurans or Hot conexosphere ; while pyruvate kinase and / or pyruvate kinase active fragments originate from Thermotoga maritime , Pyrococcus furiosus , Sulfolobus solfataricus , Desulfurococcus Kamchatka , Archaeoglobus fulgidus , Aeropyrum pernix , Pyrobaculum aerophilum , Thermotoga maritime , Microbispora thermodiastatica or Microbispora rosea .
[0016] Furthermore, according to existing technology, pyruvate-phosphokinase (DPK) and / or its active fragments can catalyze the production of ATP, phosphate, and pyruvate from phosphoenolpyruvate, adenosine monophosphate, and pyrophosphate. Therefore, adding suitable DPK and / or its active fragments and their substrates to a reaction system containing recombinases and / or their active fragments may achieve the same technical effect.
[0017] In the method of this invention, the probe used in step a) can be synthesized using existing technologies, such as column synthesis, microarray synthesis, and bioenzyme synthesis, which will not be elaborated further here. Phosphorylation of the 5' end of the probe is a prerequisite for subsequent ligation into a ring. Different 5' end phosphorylation methods can be selected based on the probe synthesis method during implementation. For example, a pre-probe can be synthesized first, containing the complete probe sequence and structure, with additional artificially designed sequences at both ends. These other sequences can be binding regions of universal primers used for PCR enrichment or sequences containing restriction enzyme sites. Restriction endonucleases are used to digest the pre-probe or the PCR-enriched pre-probe, removing these other sequences while simultaneously achieving 5' end phosphorylation. Alternatively, the probe structure in the method of this invention can be directly synthesized. Polynucleotide kinase and / or polynucleotide kinase active fragments can be used to phosphorylate the probe at the 5' end. The phosphorylation reaction can occur before the probe hybridizes with the nucleic acid sample or during hybridization (i.e., probe phosphorylation and hybridization are performed in the same reaction system). Compared to other methods, phosphorylation of the probe's 5' end by adding polynucleotide kinase and / or polynucleotide kinase active fragments can eliminate the need for pretreatment after probe synthesis and before use, and effectively avoid problems such as changes in probe sequence and uneven probe concentration during pretreatment.
[0018] In the method of the present invention, the principle of probe circumduction in step b) is as follows: the 3' portion of the probe extends along the space between the first and second regions on the nucleic acid sample under the action of nucleic acid polymerase and / or polymerase active fragment, and obtains an extended portion (the extended portion contains the target nucleic acid captured by hybridization); when and only when the 3' end of the extended portion is adjacent to the 5' end of the probe, the nucleic acid ligase and / or ligase active fragment can act on the adjacent 5'-phosphate end and 3'-hydroxy end to form a phosphodiester bond through a ligation reaction, thereby obtaining a complete circulated probe.
[0019] In the method of this invention, there are no specific limitations on the function of the target nucleic acid. For example, the target nucleic acid may be part or all of a structural gene, a regulatory gene, or other genes without translation products. Furthermore, the target nucleic acid may contain one or more variant sites, including but not limited to sites that cause changes in the organism's phenotype and polymorphic sites. These variants include, but are not limited to: single nucleotide polymorphisms (SNPs), single nucleotide variants (SNVs), insertion-deletion mutations (Indels), simple sequence repeats (SSRs), short tandem repeats (STRs), microsatellite DNA, microsatellite instability (MSI), copy number variations (CNVs), copy number polymorphisms (CNPs), fusion genes, and structural variations (SVs).
[0020] It is understood that, in step b), the activity and elongation rate of the nucleic acid polymerase and / or the polymerase active fragment, the reaction environment of the elongation reaction, and the reaction time are all key factors for achieving complete elongation along the spacer region. Preferably, in the method of the present invention, the nucleic acid polymerase and / or the polymerase active fragment is derived from... Aquatic Thermus , Thermae Brokian , Thermus caldophilus , Thermus filiformis , Yellow Thermus , Thermae thermophilic , Thermococcus zilligii .
[0021] Preferably, in the method of the present invention, the nucleic acid polymerase and / or polymerase active fragment has 5' end cleavage activity. Most nucleic acid polymerases and / or polymerase active fragments have some strand substitution activity, although their activity is far less than that of PHI29 polymerase and Bst polymerase, but it still affects the effectiveness of the capture method of the present invention. The strand substitution activity of the nucleic acid polymerase and / or polymerase active fragment will displace the 5' end of the probe, causing the 3' end of the extended portion to be not adjacent to the 5' end of the probe, and the nucleic acid ligase and / or ligase active fragment cannot function, thus failing to obtain a complete circular probe. The length of the displaced 5' end of the probe is related to the strength of the strand substitution activity of the nucleic acid polymerase and / or polymerase active fragment. Nucleic acid polymerases and / or polymerase active fragments with 5' end cleavage activity can cut off the displaced 5' end of the probe and expose a new 5' end of the probe, thereby ensuring that the 3' end of the extended portion is adjacent to the 5' end of the probe, i.e., in a ligable state.
[0022] In the method of the present invention, when enriching the circulator probe in step c), the enrichment method used can obtain a pure and large amount of hybridization capture product; wherein, the hybridization capture product needs to include the extension portion, and may also include the 5' portion, 3' portion, or even the backbone portion of the probe.
[0023] Preferably, in the method of the present invention, step c) may include: digesting linear nucleic acids using at least one exonuclease and / or exonuclease active fragment to enrich the hybridization capture product by removing background. The exonuclease and / or exonuclease active fragment used can act on linear nucleic acid molecules, and can be single-stranded, double-stranded, or partially double-stranded; the cutting direction can be 5' to 3', or 3' to 5', or a combination of enzymes and / or enzyme active fragments with two cutting directions. In specific embodiments, enzymes and / or their active fragments with different exonuclease activities and enzymes and / or their active fragments with different digestion rates can be selected. By controlling the digestion reaction environment and the digestion reaction time, complete background removal can be achieved. More specifically, the exonuclease and / or exonuclease active fragment in the present invention can be selected from exonuclease T, T5 exonuclease, T7 exonuclease, Lambda exonuclease, RecJ, etc. f Exonuclease, exonuclease I, Msz At least one of exonuclease I, exonuclease III, exonuclease V, exonuclease VII, and exonuclease VIII.
[0024] Preferably, step c) may further include: performing PCR amplification on the circular probe, with the amplification range including the extended portion, thereby enriching the hybridization capture product by increasing the number of molecules. When using PCR for enrichment, a combination of one or more enzymes, such as high-fidelity polymerase or long-fragment amplification polymerase, can be selected from existing technologies. Various methods, such as temperature-dependent amplification and isothermal amplification, can also be selected. During PCR amplification, universal primers can be designed based on the backbone sequence on the circular probe to achieve batch amplification, thereby improving enrichment efficiency. Various artificial sequences (including but not limited to barcode sequences, index sequences, and adapter sequences) can also be added to the primer ends to meet the needs of downstream detection.
[0025] The obtained hybridization capture products can be further sequenced to obtain their sequence information, mainly focusing on the sequence information of the extended portions. There are no restrictions on the sequencing method; for example, first-generation sequencing, second-generation sequencing, and third-generation sequencing can be used to sequence and detect the hybridization capture products.
[0026] In the method of this invention, the enzymes and enzyme active fragments involved in each step are intended to provide enzyme molecules with the same function in the reaction system, and there are no restrictions on the number or combination of enzymes and enzyme active fragments. For an enzyme and enzyme active fragment with a certain function, for example, one or more enzymes, one or more enzyme active fragments, a combination of one enzyme and another enzyme active fragment, a combination of multiple enzymes and active fragments of other enzymes, a combination of one enzyme and active fragments of other multiple enzymes, or a combination of multiple enzymes and active fragments of other multiple enzymes may be used. In some embodiments, variants of the enzyme and / or enzyme active fragment may also be used, such as enzymes and / or enzyme active fragments with one or more modifications and / or one or more mutation sites, and / or recombined or fused with other proteins.
[0027] In a second aspect, the present invention provides a kit for nucleic acid hybridization capture, comprising at least the following reagents: The probe consists of a 5' portion, a backbone portion, and a 3' portion, wherein the 5' portion and the 3' portion are complementary to the first region and the second region of the nucleic acid sample, respectively, and the first region and the second region are not adjacent to each other. The backbone portion is not complementary to the nucleic acid sample. Nucleic acid polymerase and / or polymerase active fragment, used to extend the 3' portion of the probe; Nucleotide ligase and / or ligase active fragments are used for probe circularization; Nucleotide recombinases and / or recombinase active fragments; ATP, or an enzyme used to generate ATP through an enzymatic reaction, specifically at least one of pyruvate kinase or an active fragment of pyruvate kinase.
[0028] Preferably, in the above kit, the recombinase and / or the recombinase active fragment is: Pyrococcus abyss The RecA family proteins from which this originate, and the enzymes used to generate ATP through enzymatic reactions are... Sea-dwelling thermotoga The pyruvate kinase is derived from the nucleic acid polymerase and / or the polymerase active fragment has 5' end cleavage activity.
[0029] Preferably, the kit also includes a polynucleotide kinase and / or a polynucleotide kinase active fragment for achieving phosphorylation of the 5' end of the probe.
[0030] Compared with the prior art, the present invention has the following advantages: (1) High specificity. Capture can only be achieved if both the 5' and 3' portions of the probe used in this invention are complementary to the nucleic acid sample. Compared with traditional linear probes that can capture with a single complementary pairing, the specificity is significantly improved. In a preferred embodiment, a nucleic acid recombinase and / or an active fragment of the nucleic acid recombinase is added to assist the hybridization of the probe with the nucleic acid sample. The nucleic acid recombinase and / or the active fragment of the nucleic acid recombinase can enable the probe to be precisely located to the region that is completely complementary to the nucleic acid sample, further improving the specificity.
[0031] (2) High sensitivity. Adding recombinase and / or the active fragment of recombinase when the probe hybridizes with the nucleic acid sample can improve the utilization rate of the probe. Increasing the reaction temperature when the probe hybridizes with the nucleic acid sample and / or when the probe circulates can effectively avoid interference from secondary structures. When the probe circulates, the 5' end enzyme digestion activity of nucleic acid polymerase and / or polymerase active fragment can improve the circulation efficiency of probes complementary to the sample nucleic acid. Thanks to the above aspects, the probe in this invention can be fully utilized, and the stability and accuracy of capture can still be ensured even when the probe input is low.
[0032] (3) High flexibility. In this invention, the probe extends along the spacer region between the first and second regions of the sample to obtain an extended portion, which contains the target nucleic acid captured by hybridization. That is, complementary regions can be designed in a large range upstream and downstream of the target nucleic acid, as long as the target nucleic acid is included in the spacer region, which greatly improves the flexibility of probe design. At the same time, it also provides the possibility for designing a probe to capture multiple sites based on conserved sequences.
[0033] (4) Stable detection of haplotypes. Since the extended portion contains the target nucleic acid captured by hybridization, the target nucleic acid can be a region, and all variant sites in that region can be stably detected. In other words, compared with traditional capture that only detects a single variant, or detects multiple variants around a single variant as the core, this invention can stably detect all combinations of variant sites contained in the target nucleic acid.
[0034] (5) Wide range of applications. In practical applications, after multiplex PCR-based capture schemes exceed 2000 multiplexes, the uniformity, accuracy, and stability of multiplex amplification will fluctuate significantly. However, this invention has no limit on throughput and can achieve full coverage of low-throughput, medium-throughput, and high-throughput.
[0035] (6) Short process. The longest step in this invention is the hybridization of the probe and the nucleic acid sample, which can be completed in no more than 2 hours. When using sequencing to detect the captured product, library preparation before sequencing can be completed simultaneously in the circular probe enrichment step, eliminating the need for separate library preparation. The entire process can be completed within one day. In the traditional probe capture sequencing process, the hybridization of the probe and the nucleic acid sample alone requires an overnight reaction of 12 hours, and the library preparation process cannot be integrated into the capture process, which conservatively requires two days to complete.
[0036] (7) Convenient operation. The steps of this invention can be combined into one tube, reducing the need to open the cap and reducing aerosol contamination. For example, the steps of probe hybridization with nucleic acid sample and probe circularization can be carried out in the same reaction system, and the digestion of linear nucleic acid by exonuclease and / or exonuclease active fragments and PCR amplification in the enrichment step can be carried out in the same reaction system. Attached Figure Description
[0037] Figure 1 This is a schematic diagram of the nucleic acid hybridization capture process in this invention; Figure 1 A is a schematic diagram of the probe structure; Figure 1 B is a schematic diagram of the hybridization of the probe and the nucleic acid sample. Figure 1 C represents the extension of the probe 3' portion along the direction indicated by the arrow, using the spacer region as a template, under the action of nucleic acid polymerase and / or polymerase active fragments. Figure 1 D is the 3' end of the extended portion (after extension, this end is adjacent to the 5' end of the probe) which forms a phosphodiester bond under the action of nuclease and / or ligase active fragment. Figure 1 E represents the probe after ring formation.
[0038] Figure 2 This is a schematic diagram illustrating the mechanism of action of a nucleic acid polymerase and / or polymerase active fragment with 5' end cleavage activity. Figure 2 A indicates that during probe circumduction, one or more nucleotides at the 5' end of the probe will be replaced. Figure 2 B is a nucleic acid polymerase with 5' end cleavage activity and / or a polymerase active fragment that removes the 5' end of the displaced probe to successfully circularize the probe.
[0039] Figure 3The images are agarose gel electrophoresis images of the first round of amplification and enrichment products in Examples 1-4; where 1, 2, 3, and 4 correspond to Examples 1, 2, 3, and 4 respectively (i.e., each example is repeated twice), NTC is a template-free negative control, and the band sizes of the markers used are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp respectively.
[0040] Figure 4 This is an agarose gel electrophoresis image of the first-round amplification enrichment product of the circulator probe in Example 8; each lane corresponds to maize variety B73, maize variety Zheng 58 (Z58), and template-free negative control (NTC), and the band sizes of the markers used are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp, respectively. Detailed Implementation
[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The term "comprising" and any variations thereof in the specification and claims of this invention are intended to cover a non-exclusive inclusion.
[0042] To further improve the technical effectiveness of nucleic acid hybridization capture, this invention provides a method for nucleic acid hybridization capture, such as... Figure 1 As shown, it includes the following steps: Obtain a probe comprising a 5' portion, a 3' portion, and a skeleton portion connecting the 5' portion and the 3' portion; A hybridization reaction system was constructed to hybridize the 5' phosphorylated probe with the nucleic acid sample; specifically, the 3' part of the probe is complementary to the first region of the nucleic acid sample, the 5' part of the probe is complementary to the second region of the nucleic acid sample, and there is a spacer region between the first region and the second region. Take the hybridization product and add nucleic acid polymerase and / or polymerase active fragment, nucleic acid ligase and / or ligase active fragment for reaction; in this reaction system, the 3' part of the probe extends along the interval between the first and second regions of the sample under the action of nucleic acid polymerase and / or polymerase active fragment, to obtain the extended part (the extended part contains the target nucleic acid captured by hybridization), and the 3' end of the extended part is then connected to the 5' end of the probe under the action of nucleic acid ligase and / or ligase active fragment, to obtain a circular probe; Enrichment of the ring-forming probe.
[0043] In the method of this invention, the nucleic acid polymerase and / or polymerase active fragment preferably have 5' end cleavage activity, for the following reasons: Figure 2As shown. Due to the strand displacement activity of nucleic acid polymerase and / or polymerase active fragment, one or more nucleotides at the 5' end of the probe can be replaced, rendering the nucleic acid ligase and / or ligase active fragment ineffective. However, when the nucleic acid polymerase and / or polymerase active fragment has 5' end cleavage activity, the replaced 5' end of the probe can be excised, exposing a new 5' end adjacent to the 3' end of the extended portion, ensuring that circularization can be achieved under the action of the nucleic acid ligase and / or ligase active fragment.
[0044] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be understood that the embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0045] Unless otherwise specified, the techniques or conditions described in the literature in the following examples are performed in accordance with the product instructions. Furthermore, all reagents used in the following examples are commercially available, and all enzymes used can be obtained by purchasing commercially available reagents or by cloning, expressing, and purifying using conventional molecular biology methods.
[0046] The nucleic acid samples used in Examples 1-7 below were all from the rice variety Zhenshan 97, and the method of acquisition was as follows: nucleic acid samples were extracted from the leaves of rice variety Zhenshan 97 using the CTAB method. After the leaf samples were thoroughly ground, CTAB buffer was added, and the mixture was incubated at 65°C for 30 min; an equal volume of chloroform-isopropanol (chloroform:isopropanol = 24:1) solution was added, and the mixture was inverted and mixed for 15 min; the mixture was centrifuged at 12000 rpm for 10 min, and the supernatant was collected; two volumes of anhydrous ethanol were added, and the mixture was placed at -20°C for at least 30 min; the supernatant was discarded, and the precipitate was washed twice with 75% ethanol; the precipitate was dried, dissolved in enzyme-free water, and stored at 4°C. The nucleic acid samples used in Example 8 below were from maize varieties B73 and Zheng 58, and the extraction method was the same as that for Zhenshan 97.
[0047] The probes used in Examples 1-7 below are identical, all being 12756 probes synthesized using the primer pool method targeting Zhenshan 97. The probe structures are as follows: Figure 1 As shown in Figure A, the probe consists of a 5' portion, a backbone portion, and a 3' portion. The 5' and 3' portions range in length from 15 to 25 nt, and their sequences are reverse complementary to the rice genome, and both are single copies after alignment with the reference genome. The backbone portion of the probe is a sequence that is completely mismatched with the rice genome, and consists entirely of the sequences shown below: 5'- GCTTGGCTTACAGACATAGG TTTGTTCTTTTCTTTTATTTTTGTTATTCTTTGGTTTTACTTT CA AGCAATCTTCGGGTAGAG -3' (SEQ ID NO.1); The underlined portion represents the binding region of the amplification primers during probe enrichment (first round of amplification enrichment).
[0048] The probes used in Example 8 below are 2281 probes synthesized for maize using the primer pool method, capable of detecting 9049 SNPs and InDel sites. The probe structure is also as described below. Figure 1 As shown in A, the 5' and 3' portions of the probe are required to be the same as those of the rice probe described above, and the skeleton portion sequence of the probe is the same as that of SEQ ID NO.1.
[0049] Example 1 The method for nucleic acid hybridization capture in this example includes the following steps: (1) Probe 5' phosphorylation.
[0050] In this example, T4 PNK was used to phosphorylate the 5' end of the probe. The specific procedure was as follows: 5 μl of 10×PNK buffer, 1 μl of T4 PNK (10 U / μl), 5 μl of 10 mM ATP were added to the probe mixture, and enzyme-free water was added to bring the total volume to 50 μl; the reaction was carried out at 37°C for 30 min, and then inactivated at 80°C for 20 min.
[0051] (2) The probe hybridizes with the nucleic acid sample.
[0052] The hybridization reaction system shown in Table 1 was constructed and reacted at 60℃ for 2 hours.
[0053] Table 1. Hybridization reaction system in Example 1
[0054] (3) Probe ring formation.
[0055] Add 0.5 μl of 10×Taq DNA ligase buffer, 1 μl of Taq DNA ligase (40 U / μl), 0.1 μl of Taq DNA polymerase (5 U / μl), and 0.5 μl of 10 mM dNTP to the hybridization product obtained in step (2), and add enzyme-free water to a final volume of 25 μl. Incubate at 60 °C for 10 min.
[0056] (4) Enrichment by exonuclease digestion of circulated probes.
[0057] Take 2 μl of the cyclized product obtained in step (3), add 0.2 μl of exonuclease VIII (10 U / μl) and 0.2 μl of Lambda exonuclease (5 U / μl), and add enzyme-free water to a final volume of 10 μl. Incubate at 37℃ for 20 min, then inactivate at 80℃ for 10 min.
[0058] (5) First round of amplification and enrichment of the circular probe.
[0059] Take 2 μl of the exonuclease digestion product obtained in step (4), add 2 μl of 10×PCR buffer, 0.2 μl of 10 mM dNTP, 1 μl each of 10 μM first-round amplification upstream and downstream primers, and 0.1 μl of Taq DNA polymerase (5 U / μl), and add enzyme-free water to 20 μl to obtain the first-round amplification system.
[0060] The amplification program was as follows: 94℃, 15min; 94℃, 20s, 58℃, 20s, 72℃, 30s, 30 cycles; 72℃, 3min.
[0061] The sequences of the upstream and downstream primers for the first round of amplification are shown below: 5'- CGGCAGCGTCAGATGTGT ATAAGAGACAGTTAGATGCAT CCTATGTCTGTAAGCCAAGC -3' (SEQ ID NO.2) 5'- TGGAGTTCAGACGTGTGCTC TTCCGATCTACTTAGAATG CAAGCAATCTTCGGGTAGAG -3' (SEQ ID NO.3); The underlined part is the complementary pairing region with the probe backbone, the italic part is the binding region with the amplification primers during the subsequent second round of amplification and enrichment, and the bold part is the barcode sequence.
[0062] (6) Second round of amplification and enrichment of the circular probe.
[0063] Take 2 μl of the first-round amplification product, add 2 μl of 10×PCR buffer, 0.2 μl of 10 mM dNTP, 0.5 μl each of 10 μM second-round amplification upstream and downstream primers, and 0.1 μl of Taq DNA polymerase (5 U / μl). Add enzyme-free water to a final volume of 20 μl to obtain the second-round amplification system.
[0064] The amplification program was as follows: 94℃, 15 min; 94℃, 20 s, 58℃, 20 s, 72℃, 30 s, 6 cycles; 72℃, 3 min.
[0065] The sequences of the upstream and downstream primers for the second round of amplification are shown below: 5'-AATGATACGGCGACCACCGAGATCTACACTATAGCCTTCGT CGGCAGCGTCAGATGTGT -3' (SEQ ID NO.4) 5'-CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGAC TGGAGTTCAGACGTGTGCTC -3' (SEQ ID NO.5); The italicized portion represents the region that binds to the amplification primers during the first round of amplification enrichment, while the bolded portion represents the barcode sequence.
[0066] (7) Purification of cyclic probe.
[0067] Add 1.8× magnetic beads to the second-round amplification product and incubate for 5 min, then let it stand on a magnetic rack for 2 min and discard the supernatant. Wash the precipitate twice with 1 ml of 80% ethanol. Resuspend in 50 μl of enzyme-free water for 1 min, then let it stand on a magnetic rack for 2 min. The supernatant is the hybridization capture product.
[0068] After two rounds of amplification and enrichment, the captured product already contains sequencing adapters and can be used directly for sequencing.
[0069] (8) Detection and analysis of captured products.
[0070] The hybridization capture products were sequenced and analyzed using the Illumina T7 sequencing platform to obtain the sequence information of the target nucleic acid.
[0071] Example 2 Compared with Example 1, the method in this example only changed the hybridization reaction system in step (2), as shown in Table 2.
[0072] Table 2 Hybridization reaction system in Example 2
[0073] The recombinase used in this example is Pyrococcus abyssi The source is a RecA family protein; for the specific sequence, please refer to https: / / www.ncbi.nlm.nih.gov / protein / WP_048146514.1.
[0074] Example 3 Compared with Example 1, the method in this example only changed the hybridization reaction system in step (2), as shown in Table 3.
[0075] Table 3. Hybridization reaction system in Example 3
[0076] The recombinase used in this example is the same as that in Example 2.
[0077] Example 4 Compared with Example 1, the method in this example only changed the hybridization reaction system in step (2), as shown in Table 4.
[0078] Table 4. Hybridization reaction system in Example 4
[0079] The recombinase used in this example is the same as in Example 2; pyruvate kinase is... Sea-dwelling thermotogaThe source and the specific sequence of its pyruvate kinase can be found at https: / / www.ncbi.nlm.nih.gov / protein / Q9WY51.1.
[0080] Three μl of the first-round amplification enrichment products of the cyclization probes from Examples 1-4 were respectively subjected to agarose gel electrophoresis for detection, and the detection results are as follows: Figure 3 As shown. Figure 3 The smaller bands near the middle arrow B are probe self-ligation products or dimers formed by probe self-expansion when the capture efficiency is low. The brighter this part in the gel image, the worse the capture effect. Figure 3 The area near the middle arrow A shows the first round of enrichment products. Because the extension lengths of the ring-forming probes are different, they appear as diffuse bands. The brighter this part is in the gel image, the better the capture effect.
[0081] In addition, the detection rate, alignment rate and consistency rate of the sequencing results of Examples 1-4 are shown in Table 5; where the detection rate is the proportion of the actual number of target nucleic acids detected to the total number of target nucleic acids, the alignment rate is the proportion of the number of reads aligned to the target nucleic acid to the total number of valid reads, and the consistency rate is the proportion of the number of sites identified by sequencing that are consistent with the genotype of the Zhenshan 97 reference genome to the total number of detected sites.
[0082] Table 5. Statistical analysis of sequencing results from Examples 1-4
[0083] Figure 3 The results shown in Table 5 are in excellent agreement. These results indicate that the amount of enriched product in the first round of amplification in Example 1 was significantly lower than in other groups and contained more non-target products. The sequencing results were also the worst among all examples, suggesting that the addition of RecA family proteins significantly improved the probe's cyclization efficiency. Furthermore, the presence of ATP in the system further enhanced the cyclization efficiency. Compared to directly adding a quantitative amount of ATP to the system (Example 3), using pyruvate kinase to generate ATP (Example 4) was more effective. In the pyruvate kinase enzymatic reaction, the ADP produced after ATP assists RecA family proteins in performing their function can be recycled and further used as a substrate for pyruvate kinase to continue generating ATP, maintaining ATP stability within the system and ensuring the activity of RecA family proteins.
[0084] Example 5 Compared with Example 1, the method in this example only changed the hybridization reaction system in step (2), as shown in Table 6.
[0085] Table 6 Hybridization reaction system in Example 5
[0086] The recombinase and pyruvate kinase used in this example are the same as those in Example 4.
[0087] Using the same method, the detection rate, alignment rate, and consistency rate of sequencing results at different probe concentrations were calculated. As can be seen from the detection results (Table 7), the method of the present invention can still ensure the capture effect when the final probe concentration is as low as 1.2 nM.
[0088] Table 7 Sequencing results at different probe concentrations
[0089] Example 6 Compared with Example 1, the method in this example only changed the hybridization reaction system in step (2), as shown in Table 8.
[0090] Table 8 Hybridization reaction system in Example 6
[0091] The recombinase and pyruvate kinase used in this example are the same as those in Example 4.
[0092] Following the same method, the detection rate, alignment rate, and consistency rate of sequencing results under different DNA dosages were calculated, and the results are shown in Table 9. The results show that when the probe dosage is low, a larger nucleic acid sample dosage results in better capture performance, with 40 ng of nucleic acid sample offering the best cost-effectiveness. Considering cost, probe synthesis, especially the synthesis of probes weighing over 1000 or 10,000 grams, is expensive. In contrast, the amount of nucleic acid sample used can be easily increased by increasing the input volume. Therefore, determining the nucleic acid dosage for low probe dosages is a more cost-effective approach.
[0093] Table 9 Sequencing results of experimental groups with different nucleic acid sample input amounts
[0094] Example 7 To verify the positive effect of nucleic acid polymerase and / or polymerase active fragment having 5' end cleavage activity on the capture effect, two experimental groups were set up in this example, denoted as group 1 and group 2, respectively.
[0095] Compared with Example 1, the method of Group 1 only changed the hybridization reaction system in step (2), as shown in Table 10.
[0096] Table 10 Hybridization reaction system in Example 7
[0097] The recombinase and pyruvate kinase used in this example are the same as those in Example 4.
[0098] Compared with group 1, the only difference in group 2 is step (3), which is: replacing Taq DNA polymerase with artificially mutated Taq DNA polymerase (see https: / / www.ncbi.nlm.nih.gov / protein / AYJ71526.1 for the sequence). The mutated Taq DNA polymerase is a truncated mutant with amino acids 1 to 294 removed, which loses the 5' end enzyme activity.
[0099] This example further validates the 5' cleavage activity of Taq DNA polymerase and its truncated mutant using oligonucleotides 1 and 2 shown below: 5'-AAGACGGATGCATGGAAATCATGGACTACTCTTTACCGAGAGATGACCTCTCAAGTGGC-3' (oligonucleotide with fluorescent modification at the 1' and 5' ends, SEQ ID NO. 6); 5'-GCCACTTGAGAGGTCATCTCTCGGTAAAGAGTAGCCTTCCTACGACAAGTACCAGATCT-3' (Oligonucleotide 2, SEQ ID NO.7).
[0100] Positions 26 to 59 of oligonucleotide 1 are reverse complementary to positions 1 to 34 of oligonucleotide 2. This means that when DNA polymerase has 5' end cleavage activity, the unmatched 5' portion of oligonucleotide 1 will be cleaved. Because the 5' end is fluorescently modified, small bands can be detected by fluorescent electrophoresis.
[0101] Three treatments were set up: Taq DNA polymerase (5 U / μl), Taq DNA polymerase truncated mutant (5 U / μl), and no DNA polymerase. 2 μl of 10×PCR buffer was added, along with 1 μl each of oligonucleotide 1 and oligonucleotide 2, and 1 μl of DNA polymerase. Enzyme-free water was added to bring the total volume to 20 μl. The reaction was incubated at 95℃ for 3 min, then at 50℃ for 5 min. The reaction products were diluted 200-fold and detected by capillary gel electrophoresis. The results showed that the Taq DNA polymerase truncated mutant treatment was consistent with the no-DNA polymerase treatment, with fluorescence signal detected only at 59 nt, indicating that the Taq DNA polymerase truncated mutant lacked 5' end digestion activity. The Taq DNA polymerase treatment showed fluorescence signal only at 25 nt, indicating that Taq DNA polymerase had 5' end digestion activity.
[0102] Following the same method, the detection rate, alignment rate, and consistency rate of the sequencing results for group 1 and group 2 were calculated, and the results are shown in Figure 11. The results show that high-quality capture can be achieved by the method of the present invention regardless of whether the polymerase has 5' end digestion activity, but the effect is better when using a polymerase with 5' end digestion activity.
[0103] Table 11 Sequencing results under different DNA polymerase conditions
[0104] Example 8 Referring to the conditions of group 1 in Example 7, this example tested nucleic acid samples from maize varieties B73 and Zheng 58, with three technical replicates for each variety.
[0105] Take 3 μl of the first-round amplification enrichment product of the circularization probe and perform agarose gel electrophoresis for detection, such as... Figure 4 As shown in the figure; and the detection rate, alignment rate and consistency rate of the sequencing results are shown in Table 12.
[0106] Table 12 Sequencing results of maize samples
[0107] The above results show that when using the method of the present invention to capture nucleic acid samples derived from maize, the capture results are also stable and reliable.
[0108] In summary, the method of the present invention has excellent capture effect and has the advantages of reliable results, short detection time, and strong applicability.
[0109] It should be noted that the above embodiments are only some embodiments of the present invention and not all embodiments, and are only used to illustrate the technical solutions of the present invention and not to limit it; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
Claims
1. A method of nucleic acid hybridization capture, characterized by, The method comprises the following steps: a) constructing a hybridization reaction system to hybridize a 5' phosphorylated probe with a nucleic acid sample; the probe comprises a 5' part, a backbone part and a 3' part in sequence, the 5' part and the 3' part are complementary to a first region and a second region of the nucleic acid sample respectively, and the backbone part is not complementary to the nucleic acid sample; b) reacting the obtained hybridization product under the action of a nucleic acid polymerase and / or a polymerase active fragment, a nucleic acid ligase and / or a ligase active fragment to obtain a looped probe; c) enriching the looped probe.
2. The method of claim 1, wherein, Steps a) and b) are both performed in a constant temperature environment of 45-85°C.
3. The method according to claim 1 or 2, characterized in that, The hybridization reaction system of step a) contains a nucleic acid recombinase and / or a nucleic acid recombinase active fragment.
4. The method of claim 3, wherein, The hybridization reaction system of step a) contains ATP.
5. The method of claim 4, wherein, The ATP is directly generated in the hybridization reaction system by an enzymatic reaction of a pyruvate kinase and / or a pyruvate kinase active fragment.
6. The method of claim 1 or 2, wherein, The probe is 5' phosphorylated in the hybridization reaction system under the action of a polynucleotide kinase and / or a polynucleotide kinase active fragment.
7. The method according to claim 1 or 2, characterized in that, The nucleic acid polymerase and / or the polymerase active fragment of step b) has 5' end cleavage activity.
8. The method of claim 1, wherein, The enrichment of step c) comprises: digesting linear nucleic acids using at least one exonuclease and / or an exonuclease active fragment and then performing PCR amplification, or directly performing PCR amplification on the looped probe, wherein the amplification range contains the target nucleic acid.
9. A kit for nucleic acid hybridization capture, characterized by, At least comprising: a probe comprising a 5' part, a backbone part and a 3' part in sequence, wherein the 5' part and the 3' part are complementary to a first region and a second region of a nucleic acid sample respectively, the first region and the second region are not adjacent, and the backbone part is not complementary to the nucleic acid sample; a nucleic acid polymerase and / or a polymerase active fragment for extending the 3' part of the probe; a nucleic acid ligase and / or a ligase active fragment for looping the probe; a nucleic acid recombinase and / or a nucleic acid recombinase active fragment; ATP, or an enzyme for generating ATP by an enzymatic reaction, specifically at least one of a pyruvate kinase and a pyruvate kinase active fragment.
10. The kit of claim 9, wherein The nucleic acid recombinase and / or nucleic acid recombinase active fragment is Pyrococcus abyssi a RecA family protein from E. coli, the enzyme for generating ATP by an enzymatic reaction is Thermotoga maritima a pyruvate kinase from E. coli, the nucleic acid polymerase and / or polymerase active fragment has 5' endonuclease activity.