Application of KASP marker of wheat ethylene response factor ERF gene in assisting wheat high-grain-per-ear breeding

Abstract

The invention discloses application of a KASP marker of a wheat ethylene response factor ERF gene in assisting wheat high-grain-per-ear breeding, and relates to the technical field of molecular marker-assisted breeding. The nucleotide sequence of the KASP marker is as shown in SEQ ID NO.4, and an SNP (Single Nucleotide Polymorphism) site exists at the 24th basic group of the KASP marker and is C / A mutation. The KASP marker can be used for distinguishing and / or identifying the haplotype of the TraesCS3A02G041200 gene of the wheat variety with any tissue at any period, so that the wheat variety with high grain number per ear can be quickly screened. The KASP detection method provided by the invention is convenient and rapid, is not limited by conditions such as weather and environment, is high in accuracy, can be further used for screening and identifying phenotypic characters of the grain number per ear of the wheat variety, and provides important technical support for assisted breeding of the wheat variety with high grain number per ear.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of molecular marker assisted breeding, and in particular to a KASP marker of a wheat ethylene response factor ERF The application relates to the technical field of molecular marker assisted breeding, and in particular to a KASP marker of a wheat ethylene response factor BACKGROUND

[0002] Wheat spike grain number is significantly positively correlated with wheat yield, is a component with greater genetic potential and wider breeding improvement space among three core elements of yield, and is one of the traits for which breakthroughs in wheat breeding have been achieved the fastest in recent years. Under the premise that the number of spikes and the thousand-grain weight remain at reasonable levels, increasing the number of grains per spike is a key path to realizing wheat yield increase. Therefore, developing more molecular markers for assisting in wheat high-spike-grain breeding is of great significance for promoting the progress of breeding technology.

[0003] Molecular marker assisted breeding technology has become an important technical means in the field of crop breeding due to its advantages of high precision, short screening period and being free from environmental conditions. As specific DNA fragments that are closely linked to target traits and can be stably inherited, molecular markers can quickly and accurately reflect genetic differences between varieties and provide reliable basis for early screening of target traits. In wheat breeding, molecular markers related to spike grain number can realize directional selection of high-spike-grain traits, effectively avoid the lag and environmental sensitivity problems in traditional breeding which rely on phenotypic identification, and significantly improve breeding efficiency and selection accuracy.

[0004] At present, some molecular markers related to wheat spike grain number have been reported, but most of the markers have technical defects such as low detection efficiency, weak specificity, and loose linkage with target traits, which cannot meet the needs of actual breeding work, and more stable, reliable, efficient and practical molecular marker resources need to be explored.

[0005] The ethylene response factor (ERF) gene family as a plant-specific transcription factor family plays an important role in regulating physiological processes such as plant growth and development and stress response. Studies have shown that some members of the family are involved in the regulation of crop yield-related traits. Therefore, further exploration of functional sites in wheat ERF genes related to spike grain number and development of efficient and specific molecular markers have important theoretical value and practical significance for enriching the molecular tool library for wheat high-spike-grain breeding and accelerating the process of high-yield variety breeding, and provide a new way to solve the technical bottleneck of spike grain number improvement in current wheat breeding. SUMMARY

[0006] The application aims to provide a KASP marker of a wheat ethylene response factor ERFThe KASP marker of the gene is applied in assisted breeding of high spike grain number of wheat to solve the problems in the prior art.

[0007] To achieve the above object, the present application provides the following scheme: The present application provides a KASP marker related to the spike grain number of wheat, the nucleotide sequence of which is shown in SEQ ID NO. 4, and a SNP site exists at the 24th base of the KASP marker, which is a C / A mutation.

[0008] The present application also provides a KASP primer combination for identifying the spike grain number trait of wheat, which comprises an upstream primer F1 with the nucleotide sequence shown in SEQ ID NO. 5, an upstream primer F2 with the nucleotide sequence shown in SEQ ID NO. 6, and a universal downstream primer R with the nucleotide sequence shown in SEQ ID NO. 7.

[0009] Further, the upstream primer F1 and the upstream primer F2 are labeled with different fluorescent groups.

[0010] Further, the upstream primer F1 is labeled with a HEX fluorescent group, and the upstream primer F2 is labeled with a FAM fluorescent group.

[0011] The present application also provides the use of the above-mentioned KASP primer combination in the preparation of a detection product for identifying the spike grain number trait of wheat.

[0012] Further, the detection product is a kit.

[0013] The present application also provides a detection product for identifying the spike grain number trait of wheat, which comprises the above-mentioned KASP primer combination.

[0014] Further, the detection product is a kit.

[0015] The present application also provides the use of the above-mentioned KASP marker, KASP primer combination or detection product in the assisted breeding of high spike grain number of wheat, and the spike grain number of CC genotype wheat is greater than that of AA genotype wheat.

[0016] The present application also provides a method for identifying the spike grain number trait of wheat, comprising the following steps: Genomic DNA of a to-be-tested wheat sample is extracted; The genomic DNA is used as a template, and the above-mentioned KASP primer combination is used for PCR amplification, and the trait is identified according to the detection result: the spike grain number of CC genotype wheat is greater than that of AA genotype wheat.

[0017] The present application discloses the following technical effects: The present application is TraesCS3A02G041200 A SNP site related to the spike grain number of wheat is screened in the gene, and a KASP marker is developed based on the SNP site, which is used for detecting single nucleotide polymorphism, and the KASP marker can be used for distinguishing and / or identifying the haplotype of the gene of any wheat variety at any period and any tissue, so that the wheat variety with high spike grain number is quickly screened. TraesCS3A02G041200

[0018] The KASP detection method provided by the present application is convenient and fast, is not limited by weather and environmental conditions, and is high in accuracy, and can be used for screening and identifying the phenotypic traits of the spike grain number of the wheat variety, and provides important technical support for the assisted breeding of the wheat variety with high spike grain number. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0020] Figure 1 Figure 2 is a genotyping diagram of the wheat F2 separation population in Example 2; Figure 2 Figure 3 is a genotyping diagram of part of the wheat varieties in Example 3; Figure 3 Figure 4 is a correlation analysis diagram of the spike grain number of the wheat variety and the haplotype of the gene. DETAILED DESCRIPTION

[0021] The various exemplary embodiments of the present application will be described in detail below, and the detailed description should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0022] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between the intermediate values in any stated value or range, and any other stated value or intermediate value in the range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0023] ​Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Example 1 Based on the reference genome version of the Chinese Spring genome database (Chinese Spring RefSeq v1.1, database link: http: / / plants.ensembl.org / Triticum_aestivum / Info / Index), targeting TraesCS3A02G041200 For the gene coding region, specific primers TraesCS3A02G041200-F / R were designed (primer sequences are detailed in Table 1). Using cDNA from mainstream wheat cultivars as templates, PCR amplification was performed using the above specific primers. The amplified gene coding sequence was sequenced, and sequence alignment analysis was performed. The results were... TraesCS3A02G041200 A SNP site associated with the number of grains per ear of wheat was found in the gene (nucleotide sequence shown in SEQ ID NO.1), located at the 689th base of the gene, which is a C / A mutation.

[0027] Table 1. Used for amplification TraesCS3A02G041200 Primer sequences for gene coding regions SEQ ID NO.1:

[0028] Based on the above SNP sites, KASP markers and primers for KASP detection were developed. The primer sequences are detailed in Table 2. The nucleotide sequence of the KASP marker is shown in SEQ ID NO.4. An SNP site exists at the 24th base, which is a C / A mutation.

[0029] SEQ ID NO.4: TGTCCTGGAAGCTACCAAGCCAGMAGCTGAGTCCCTGTCGCCTGAGCCGACTCCAGTCCCTGTGATGGTGTCCACA, where M is A or C.

[0030] Table 2 KASP detection primers Note: F1 is labeled with the HEX fluorescent group, and F2 is labeled with the FAM fluorescent group.

[0031] Example 2 Genotyping of the wheat F2 segregating population was performed using the KASP markers from Example 1. The parents of the F2 population were Xianmai 686 (Hap1, corresponding to CC genotype) and Cunmai 20 (Hap2, corresponding to AA genotype).

[0032] The genotyping method is as follows: (1) DNA extraction Wheat genomic DNA was extracted using the conventional CTAB method.

[0033] (2) Genotyping Using the extracted wheat genomic DNA as a template, PCR amplification was performed using the KASP detection primers shown in Table 2.

[0034] The reaction system consisted of 1 μL DNA template, 5 μL 2× Probe Mix premix (Beijing Jiacheng Biotechnology Co., Ltd.), 0.2 μL each of upstream and downstream primers, and sterile water to a final volume of 10 μL.

[0035] The reaction program was as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s, 63℃ annealing and extension for 40 s, for 9 cycles; 95℃ denaturation for 20 s, 57℃ annealing and extension for 40 s, for 31 cycles.

[0036] Genotyping results of the wheat F2 segregating population are as follows Figure 1As shown, the Hap1 haplotype exhibits a blue fluorescent signal (corresponding to the CC genotype), the Hap2 haplotype exhibits an orange fluorescent signal (corresponding to the AA genotype), and the heterozygous haplotype exhibits a gray fluorescent signal (corresponding to the CA genotype). Homozygous and heterozygous plants of the two genotypes can be clearly distinguished.

[0037] Example 3 Phenotypic identification of ear grain number was performed on 399 major wheat varieties in the Huang-Huai wheat region, and genotyping was performed using the KASP markers designed in Example 1, following the same method as in Example 2. The results are shown in Table 4, and the genotyping results of some varieties are shown in Table 4. Figure 2 .

[0038] Statistical analysis revealed that the average number of grains per ear in varieties containing TraesCS3A02G041200-Hap1 (corresponding to the CC genotype) (55.59 grains per ear for 295 varieties) was significantly higher than that in varieties containing TraesCS3A02G041200-Hap2 (corresponding to the AA genotype) (53.35 grains per ear for 104 varieties), indicating that varieties containing TraesCS3A02G041200-Hap1 had a higher number of grains per ear.

[0039] Correlation analysis of wheat varieties with grain number per spike and haplotype yielded the following conclusion: TraesCS3A02G041200-Hap1 type varieties have a higher grain number per spike. Figure 3 The molecular markers of this invention can identify haplotypes of TraesCS3A02G041200 in wheat varieties, assisting in the screening of wheat varieties with different haplotypes and high grain number per spike. This detection method is convenient, fast, and highly accurate, providing important technical support for the assisted breeding of wheat varieties with high grain number per spike.

[0040] Table 4 399 wheat varieties TraesCS3A02G041200 Gene haplotype statistics table The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A KASP marker associated with wheat spike grain number, characterized in that, The nucleotide sequence is shown as SEQ ID NO. 4, and there is a SNP site at the 24th base of the KASP marker, which is a C / A mutation.

2. A KASP primer combination for use in identifying the wheat spike grain number trait, characterised in that, The KASP primer combination comprises an upstream primer F1 with a nucleotide sequence shown as SEQ ID NO. 5, an upstream primer F2 with a nucleotide sequence shown as SEQ ID NO. 6, and a universal downstream primer R with a nucleotide sequence shown as SEQ ID NO.

7.

3. The KASP primer combination according to claim 2, wherein, The upstream primer F1 and the upstream primer F2 label different fluorescent groups.

4. The KASP primer combination according to claim 3, wherein, The upstream primer F1 labels a HEX fluorescent group, and the upstream primer F2 labels a FAM fluorescent group.

5. Use of the KASP primer combination according to any one of claims 2-4 in the preparation of a detection product for identifying the wheat ear grain number trait.

6. Use according to claim 5, characterized in that, The detection product is a kit.

7. An assay product for discriminating the wheat spike grain number trait, characterized in that, The KASP primer combination according to any one of claims 2-4.

8. The test product of claim 7, wherein, The detection product is a kit.

9. Use of a KASP marker according to claim 1, a KASP primer combination according to any one of claims 2 to 4 or a detection product according to claim 7 or 8 in assisting wheat high spike grain number breeding, characterised in that, The ear grain number of the CC genotype wheat is greater than that of the AA genotype wheat.

10. A method of identifying a wheat ear grain number trait, characterized in that, The method comprises the following steps: Genomic DNA of the wheat sample to be detected is extracted; PCR amplification is performed on the genomic DNA as a template by using the KASP primer combination according to any one of claims 2-4, and the trait is identified according to the detection result: the ear grain number of the CC genotype wheat is greater than that of the AA genotype wheat.

Images