Molecular marker for identifying and distinguishing three plants of erigeron and application of molecular marker
By developing species-specific molecular markers using high-throughput sequencing technology, the problem of difficult identification of plants in the genus Erigeron with similar morphologies has been solved, enabling rapid and accurate plant identification and control, and improving identification efficiency and automation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies make it difficult to quickly and accurately distinguish between morphologically similar Erigeron species such as Erigeron davidii, Erigeron simonii, and Erigeron simonii, especially in the seedling stage where identification using traditional morphological and molecular marker methods is challenging, resulting in low efficiency in controlling invasive plants.
High-throughput sequencing technology was used to assemble contig sequences from the whole genome sequences of *Sophora flavescens*, *Eragrostis sulphureus*, and *Eragrostis sulphureus*, and species-specific molecular markers were developed to achieve precise plant identification through sequence alignment.
It enables efficient and accurate identification of Sumatran sphagnum, sedge, and sedge, allowing for rapid differentiation in batches of samples, reducing human error, and improving the automation and standardization of the identification process.
Smart Images

Figure CN121629073A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers for identifying three species of plants in the genus *Erigeron* and their applications. Background Technology
[0002] *Conyza* is a genus of annual or perennial herbaceous plants belonging to the Asteraceae family. Widely distributed in temperate to subtropical regions worldwide, it commonly grows in open habitats such as farmland, roadsides, and wastelands. Species within this genus generally possess erect stems, narrow lanceolate leaves, and capitula, and exhibit strong reproductive capacity and wide ecological adaptability. Some species possess both invasive characteristics and potential medicinal value, making them significant for research in agricultural production, ecological management, and medicinal resource development. Among them, *Conyza* (also known as *Conyza spp.*) is particularly important. Erigeron bonariensis Sumatran white wine grass ( Erigeron sumatrensis ) and small turfgrass ( Erigeron canadensis These three species, *Erigeron*, are morphologically closely related to each other and are common annual herbaceous plants belonging to the genus *Erigeron* in the family Asteraceae. They are widely distributed in temperate to subtropical regions of my country and are commonly found in farmland, roadsides, and wastelands. The three species share highly similar morphological characteristics, all possessing erect stems, narrow lanceolate leaves, and capitula. They can only be distinguished by subtle differences such as inflorescence size, ray floret color, and the number of pappus layers. However, in the wild, the morphological characteristics of these plants are often blurred due to factors such as growth stage (seedlings do not flower) and habitat stress (drought causes leaf wrinkling), making traditional classification and identification extremely difficult. Furthermore, the morphological boundaries between these three species and other closely related species in the genus *Erigeron* are also unclear, especially in the seedling stage, easily leading to misidentification.
[0003] Sumatran white wine grass and Erigeron cannabinoides are highly invasive and can compete for light and nutrients, squeezing out the living space of crops and causing crop yield reduction. They have been listed as first-level malicious invasive plants. Although Sedum cannabinoides is less invasive, when it grows together with the former two, it is difficult to develop targeted control plans if they cannot be distinguished, resulting in low control efficiency.
[0004] Currently, species identification in the genus *Erigeron* still relies on morphological classification and traditional molecular marker techniques. Morphological classification is overly dependent on the experience of the identifyer and is greatly affected by the environment. Existing molecular markers, such as RAPD and ISSR, while useful for species differentiation, suffer from poor stability, low reproducibility, and insufficient detection efficiency. Conventional gene fragments used in plant phylogenetic studies (such as rbcL and matK) are mostly single nucleotide polymorphisms (SNPs), which are difficult to observe directly through conventional experiments (such as electrophoresis) in rapid species identification. Therefore, developing rapid, accurate, and easy-to-use molecular markers to achieve efficient identification of *Erigeron*, *Erigeron simonii*, and / or *Erigeron davidii* (achieving differentiation among these three species and / or with other plants in the same genus) is of great significance for the control of invasive weeds, screening of medicinal resources, and taxonomic research of *Erigeron* species. SUMMARY
[0005] The present application is mainly directed to the above technical problems, and provides a simple method for molecular marker, which realizes the identification and distinction of S. sumatrensis, P. minor and / or P. odorata, and can also distinguish at least one of the above three plants from other plants of the genus Papaver. The present application first uses the method of high-throughput sequencing to assemble the genomic contigs sequences from the whole genome sequences of S. sumatrensis, P. minor and P. odorata, and compares the genomic contigs sequences of the three plants to obtain species-specific fragments, i.e. molecular markers. The molecular markers have strong species specificity, which can not only distinguish the three plants of S. sumatrensis, P. minor and P. odorata, but also effectively distinguish at least one of the above three plants from other plants of the genus Papaver, which meets the urgent needs of the industry for variety authenticity identification and has important practical value.
[0006] Specifically, the present application provides the following technical solutions: In one aspect, the present application provides a molecular marker (or called DNA barcode) for identifying plants of the genus Papaver, characterized in that the molecular marker comprises at least one of three molecular markers, and the nucleotide sequences of the molecular markers are shown in SEQ ID NO. 1-3, wherein SEQ ID NO. 1 is the molecular marker corresponding to S. sumatrensis, SEQ ID NO. 2 is the molecular marker corresponding to P. minor, and SEQ ID NO. 3 is the molecular marker corresponding to P. odorata.
[0007] In another aspect, the present application provides the use of the above molecular marker as a reference sequence for identifying or assisting in identifying plants of the genus Papaver.
[0008] In another aspect, the present application provides a specific method for identifying or assisting in identifying three target plants of the genus Papaver, characterized in that the method comprises the following steps: 1) collecting plants of the genus Papaver as a sample to be detected; 2) extracting total DNA of the sample to be detected; 3) performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) assembling the sequencing data, and aligning the contigs obtained by assembly with the aforementioned molecular marker; 5) performing sequence alignment of the contigs that can completely cover the aforementioned molecular marker and have the highest consistency with the molecular marker, and judging what target plant of the genus Papaver the sample contains according to the alignment result; if the sequence is consistent with the molecular marker, it is judged that the sample to be detected contains the target plant of the genus Papaver corresponding to the molecular marker, thereby realizing the distinction of the target plant of the genus Papaver from other plants of the genus Papaver.
[0009] In some embodiments of the present application, the three target plants of the genus Eupatorium are Eupatorium odoratum, Eupatorium humifusum and / or Eupatorium fortunei.
[0010] In some embodiments of the present application, in step 4), the contigs of a single sample can be aligned to the molecular marker set, or the contigs of multiple samples can be mixed and then aligned to the molecular marker set.
[0011] In another aspect, the present application provides a method for identifying or assisting in identifying three target plants of the genus Eupatorium, characterized in that it comprises the following steps: 1) Collecting a plant of the genus Eupatorium as a sample to be detected; 2) Extracting total DNA from the sample to be detected; 3) Performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Aligning the sequencing reads to a DNA barcode, which is any one of the aforementioned molecular marker set; 5) Judging the species of the sample according to the coverage of the sequencing reads on the DNA barcode; if the DNA barcode can be completely covered and a consistent sequence identical to the DNA barcode can be generated, it is judged that the species of the sample to be detected contains the target plant of the genus Eupatorium corresponding to the DNA barcode, thereby realizing the differentiation of the target plant of the genus Eupatorium from other plants of the genus Eupatorium.
[0012] In some embodiments of the present application, the three target plants of the genus Eupatorium are Eupatorium odoratum, Eupatorium humifusum and / or Eupatorium fortunei.
[0013] In some embodiments of the present application, according to the application purpose, only one plant of the three target plants of the genus Eupatorium can be identified.
[0014] In some embodiments of the present application, in order to improve the identification efficiency and reduce the identification cost, for the identification of a large number of plant samples, a grouping screening strategy can be implemented. Specifically, in step 4), if the sequencing reads of multiple samples are grouped and mixed, further comprising step 6) dividing the samples containing the target plant of the genus Eupatorium into two groups, respectively mixing the sequencing reads of the samples in each group, repeating the above steps 4)-5) until the target plant of the genus Eupatorium of a single sample is identified.
[0015] In some embodiments of the present application, the high-throughput sequencing in step 3) is second-generation sequencing or third-generation sequencing.
[0016] In some embodiments of the present application, reads alignment in step 4) is performed using any one of Geneious, Bowtie, Tophat or HISAT.
[0017] The present application has the following advantages: 1. Accurate and specific identification: The molecular marker and method provided by the present application can effectively distinguish three very similar and difficult-to-identify species of the genus Centaurea, namely C. somae, C. ericoides and C. odorata, solving the problem of strong subjectivity and easy error of traditional morphological identification methods.
[0018] 2. High throughput, simple and fast: Compared with traditional single-locus detection methods such as Sanger sequencing, the present application uses high-throughput sequencing technology, which can simultaneously detect multiple samples, greatly improving the detection efficiency and being more suitable for rapid identification and analysis of batch samples.
[0019] 3. Wide application range: The method can not only distinguish between C. somae, C. ericoides and C. odorata, but also can effectively identify at least one of the above three target plants of the genus Centaurea from other non-target plants of the genus Centaurea, having a wider applicability.
[0020] 4. High potential for automation and standardization: The method of the present application is based on sequence alignment and coverage analysis for species determination, with clear process and clear criteria, which is conducive to the automation and standardization of the identification process, reduces human error, and improves the repeatability and reliability of the method. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Fig. 1 is a morphological photograph of three species of the genus Centaurea, wherein A is C. odorata, B is C. somae, and C is C. ericoides.
[0022] Figure 2 Fig. 2 is the alignment result of SEQ ID NO. 1 on Genbank.
[0023] Figure 3 Fig. 3 is the alignment result of SEQ ID NO. 2 on Genbank.
[0024] Figure 4 Fig. 4 is the alignment result of SEQ ID NO. 3 on Genbank.
[0025] Figure 5 Fig. 5 is the alignment result of the reads of the second-generation sequencing containing C. somae on SEQ ID NO. 1, and Figs. A ~ C are the alignment results of three different samples.
[0026] Figure 6is the alignment result of the second-generation sequencing reads containing Conyza sumatrensis on SEQ ID NO. 2, and Figures A ~ C are the alignment results of three different samples.
[0027] Figure 7 is the alignment result of the second-generation sequencing reads containing Conyza sumatrensis on SEQ ID NO. 2, and Figures A ~ C are the alignment results of three different samples.
[0028] Figure 8 is the alignment result of the second-generation sequencing reads containing Conyza sumatrensis on SEQ ID NO. 2, and Figures A ~ C are the alignment results of three different samples. Figure 8 A is the alignment result of the second-generation sequencing reads containing no Conyza sumatrensis (containing only Conyza blinii and Conyza sumatrensis) on SEQ ID NO. 1, and the figure is the alignment of the mixed sequencing reads of 6 groups of samples; Figure 8 B is the alignment result of the second-generation sequencing reads containing no Conyza blinii (containing only Conyza sumatrensis and Conyza sumatrensis) on SEQ ID NO. 2, and the figure is the alignment of the mixed sequencing reads of 6 groups of samples; Figure 8 C is the alignment result of the second-generation sequencing reads containing no Conyza sumatrensis (containing only Conyza blinii and Conyza sumatrensis) on SEQ ID NO. 3, and the figure is the alignment of the mixed sequencing reads of 6 groups of samples.
[0029] Figure 9 is the alignment result of the second-generation sequencing reads of 27 plants of the genus Conyza on SEQ ID NO. 2 ~ 3, Figure A is the alignment result on SEQ ID NO. 2, and Figure B is the alignment result on SEQ ID NO. 3. DETAILED DESCRIPTION
[0030] In order to make the purposes, technical solutions and beneficial technical effects of the present application clearer, the present application will be further described in detail below in combination with examples. It should be understood that the following examples are given only for the purpose of illustration and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. The plant samples used in the following examples can be obtained by field collection or commercial purchase.
[0031] Example 1 Development of specific molecular markers for three plants of the genus Conyza The three plants of the genus Conyza (Conyza sumatrensis, Conyza blinii and Conyza sumatrensis) are extremely similar in morphological growth period, especially in leaf morphology, and it is difficult to achieve accurate and rapid species identification by relying on external characteristics (seeFigure 1 It is difficult to identify the three plants from each other and from other plants of the genus Eupatorium at the seedling stage. Therefore, it is of great significance to develop specific molecular markers that can clearly distinguish the three plants for their accurate identification.
[0032] The specific molecular markers of S. sumatrensis, P. humilis and S. odoratum are obtained by the following steps, i.e., molecular marker: 1) Collecting plant sample leaves; 2) Extracting total DNA from leaves; 3) Performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Performing genome assembly on the sequencing reads of the three plant samples to obtain genome contigs sequences.
[0033] 5) Comparing the genome contigs of the three plant samples to obtain species-specific fragments, i.e., molecular markers.
[0034] The results show that a specific nucleotide sequence is obtained in the genomes of the three plant samples, which is speculated to be a molecular marker for identifying and distinguishing the three species. The nucleotide sequences of the specific molecular markers of the three species are as follows.
[0035] SEQ ID NO. 1 (located in the genome of S. sumatrensis): GAGAGGGCACTGCTAAAGGGGAAACACACTCTTTGTCGGAACGAGGAAGAACTGTTGACGTAAAACCCCTTCTTTTTCTCTTGTCCTATTATCTTTATGCTCTCTTAGTAGAGACCCCCACAACTCAACCCTAACTAAGCTCTGTAAACAAAAAGAAGATGTTGTTTAAAGTTCCAAGAAAGGGCTATGGTTCACTCGCGGTCGAAGAA SEQ ID NO. 2 (located in the genome of P. humilis): GGATCTTGGTCCTTTATTTATAGTTCTTGCATTAACCGGTCTGGAATTAGGTGTAGCTATATTACAAGCTTATGTTTTTACGATCTTAATCTGTATTTACTTGAATGAGAACGCGGCGGTCAAAAATAGTTTACCCCGCGAAAGCGGGCTGGTCGTACCGGCCAACACGTCTCTGCGTGATGTTGTCACATCCGCAGCCCCTGTACTGGCTGTA SEQ ID NO.3 (located in the genome of *Corydalis yanhusuo*): GAACAGCCATCGGACCGGATTTGTCGTAAAATTGAGATTCTTTCGTTTTCTTCCTATCAGAGAGGGTTGTTGAGCGGTCCATCTTTTCTTTTACTTCACAGAGCTTCCCATCTCCTGGAAGTTATTGAGGAAAAAAAGCTAAGCGGCGGGCGGCCCCGGTAAAG Example 2 Specificity verification of molecular markers To further verify that the molecular markers in Example 1 are species-specific sequences, the three molecular marker sequences from Example 1 were submitted to the NCBI GenBank database for BLAST alignment. The results showed that although most of the homologous sequences in the NCBI database belonged to the Asteraceae family, none of the three molecular marker sequences had highly homologous species (coverage and identity could not both reach 100%). Figures 2-4 This indicates that the three molecular markers developed in this invention have extremely high species specificity.
[0036] Example 3: Identification of three species of *Erigeron* The identification of three species of *Erigeron* plants based on the specific molecular markers developed in this invention specifically includes the following steps: 1) Collect leaves of *Sophora flavescens*, *Erigeron simonii* and *Erigeron simonii* as samples to be tested (3 replicates for each variety); 2) Extract total DNA from the sample to be tested; 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Use Geneious software to align the sequencing reads to SEQ ID NO. 1~3 respectively, with default parameters. Determine the species of the sample based on the alignment results.
[0037] 5) Results are as follows Figures 5-8 As shown, Figure 5 The sequencing reads of the sample containing *Sophora flavescens* completely covered the sequence in SEQ ID NO.1 and generated a sequence that was identical to SEQ ID NO.1. Figure 6 The sequencing reads from the sample containing Erigeron brevis showed that the sequence completely covered SEQ ID NO.2 and generated a sequence that was identical to SEQ ID NO.2. Figure 7The sequencing reads of the samples containing S. suaveolens can completely cover the sequence of SEQ ID NO. 3 and generate the same consistent sequence as SEQ ID NO. 3. In contrast, the sequencing reads of each of the other species cannot completely cover the other sequences and cannot generate the same consistent sequence. Figure 8 It is shown that the molecular marker developed in the present application has very high specificity between the three species.
[0038] Example 4 Identification of the differences between the three species of the genus Eupatorium and other species of the genus Eupatorium The second-generation sequencing data of 27 species of the genus Eupatorium (Table 1) were downloaded from the NCBI database, and the mixed second-generation sequencing reads of the 27 species of the genus Eupatorium were aligned to SEQ ID NO. 1-3 using Geneious software.
[0039] Table 1 List of 27 species of the genus Eupatorium The results are shown in Figure 9 These species cannot completely cover SEQ ID NO. 1-3 and generate the same consistent sequence as the reference sequence, wherein Figure 9 A is the result of alignment to SEQ ID NO. 2, Figure 9 B is the result of alignment to SEQ ID NO. 3, and no consistent sequence can be generated on SEQ ID NO. 1, so it is not shown. This shows that the molecular marker developed in the present application can not only identify S. suaveolens, S. chinense and S. odoratum, but also can identify these three species of the genus Eupatorium from other species of the genus Eupatorium.
[0040] In summary, first of all, the present application is a powerful supplement to traditional species identification, which can realize automation and standardization, break through the excessive dependence on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a short time.
[0041] According to the disclosure and teaching of the above description, those skilled in the art of the present application can also make appropriate changes and modifications to the above embodiments. Therefore, the present application is not limited to the specific embodiments disclosed and described above, and some modifications and changes of the present application should fall within the protection scope of the claims of the present application. In addition, although some specific terms are used in the present specification, these terms are only for convenience of explanation and do not constitute any limitation on the present application.
Claims
1. A molecular marker for identifying plants of the genus Erodium, characterized in that, The molecular marker comprises at least one of three molecular markers, and nucleotide sequences of the three molecular markers are respectively shown in SEQ ID NO. 1~SEQ ID NO. 3, wherein SEQ ID NO. 1 is a molecular marker corresponding to S. sumatrensis, SEQ ID NO. 2 is a molecular marker corresponding to P. minor, and SEQ ID NO. 3 is a molecular marker corresponding to P. odoratum.
2. A method for identifying or aiding in the identification of a target plant of the genus Erodium, characterized in that, The method comprises the following steps: 1) collecting a plant of the genus Pteridium as a sample to be detected; 2) extracting total DNA of the sample to be detected; 3) performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) assembling the sequencing data, and aligning contigs obtained by assembly with the molecular marker of claim 1; 5) performing sequence alignment of contigs that can completely cover the molecular marker of claim 1 and have the highest consistency with the molecular marker of claim 1, and judging what target plant of the genus Pteridium the sample contains according to the alignment result; if the sequence is consistent with the sequence of the molecular marker of claim 1, it is judged that the species of the sample to be detected contains the target plant of the genus Pteridium corresponding to the molecular marker, and the target plant of the genus Pteridium is distinguished from other plants of the genus Pteridium.
3. A method for identifying or aiding in the identification of a target plant of the genus Erodium, characterized in that, The method comprises the following steps: 1) collecting a plant of the genus Pteridium as a sample to be detected; 2) extracting total DNA of the sample to be detected; 3) performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) aligning the sequencing reads to a DNA barcode, and the DNA barcode is any one of the molecular markers of claim 1; 5) judging the species of the sample according to the coverage of the sequencing reads on the DNA barcode; if the sequencing reads can completely cover the DNA barcode and generate a consistent sequence identical to the DNA barcode, it is judged that the species of the sample to be detected contains the target plant of the genus Pteridium corresponding to the DNA barcode, and the target plant of the genus Pteridium is distinguished from other plants of the genus Pteridium.
4. The method for identifying or aiding in the identification of a target plant of the genus Erodium according to claim 3, characterized in that, If the sequencing reads of multiple samples are grouped and mixed in step 4), further comprising step 6) grouping the samples containing the target plant of the genus Pteridium into two groups, respectively mixing the sequencing reads of the samples in each group, and repeating the above steps 4)-5) until the target plant of the genus Pteridium of the individual sample is identified.
5. The method for identifying or aiding in the identification of a plant of the genus Centaurea according to any one of claims 2 to 4, characterized in that, The high-throughput sequencing in step 3) is second-generation sequencing or third-generation sequencing.
6. The method for identifying or aiding in the identification of a plant of the genus Centaurea according to any one of claims 3 to 4, characterized in that, In step 4), any one of Geneious, Bowtie, Tophat or HISAT is used for reads alignment.
7. Use of the molecular marker of claim 1 as a reference sequence for identifying or assisting in identifying a plant of the genus Pteridium.