Imidazopyrazine heterocyclic compound and application thereof

Abstract

The invention provides an imidazopyrazine heterocyclic compound and an application of the imidazopyrazine heterocyclic compound. The imidazo piperazine heterocyclic compound provided by the invention inhibits the activation of an NLRP3 inflammasome complex through targeted degradation of NEK7 so as to regulate the secretion of IL-1beta and IL-18, thereby being capable of preventing and / or treating IL-1beta and IL-18 mediated related diseases, including inflammation, tumor and the like.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to imidazopiperazine heterocyclic compounds and their uses. Background Technology

[0002] Inflammatory bodies are multi-protein complexes whose activation plays a central role in innate immunity and inflammation. To date, four inflammatory bodies have been reported: NLRP1, NLRC4, NLRP3, and AIM2. The NLRP3 inflammatory body is composed of NLRP3, a member of the nucleotide-binding oligomerization domain-like receptor (NLR) family, the adaptor protein apoptosis-associated speckle-like protein (ASC), and the effector protein caspase-1. Its activation leads to the activation of caspase-1, thereby promoting the secretion of IL-1β and IL-18, which are inflammatory cytokines mediating various autoimmune diseases, myocardial infarction, metabolic syndrome, inflammatory bowel disease, and macrophage activation syndrome in animal disease models. Therefore, targeting the NLRP3 inflammatory body could be an effective treatment for IL-1β and IL-18-mediated diseases.

[0003] Currently, the main targeting methods for the NLRP3 inflammasome are aimed at NLRP3, one of its core proteins, and there are already a large number of NLRP3 inhibitors, such as MCC950 (Nat Med. 2015, 21(3):248-55) and its sulfonylurea analogs such as MCC7840 (WO2016131098), compound 102 (WO2020010118), and compound N14 (J Med Chem 2023, 66(18):12966–12989); as well as non-MCC950 analogs, such as compound 23 (WO2024064245A1) and compound II-8 (J Med Chem 2024, 67(12):9869-9895). Among them, inhibitors such as MCC950 have entered clinical trials, but were terminated due to liver toxicity. In addition, studies have shown that when the NLRP3 protein is acted upon by small molecule inhibitors, the NLRP3 inflammasome is completely inactivated, which eventually leads to a decrease in the body's immunity (Viruses 2023, 15(6), 1339). Therefore, direct targeting of the NLRP3 protein may pose safety concerns.

[0004] NEK7, a member of the NIMA-associated kinases (NEKs) family, is a serine / threonine kinase crucial for mitotic entry, cell cycle progression, cell division, and mitotic processes. It is expressed in various tissues, including the brain, heart, lungs, liver, and spleen. Overexpression of NEK7 induces the production of abnormal cells, which are closely linked to tumors such as retinoblastoma, gallbladder cancer, and head and neck cancer. Recent studies have shown that NEK7 acts as a scaffold protein for the NLRP3 inflammasome, promoting the formation of the NLRP3-ASC complex, ASC oligomerization, and Caspase-1 activation through a non-kinase-dependent binding to the leucine-rich repeat series of NLRP3, ultimately activating the NLRP3 inflammasome. Therefore, targeting NEK7 can inhibit the activation of the NLRP3 inflammasome without affecting the NLRP3 protein itself, allowing the body to maintain immunity. This approach overcomes the limitations of NLRP3 inhibitors and is considered a safer method.

[0005] Currently, in the development of drugs targeting the NEK7 protein, Halia Therapeutics has developed NEK7 kinase inhibitors, including HT-6153, HT-6184, HT-6258, HT-6283, and HT-6515, to affect NLRP3 inflammasome activity for the treatment of inflammatory diseases. However, mechanistically, the activation of the NLRP3 inflammasome partially depends on NEK7 non-kinase activity; therefore, the efficacy of these inhibitors may be limited.

[0006] Compared to inhibitors, degraders can be administered at lower doses, thus reducing side effects, but there is a lack of NEK7 protein degraders on the market. Summary of the Invention

[0007] This invention provides an imidazopiperazine heterocyclic compound and its use. This imidazopiperazine heterocyclic compound can target and degrade NEK7 and inhibit the activation of the NLRP3 inflammasome, thereby avoiding the activation of Caspase-1 and thus avoiding the increase in the levels of cytokines IL-1β and IL-18. It can be used to treat IL-1β and IL-18-mediated diseases.

[0008] The first aspect of this invention provides an imidazopiperazine heterocyclic compound having the structure shown in formula (I):

[0009]

[0010] in:

[0011] X represents carbonyl or methylene;

[0012] W represents H or methyl;

[0013] R represents one or more of H, -CO-Y, and -CH2-Y;

[0014] Y represents one or more of the following: substituted or unsubstituted cyclic hydrocarbon group, saturated heterocyclic group, and aromatic group;

[0015] The number of substituents in Y ranges from 0 to 4, and the types of substituents may be the same or different.

[0016] In some embodiments of the present invention, the cyclic hydrocarbon group is a cycloalkane having 3 to 7 carbon atoms; and / or, the saturated heterocyclic group is a saturated five- to seven-membered ring group having 1 or 2 heteroatoms, wherein the heteroatoms are one or more of O, N, and S; and / or, the aromatic group is one or more of phenyl, heteroaryl, and fused-ring aryl.

[0017] In some embodiments of the present invention, the saturated heterocyclic group is an epoxide alkyl or a cyclonitroxide alkyl; and / or, the heteroaryl group is an unsaturated five- or six-membered ring having one or two heteroatoms; the heteroatoms are one or more of O, N, and S; and / or, the fused-ring aryl group includes one or more of fused-ring alkylphenyl, fused-ring heteroaryl, fused-ring heterophenyl, fused-ring heteroaryl, benzo[a]aryl, fused-ring alkylnaphthyl, fused-ring heteronaphthyl, fused-ring alkylanthrayl, and fused-ring heteroanthrayl.

[0018] In some embodiments of the present invention, the saturated heterocyclic group is one or more of epoxypentyl, cyclothiopentyl, p-thionitrohexane, and p-oxynitrohexane; and / or, the heteroaryl group is one or more of pyrrole, thiophene, furanyl, thiazolyl, pyrazolyl, imidazole, pyridinyl, pyrazinyl, oxazolyl, and pyrimidinyl; and / or, the fused-ring aryl group is one or more of benzopyrazinyl, naphthyl, pyridylpyrrole, benzimidazolyl, benzo-p-oxyhexane, and imidazole-p-nitrohexane.

[0019] In some embodiments of the present invention, the substituent of Y is one or more of a halogen atom, a cyano group, or a substituted or unsubstituted Z group; and / or, the Z group is one of a lower alkyl group, a lower alkoxy group, a saturated heterocyclic group, a phenoxy group, a benzoxy group, an aniline group, a heteroaryl group, or a phenyl group; and / or, the number of substituents in the Z group is 0 to 4, and each substituent is independently selected from a halogen atom, a cyano group, an alkyl group, and an alkoxy group; and / or, the lower alkyl group and / or the lower alkoxy group has 1 to 6 carbon atoms.

[0020] In some embodiments of the present invention, the imidazopiperazine heterocyclic compound includes at least one of the compounds shown in Table 1:

[0021] Table 1

[0022]

[0023]

[0024]

[0025] A second aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of one or more of the above-mentioned imidazopiperazine heterocyclic compounds or pharmaceutically acceptable salts, enantiomers, stereoisomers, solvates, deuterates, and polymorphs thereof.

[0026] A third aspect of the present invention provides the use of the above-mentioned imidazopiperazine cyclic compounds in the preparation of medicaments for the prevention and / or treatment of diseases related to the NEK7 protein.

[0027] The fourth aspect of the present invention provides the use of the above-mentioned imidazopiperazine heterocyclic compounds in the preparation of medicaments for the prevention and / or treatment of diseases related to NLRP3 inflammasomes.

[0028] A fifth aspect of this invention provides the use of the above-described imidazopiperazine heterocyclic compounds in the preparation of medicaments for the prevention and / or treatment of IL-1β and / or IL-18-mediated diseases. IL-1β and / or IL-18-mediated diseases include inflammatory diseases and / or tumors.

[0029] Compared with the prior art, the present invention has at least the following beneficial effects:

[0030] Experiments show that the compounds provided by this invention can target and degrade NEK7, inhibit the activation of NLRP3 inflammasome and Caspase-1, and have a significant downregulation effect on the levels of cytokines IL-1β and IL-18, and are expected to participate in the treatment or prevention of IL-1β and / or IL-18-mediated diseases. Attached Figure Description

[0031] Figure 1 Experiments on the promotion of NEK7 protein degradation in Molt-4 cells by LC-03-052 and LC-04-045.

[0032] Figure 2 The release level of IL-18 in hPBMC cells after treatment with MCC950 and LC-04-045.

[0033] Figure 3 IL-1β release levels in hPBMC cells after treatment with MCC950 and LC-04-045. Detailed Implementation

[0034] The present invention will now be described in detail through embodiments, but this does not imply any adverse limitations on the present invention.

[0035] For the NLRP3 inflammasome, inhibitors such as MCC950 have entered clinical trials, but these trials were terminated due to liver toxicity. This may be because NLRP3 is completely inactivated by small-molecule inhibitors, ultimately leading to a decrease in the body's immunity; therefore, directly targeting NLRP3 poses a safety risk. In addition, NEK7, as a scaffold protein, is an important component of the NLRP3 inflammasome. NEK7 binds to NLRP3 in a non-kinase manner, meaning it does not function as a kinase in the NLRP3 inflammasome. This invention develops a series of imidazopiperazine heterocyclic compounds that can target and degrade NEK7 protein kinase to address diseases related to the NLRP3 inflammasome. These compounds can target and degrade, rather than inhibit, NEK7, thus avoiding the risk of infection.

[0036] The imidazopiperazine heterocyclic compounds provided by this invention have the structure shown in formula (I):

[0037]

[0038] in:

[0039] X represents carbonyl or methylene;

[0040] W represents H or methyl;

[0041] R represents one or more of H, -CO-Y, and -CH2-Y;

[0042] Y represents one or more of the following: substituted or unsubstituted cyclic hydrocarbon group, saturated heterocyclic group, and aromatic group;

[0043] The number of substituents in Y ranges from 0 to 4, and the types of substituents may be the same or different.

[0044] The imidazopiperazine heterocyclic compounds with the structure shown in formula (I) provided by this invention can degrade NEK7 protein with high activity and high selectivity, and inhibit the secretion of IL-1β and IL-18, and can be used to treat inflammatory diseases and tumors related to NEK7 protein function.

[0045] In some embodiments of the present invention, the cyclic hydrocarbon group is a cycloalkane having 3 to 7 carbon atoms; and / or, the saturated heterocyclic group is a saturated five- to seven-membered ring group having 1 or 2 heteroatoms, wherein the heteroatoms are one or more of O, N, and S; and / or, the aromatic group is one or more of phenyl, heteroaryl, and fused-ring aryl.

[0046] In this invention, the term "cyclic hydrocarbon group" refers to a group whose atoms connected to the main chain are located on a "cyclic hydrocarbon ring." A "cyclic hydrocarbon ring" refers to an alicyclic hydrocarbon having one or two degrees of unsaturation, consisting of a cyclic carbon chain of 3 to 7 carbon atoms, and optionally substituted with substituents selected from the following groups: lower alkyl, lower alkoxy, lower alkylthioalkyl, hydroxyl, cyano, halogen atom, haloalkyl; the number of substituents is one or more; "cyclic hydrocarbon group" includes, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, etc.

[0047] In this invention, the term "saturated heterocyclic group" refers to a group whose atom connected to the main chain is located on a "saturated heterocycle." A "saturated heterocycle" refers to a saturated ring composed of multiple methylene groups and at least one heteroatom, where the heteroatom is selected from one or two of O, N, and S. When a "saturated heterocycle" contains two heteroatoms, these two heteroatoms are located in the ortho or para position and may be of the same or different types. Any hydrogen atom on the "saturated heterocycle" can be substituted by a substituent selected from the following groups: lower alkyl, lower alkoxy, lower alkylthioalkyl, hydroxyl, cyano, halogen atom, haloalkyl; the number of substituents can be one or more. In this invention, the "saturated heterocyclic group" is one or more of epoxypentyl, epthiopentyl, p-thionitrohexacyclic, and p-oxynitrohexacyclic; the atom connected to the main chain of the "saturated heterocyclic group" is a carbon atom or a heteroatom.

[0048] In this invention, the term "aromatic group" refers to a group containing a benzene ring or a heteroaromatic ring, including phenyl, heteroaromatic, and fused-ring aryl groups.

[0049] In this invention, the term "phenyl" refers to an aromatic group whose atoms connected to the main chain are located on a non-fused, independent benzene ring.

[0050] In this invention, the term "heteroaryl" refers to a group whose atom connected to the main chain is located on a heteroaryl ring. The term "heteroaryl ring" refers to a conjugated five-membered or six-membered ring containing heteroatoms such as O, N, and S. The number of heteroatoms in the "heteroaryl ring" is one or two, and the types of heteroatoms may be the same or different. Any hydrogen atom on the "heteroaryl ring" can be substituted by a substituent selected from the following groups: lower alkyl, lower alkoxy, lower alkylthioalkyl, hydroxyl, cyano, halogen atom, and haloalkyl; the number of substituents can be one or more. In this invention, "heteroaryl" is one or more of pyrroleyl, thiopheneyl, furanyl, thiazolyl, pyrazolyl, imidazolyl, pyridinyl, pyrazinyl, oxazolyl, and pyrimidinyl, and the atom connected to the main chain is a carbon atom on the heteroaryl ring.

[0051] The term "fused-ring aryl" in this invention refers to a group that shares two atoms with a heteroaromatic ring or benzene ring and a benzene ring, heteroaromatic ring, saturated heterocycle, or saturated alkane ring. Fused-ring aryl groups include fused-ring alkylphenyl, fused-ring heteroaryl, fused-ring heterophenyl, fused-ring heteroaryl, benzo[a]heteroaryl, heteroaryl[a]heteroaryl, fused-ring alkylnaphthyl, fused-ring heteroarylnaphthyl, fused-ring alkylanthyl, fused-ring heteroaryl anthryl, naphthyl, anthryl, etc. Further, benzo[a]heteroaryl is preferably benzo[pyrazinyl] (also known as quinoxaline) or benzo[imidazolyl] (also known as indole), heteroaryl[a]heteroaryl is pyridyl[a]pyrroleyl; fused-ring heterophenyl is benzo[p]oxohexacycloyl; fused-ring heteroaryl is imidazol[p]nitrohexacycloyl. When the "fused-ring aryl" is a fused-ring alkyl phenyl, a fused-ring heteroaryl, a fused-ring heteroaryl phenyl, a fused-ring heteroaryl heteroaryl, a fused-ring alkyl naphthyl, a fused-ring heteroaryl naphthyl, a fused-ring alkyl anthracel, or a fused-ring heteroaryl anthracel, the atom connected to the "fused-ring aryl" and the main chain is located on the benzene ring or a heteroaryl ring. When the "fused-ring aryl" is a benzo[a]heteroaryl, the atom connected to the "fused-ring aryl" and the main chain is located on the benzene ring, and the atom connected to the "fused-ring aryl" and the main chain is a carbon atom or a heteroatom.

[0052] Individual enantiomers of compounds represented by formula (I) above, as well as any racemic mixtures of all or part thereof, are also included within the scope of protection of this invention. This invention also includes mixtures of individual enantiomers of compounds represented by formula (I) above with diastereomers of one or more of them whose stereocenters have been inverted.

[0053] The pharmaceutical composition provided by the present invention comprises a therapeutically effective amount of one or more of the above-mentioned imidazopiperazine heterocyclic compounds or their pharmaceutically acceptable salts, enantiomers, stereoisomers, solvates, deuterates, and polymorphs.

[0054] The pharmaceutical compositions provided in some embodiments of the present invention further comprise one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0055] The pharmaceutical compositions provided in some embodiments of the present invention further comprise one or more therapeutic agents.

[0056] The term "therapeutic effective amount" in this invention refers to the amount of drug or pharmaceutical reagent that can elicit a desired therapeutic response in animals or humans.

[0057] This compound can act as a protein degrader, particularly as a degrader of NEK7 protein kinase. Compared with small molecule inhibitors targeting the NLRP3 inflammasome, this class of heterocyclic compounds can avoid the complete inactivation of the NLRP3 inflammasome, thereby avoiding the risk of infection. It is known that NEK7 binds to the NLRP3 inflammasome in a non-kinase-dependent manner, and NEK7 cannot exert the activity of a traditional protein kinase. As a protein degrader, this class of heterocyclic compounds can target and degrade rather than inhibit NEK7 and render it inactive.

[0058] This invention provides the use of the above-mentioned imidazopiperazine heterocyclic compounds in the preparation of medicaments for the prevention and / or treatment of NEK7 protein-related diseases. Applications in the biological mechanisms of targeted degradation of NEK7 kinase protein include NEK7-NLRP3-mediated diseases such as gout, atherosclerosis, type 2 diabetes, metabolic syndrome, macular degeneration, Alzheimer's disease, multiple sclerosis, and inflammatory bowel disease, as well as NEK7-related tumors such as retinoblastoma, gallbladder cancer, and head and neck cancer. The imidazopiperazine heterocyclic compounds of this invention can degrade NEK7 protein with high activity and selectivity, inhibiting the secretion of IL-1β and IL-18, and can be used to treat inflammatory diseases and tumors related to NEK7 protein function.

[0059] This invention provides the use of the above-mentioned imidazopiperazine heterocyclic compounds in the preparation of medicaments for the prevention and / or treatment of diseases related to NLRP3 inflammasomes.

[0060] The present invention provides the use of the above-mentioned imidazopiperazine heterocyclic compounds in the preparation of medicaments for the prevention and / or treatment of IL-1β and / or IL-18-mediated related diseases.

[0061] The present disclosure can be further understood through the following non-limiting examples. For all the following examples, standard processing and purification methods known to those skilled in the art can be used. The synthetic methods described herein are intended to illustrate applicable chemical methods through the use of specific examples and do not indicate the scope of this disclosure.

[0062] The intermediate biphenylaldehyde derivative and 2'-chloro-[1,1'-biphenyl]-2-carboxylic acid used in the following examples were synthesized using the following method:

[0063] (I) Synthesis of biphenylaldehyde derivatives:

[0064] Synthetic Method A: The halogenated substrate (1 eq) and aromatic boric acid (1.2 eq) were dissolved in ethanol, and Na₂CO₃ (1 eq) and Pd(AcO)₂ (0.1 eq) were added to the solution. The reaction system was stirred at room temperature for 12 h under nitrogen protection. The reaction was monitored by thin-layer chromatography. The solid was removed by filtration with diatomaceous earth, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the intermediate biphenylaldehyde derivative.

[0065] Synthetic Method B: The halogenated substrate (1 eq) and aromatic boric acid (1.2 eq) were dissolved in a mixed solvent of ethanol and water. Na₂CO₃ (1.2 eq), PPh₃ (0.1 eq), and Pd(PPh₃)₂Cl₂ (0.05 eq) were added to the solution. Under nitrogen protection, the reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction was detected by thin-layer chromatography, and the mixture was cooled to room temperature. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the two organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the intermediate biphenylaldehyde derivative.

[0066] Synthetic Method C: The halogenated substrate (1 eq) and aromatic boric acid (1.05 eq) were dissolved in a mixed solvent of ethanol or methanol, toluene, and aqueous Na₂CO₃. Pd(PPh₃)₄ (0.05 eq) was added to the solvent. Under nitrogen protection, the reaction solution was heated to 90 °C and stirred for 6 hours. The reaction was detected by thin-layer chromatography, and the reaction solution was cooled to room temperature. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the intermediate biphenylaldehyde derivative.

[0067] Synthetic Method D: The halogenated substrate (1 eq) and aromatic boric acid (1.2 eq) were dissolved in a mixed solvent of ethanol, ethylene glycol dimethyl ether, and aqueous Na₂CO₃ solution. Pd(PPh₃)₂Cl₂ (0.05 eq) was added to the solvent. Under nitrogen protection, the reaction mixture was heated to 50°C and stirred for 1 hour. The reaction was detected by thin-layer chromatography, and the mixture was cooled to room temperature. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the intermediate biphenylaldehyde derivative.

[0068] Synthetic Method E: The halogenated substrate (1 eq) and aromatic boric acid (1.2 eq) were dissolved in a mixed solvent of 1,4-dioxane and water. KF (3 eq) and Pd(PPh3)4 (0.05 eq) were added to the solvent. Under nitrogen protection, the reaction solution was heated to 100 °C and stirred for 12 hours. The reaction was detected by thin-layer chromatography, and the reaction solution was cooled to room temperature. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the intermediate biphenylaldehyde derivative.

[0069] Synthetic Method F: 2-Fluorobenzaldehyde (1 eq) was dissolved in DMF solvent, and K2CO3 (1.5 eq) and (S)-3-methylmorpholine (1.5 eq) were added to the solvent. The reaction solution was heated to 150 °C and stirred for 20 hours. The reaction was detected by thin-layer chromatography, and the reaction solution was cooled to room temperature. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the intermediate aromatic aldehyde derivative.

[0070] Table 2. Substrates and synthetic methods for synthesizing different intermediate biphenylaldehyde derivatives in this invention.

[0071]

[0072]

[0073] (II) Synthesis of intermediate 2'-chloro-[1,1'-biphenyl]-2-carboxylic acid:

[0074]

[0075] Step 1: Dissolve the halogenated substrate (1 eq) and aromatic boric acid (1.05 eq) in a mixed solvent of methanol, toluene, and Na₂CO₃ aqueous solution. Add Pd(PPh₃)₄ (0.05 eq) to the solvent. Under nitrogen protection, heat the reaction solution to 90°C and stir for 12 hours. Detect the completion of the reaction by thin-layer chromatography. Cool the reaction solution to room temperature. Add water to the reaction solution, extract with ethyl acetate, wash the organic phase with saturated brine, combine the organic phases, dry to anhydrous sodium sulfate, filter, and concentrate under reduced pressure. Purify the residue by silica gel column chromatography to obtain methyl 2'-chloro-[1,1'-biphenyl]-2-carboxylic acid.

[0076] Step 2: Dissolve biphenyl carboxylate (1 eq) in a mixed solvent of tetrahydrofuran, methanol, and water. Add lithium hydroxide (1 eq) to the solution at low temperature. Stir the reaction system at room temperature for 3 hours. LCMS analysis indicates the reaction is complete. Remove the organic solvent by vacuum concentration. Add citric acid to the remaining solution to adjust the pH to acidity, resulting in the precipitation of a white solid. Filter the solid, and concentrate the filter cake under vacuum to obtain 2'-chloro-[1,1'-biphenyl]-2-carboxylic acid.

[0077] Examples 1-53 provide a detailed description of the synthesis method of the target compound:

[0078] Example 1: Synthesis of (S)-3-(5-(7-([1,1'-biphenyl]-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-052)

[0079] Step 1: Synthesis of (S)-5-amino-4-(5-bromo-1-oxoisoindoline-2-yl)-5-oxovalerate tert-butyl ester (LC-01-151)

[0080] Methyl 4-bromo-2-bromomethylbenzoate (1.3 eq.) and (S)-4,5-diamino-5-oxovalerate tert-butyl hydrochloride (1 eq.) were dissolved in acetonitrile, and then N,N-diisopropylethylamine (3 eq.) was added. The reaction mixture was heated to 80 °C and stirred for 12 hours. The reaction was monitored by LC-MS to confirm completion, and the reaction mixture was cooled to room temperature. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give (S)-5-amino-4-(5-bromo-1-oxoisoindolin-2-yl)-5-oxovalerate tert-butyl ester as a white solid (14.52 g, yield 87.25%). LC-MS (ESI) C 17 H 22 BrN2O4 + [M+H] + Calculated values: 397.08 and 399.07; measured values: 397.11 and 399.12.

[0081] Step 2: Synthesis of (S)-5-amino-5-oxo-4-(1-oxo-5-(4,4,5,5-tetramethyl-1,3,2-dioxoboronyl-2-yl)isoindololin-2-yl)tert-butyl valerate (LC-01-156)

[0082] (S)-5-amino-4-(5-bromo-1-oxoisoindoline-2-yl)-5-oxovalerate tert-butyl ester (1 eq.) and pinacol diborate (1.5 eq.) were dissolved in 1,4-dioxane, and potassium acetate (3 eq.) was added. The mixture was purged three times with nitrogen, and Pd(dppf)Cl2 (0.03 eq.) was added. The mixture was then purged three more times with nitrogen. The reaction solution was heated to 100°C and stirred for 12 hours. The reaction was monitored for completion by LCMS, and the solution was cooled to room temperature. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give a white solid (S)-5-amino-5-oxo-4-(1-oxo-5-(4,4,5,5-tetramethyl-1,3,2-dioxoboronyl-2-yl)isoindololin-2-yl)tert-butyl valerate (14.83 g, yield 89.97%). LC-MS (ESI) C 23 H 34 BN2O6 + [M+H] + Calculated value: 445.25; Measured value: 445.30.

[0083] Step 3: Synthesis of (S)-3-(2-(1-amino-5-(tert-butoxy)-1,5-dioxapentan-2-yl)-1-oxoisoindoline-5-yl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylic acid tert-butyl ester (LC-03-038)

[0084] (S)-5-amino-5-oxo-4-(1-oxo-5-(4,4,5,5-tetramethyl-1,3,2-dioxoboronyl-2-yl)isoindololin-2-yl)tert-butyl valerate (1 eq.) and 3-bromo-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylic acid tert-butyl ester (1 eq.) were dissolved in 1,4-dioxane, and 2M sodium carbonate solution (2 eq.) was added. The mixture was purged three times with nitrogen, and Pd(PPh3)4 (0.04 eq.) was added. The mixture was then purged three more times with nitrogen. The reaction mixture was heated to 80°C and stirred for 12 hours. The reaction was monitored by LCMS until complete, and the mixture was cooled to room temperature. Water and ethyl acetate were added to the reaction mixture for extraction. The extraction was repeated three times until complete. The organic phases were washed with saturated brine, combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give a white solid (S)-3-(2-(1-amino-5-(tert-butoxy)-1,5-dioxapentan-2-yl)-1-oxoisoindoline-5-yl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylic acid tert-butyl ester (3.00 g, yield 80.96%). LC-MS (ESI) C28 H 38 N5O6 + [M+H] + Calculated value: 540.28; Measured value: 540.30. Step 4: Synthesis of (S)-3-(1-oxo-5-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-041)

[0085] (S)-3-(2-(1-amino-5-(tert-butoxy)-1,5-dioxapentan-2-yl)-1-oxoisoindoline-5-yl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylic acid tert-butyl ester (1 eq.) was dissolved in acetonitrile, and benzenesulfonic acid (3 eq.) was added. The reaction mixture was heated to 100°C and stirred for 12 hours. The reaction was monitored by LCMS until completion, and the reaction mixture was cooled to room temperature. The solvent was removed by vacuum concentration, and the residue was slurried with ethyl acetate and petroleum ether. Filtration yielded a white solid (S)-3-(1-oxo-5-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-3-yl)isoindoline-2-yl)piperidin-2,6-dione (2.00 g, yield 94.15%). 1 H NMR (400MHz, DMSO-d6) δ11.04(s,1H),7.87(d,J=8.0Hz,1H),7.80(s,1H),7.68( d,J=8.0Hz,1H),7.63(s,1H),5.16(dd,J=12.0,4.0Hz,1H),4.61(s,2H),4.53(d, J=16.0Hz,1H),4.41(d,J=16.0Hz,1H),4.35(t,J=4.0Hz,2H),3.66(t,J=4.0Hz, 2H),2.98-2.89(m,1H),2.64-2.59(m,1H),2.45-2.38(m,1H),2.04-2.01(m,1H). LC-MS(ESI)C 19 H 20 N5O3 + [M+H] + Calculated value: 366.16; Measured value: 366.20.

[0086] Step 5: Synthesis of (S)-3-(5-(7-([1,1'-biphenyl]-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-052)

[0087] (S)-3-(1-oxo-5-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidin-2,6-dione (1 eq.) and [1,1'-biphenyl]-2-carboxaldehyde (1,2 eq.) were dissolved in N,N-dimethylformimide, and a catalytic amount of acetic acid was added. The reaction mixture was stirred at room temperature for 30 minutes, followed by the addition of sodium borohydride acetate (3 eq.), and stirring was continued for 12 hours. The reaction was monitored for completion by LCMS, and the reaction mixture was quenched by adding sodium bicarbonate solution. The reaction mixture was extracted with ethyl acetate, and the extraction was repeated three times until complete. The organic phases were washed with saturated brine, combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by pre-silica gel stencil to give a white solid (S)-3-(5-(7-([1,1'-biphenyl]-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (32.00 mg, yield 43.99%). 1 H NMR(400MHz,DMSO)δ11.05(s,1H),7.79-7.70(m,2H),7.64-7.62(m,2H),7.47 -7.35(m,7H),7.28-7.26(m,1H),7.17(s,1H),5.16-5.11(m,1H),4.50-4.32( m,2H),4.05(t,J=4.7Hz,2H),3.65(s,2H),3.59(s,2H),2.97-2.86(m,1H),2. 74(t,J=4.9Hz,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.02-1.98(m,1H). LCMS(ESI)C 32 H 30 N5O3 + [M+H] + Calculated value: 532.23; Measured value: 532.30.

[0088] Example 2: Synthesis of (S)-3-(5-(7-benzyl-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-047)

[0089] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with benzaldehyde to synthesize the target product. LCMS(ESI)C 26 H 26 N5O3 +[M+H] + Calculated value: 456.20; Measured value: 456.20.

[0090] Example 3: Synthesis of (S)-3-(5-(7-(4-methoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-042)

[0091] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 4-methoxybenzaldehyde to synthesize the target product. LCMS(ESI)C 27 H 28 N5O4 + [M+H] + Calculated value: 486.21; Measured value: 486.20.

[0092] Example 4: Synthesis of (S)-3-(5-(7-(4-chlorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-048)

[0093] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 4-chlorobenzaldehyde to synthesize the target product. LCMS(ESI)C 26 H 25 ClN5O3 + [M+H] + Calculated value: 490.16; Measured value: 490.20.

[0094] Example 5: Synthesis of (S)-3-(5-(7-(4-fluorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-049)

[0095] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 4-fluorobenzaldehyde to synthesize the target product. LCMS(ESI)C 26 H 25 FN5O3 + [M+H] + Calculated value: 474.19; Measured value: 474.20.

[0096] Example 6: Synthesis of (S)-3-(1-oxo-5-(7-(pyridin-4-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-050)

[0097] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with isonicoaldehyde to synthesize the target product. LCMS(ESI)C 25 H 25 N6O3 + [M+H] + Calculated value: 457.20; Measured value: 457.20.

[0098] Example 7: Synthesis of (S)-3-(1-oxo-5-(7-(2-phenoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-051)

[0099] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-phenoxybenzaldehyde to synthesize the target product.

[0100] 1 H NMR(400MHz,DMSO)δ11.05(s,1H),7.80-7.69(m,2H),7.64-7.58(m,2H),7.37-7.31(m, 3H),7.24-7.20(m,1H),7.17(s,1H),7.10-7.06(m,1H),6.94-6.92(m,3H),5.16-5.11( m,1H),4.50-4.32(m,2H),4.05(t,J=4.6Hz,2H),3.75(s,2H),3.69(s,2H),2.96-2.90( m,1H),2.85(t,J=4.8Hz,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 32 H 30 N5O4 + [M+H] + Calculated value: 548.23; Measured value: 548.30.

[0101] Example 8: Synthesis of (S)-3-(5-(7-(naphth-1-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-053)

[0102] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 1-naphthaldehyde to synthesize the target product.

[0103] 1 H NMR(400MHz,DMSO)δ11.04(s,1H),8.40-8.27(m,1H),7.98-7.86(m,2H),7.7 7-7.70(m,2H),7.64-7.62(m,1H),7.59-7.45(m,4H),7.17(s,1H),5.15-5.11 (m,1H),4.46-4.30(m,2H),4.15(s,2H),4.06(t,J=4.8Hz,2H),3.75(s,2H), 3.00-2.81(m,3H),2.61-2.57(m,1H),2.46-2.35(m,1H),2.04-1.93(m,1H). LCMS(ESI)C 30 H 28 N5O3 + [M+H] + Calculated value: 506.22; Measured value: 506.30.

[0104] Example 9: Synthesis of (S)-3-(5-(7-(imidazo[1,2-a]pyridin-7-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-054)

[0105] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with imidazo[1,2-a]pyridine-7-carboxaldehyde to synthesize the target product. LCMS(ESI)C 27 H 26 N7O3 + [M+H] + Calculated value: 496.21; Measured value: 496.20.

[0106] Example 10: Synthesis of (S)-3-(1-oxo-5-(7-((tetrahydro-2H-pyran-4-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidin-2,6-dione (LC-03-055) This example follows the synthesis method of Example 1, except that in this example, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with tetrahydro-2H-pyran-4-carboxaldehyde to synthesize the target product. LCMS(ESI)C 25 H 30 N5O4 + [M+H] + Calculated value: 464.23; Measured value: 464.20.

[0107] Example 11: Synthesis of (S)-3-(5-(7-(3-methoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (LC-03-059)

[0108] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with the target product 3-methoxybenzaldehyde. LCMS(ESI)C 27 H 28 N5O4 + [M+H] + Calculated value: 486.21; Measured value: 486.20.

[0109] Example 12: Synthesis of (S)-3-(5-(7-(3-chlorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-060)

[0110] The difference between this embodiment and Example 1 is that in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with the target product 3-chlorobenzaldehyde.

[0111] 1H NMR(400MHz,DMSO)δ11.04(s,1H),7.79-7.73(m,2H),7.67-7.65(m,1H),7.49 -7.45(m,1H),7.43-7.35(m,3H),7.21(s,1H),5.16-5.12(m,1H),4.50-4.32( m,2H),4.11(t,J=5.0Hz,2H),3.76(s,2H),3.69(s,2H),2.99-2.89(m,1H),2. 85(t,J=4.8Hz,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.05-1.95(m,1H). LCMS(ESI)C 26 H 25 ClN5O3 + [M+H] + Calculated value: 490.16; Measured value: 490.20.

[0112] Example 13: Synthesis of (S)-3-(5-(7-(3-fluorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-061)

[0113] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 3-fluorobenzaldehyde to synthesize the target product. LCMS(ESI)C 26 H 25 FN5O3 + [M+H] + Calculated value: 474.19; Measured value: 474.20.

[0114] Example 14: Synthesis of (S)-3-(1-oxo-5-(7-(pyridin-3-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-062)

[0115] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with nicotinic aldehyde to synthesize the target product.

[0116] 1H NMR (400MHz, DMSO) δ11.04(s,1H),8.59(s,1H),8.52(d,J=4.5Hz,1H),7.81(d,J=7.6Hz, 1H),7.76-7.74(m,2H),7.65(d,J=8.0Hz,1H),7.42-7.39(m,1H),7.18(s,1H),5.16-5.1 1(m,1H),4.49-4.32(m,2H),4.10(t,J=5.0Hz,2H),3.78(s,2H),3.70(s,2H),2.97-2.87 (m,1H),2.85(t,J=4.8Hz,2H),2.62-2.57(m,1H),2.47-2.35(m,1H),2.08-1.94(m,1H). LCMS(ESI)C 25 H 25 N6O3 + [M+H] + Calculated value: 457.20; Measured value: 457.20.

[0117] Example 15: Synthesis of (S)-3-(1-oxo-5-(7-(3-phenoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-063)

[0118] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 3-phenoxybenzaldehyde to synthesize the target product.

[0119] 1 H NMR (400MHz, DMSO) δ11.04 (s, 1H), 7.77-7.75 (m, 2H), 7.65 (d, J = 8.1Hz, 1H), 7.43-7.36 ( m,3H),7.22(s,1H),7.17-7.12(m,2H),7.07-6.99(m,3H),6.94(d,J=8.0Hz,1H),5.16-5. 12(m,1H),4.50-4.33(m,2H),4.09(t,J=4.6Hz,2H),3.74(s,2H),3.69(s,2H),2.98-2.8 9(m,1H),2.84(t,J=4.4Hz,2H),2.62-2.58(m,1H),2.46-2.34(m,1H),2.05-1.97(m,1H). LCMS(ESI)C 32 H 30 N5O4+ [M+H] + Calculated value: 548.23; Measured value: 548.20.

[0120] Example 16: Synthesis of (S)-3-(5-(7-([1,1'-biphenyl]-3-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-064)

[0121] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with [1,1'-biphenyl]-3-formaldehyde to synthesize the target product. 1 H NMR(400MHz,DMSO)δ11.03(s,1H),7.79-7.72(m,2H),7.69-7.64(m,4H),7.60(d,J =7.7Hz,1H),7.49-7.51(m,3H),7.41-7.35(m,2H),7.19(s,1H),5.15-5.11(m,1H), 4.49-4.12(m,2H),4.11(t,J=4.9Hz,2H),3.82(s,2H),3.73(s,2H),2.98-2.89(m,1 H), 2.84 (t, J = 4.4Hz, 2H), 2.62-2.57 (m, 1H), 2.46-2.35 (m, 1H), 2.03-1.98 (m, 1H). LCMS(ESI)C 32 H 30 N5O3 + [M+H] + Calculated value: 532.23; Measured value: 532.20.

[0122] Example 17: Synthesis of (S)-3-(5-(7-(naphth-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-065)

[0123] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-naphthaldehyde to synthesize the target product.

[0124] 1H NMR (400MHz, DMSO) δ11.05(s,1H),7.94-9.91(m,4H),7.80-7.78(m,2H),7.69(d,J= 8.2Hz,1H),7.57(d,J=8.6Hz,1H),7.54-7.48(m,2H),7.38(s,1H),5.17-5.12(m,1H) ,4.50-4.33(m,2H),4.16(t,J=4.4Hz,2H),3.94(s,2H),3.83(s,2H),2.84(t,J=4.4 Hz,2H),2.62-2.57(m,1H),2.62-2.58(m,1H),2.45-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 30 H 28 N5O3 + [M+H] + Calculated value: 506.22; Measured value: 506.20.

[0125] Example 18: Synthesis of (S)-3-(5-(7-(imidazo[1,2-a]pyridin-6-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindoline-2-yl)piperidine-2,6-dione (LC-03-066)

[0126] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with imidazole and [1,2-a]pyridine-6-carboxaldehyde to synthesize the target product.

[0127] 1 H NMR(400MHz,DMSO)δ11.03(s,1H),8.59(s,1H),7.95(s,1H),7.76-7.74(m,2H),7.64(d,J =8.3Hz,1H),7.56-7.54(t,J=4.4Hz,2H),7.28-7.26(d,J=9.1Hz,1H),7.18(s,1H),5.15-5 .10(m,1H),4.49-4.32(m,2H),4.11(t,J=5.0Hz,2H),3.74(s,2H),3.73(s,2H),3.06-2.9 2(m,1H),2.90(t,J=4.8Hz,2H),2.61-2.57(m,1H),2.46-2.37(m,1H),2.03-1.96(m,1H). LCMS(ESI)C 27 H 26N7O3 + [M+H] + Calculated value: 496.21; Measured value: 496.20.

[0128] Example 19: Synthesis of (S)-3-(1-oxo-5-(7-(4-(phenylamino)benzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-067)

[0129] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 4-phenylaminobenzaldehyde to synthesize the target product. 1 HNMR(400MHz,DMSO)δ11.03(s,1H),8.20(s,1H),7.76(d,J=7.1Hz,2H),7.65(d,J=8.1Hz,1H), 7.22(dd,J=16.8,7.8Hz,5H),7.07(d,J=8.1Hz,4H),6.81(t,J=7.2Hz,1H),5.14(dd,J=13.2,4 .9Hz,1H),4.47(d,J=17.4Hz,1H),4.35(d,J=17.4Hz,1H),4.10(s,2H),3.64(s,4H),2.97-2.8 7(m,1H),2.86(d,J=11.2Hz,2H),2.60(d,J=16.8Hz,1H),2.47-2.35(m,1H),2.06-1.94(m,1H). LCMS(ESI)C 32 H 31 N6O3 + [M+H] + Calculated value: 547.25; Measured value: 547.30.

[0130] Example 20: Synthesis of (S)-3-(1-oxo-5-(7-(((2-phenylthiazo-5-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-068)

[0131] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2-phenylthiazole-5-carboxaldehyde to synthesize the target product. 1H NMR (400MHz, DMSO) δ11.03 (s, 1H), 7.93 (d, J = 5.9Hz, 2H), 7.87 (s, 1H), 7.78–7.74 (m, 2H), 7.6 5(d,J=8.0Hz,1H),7.50(d,J=6.6Hz,3H),7.20(s,1H),5.13(dd,J=13.2,4.8Hz,1H),4.47(d, J=17.3Hz,1H),4.35(d,J=17.4Hz,1H),4.12(s,2H),4.05(s,2H),3.79(s,2H),2.93(d,J=4.7 Hz,2H),2.88(d,J=5.0Hz,1H),2.60(d,J=16.3Hz,1H),2.46–2.36(m,1H),2.05–1.98(m,1H). LCMS(ESI)C 29 H 27 N6O3S + [M+H] + Calculated value: 539.19; Measured value: 539.20.

[0132] Example 21: Synthesis of (S)-3-(5-(7-(2-methoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (LC-03-069)

[0133] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-methoxybenzaldehyde to synthesize the target product. 1HNMR (400MHz, DMSO) δ11.03(s,1H),7.84–7.71(m,2H),7.66(d,J=8.3Hz,1H),7.39(d,J=7.4Hz,1H),7.31–7 .23(m,1H),7.19(s,1H),7.02(d,J=8.1Hz,1H),6.95(t,J=7.4Hz,1H),5.14(dd,J=13.3,5.0Hz,1H),4.48(d, J=17.5Hz,1H),4.35(d,J=17.4Hz,1H),4.11(t,J=5.0Hz,2H),3.80(s,3H),3.73(s,2H),3.71(s,2H),2.99– 2.88(m,1H),2.86(t,J=5.2Hz,2H),2.60(d,J=16.3Hz,1H),2.42(qd,J=13.1,4.3Hz,1H),2.06–1.94(m,1H). LCMS(ESI)C 27 H 28 N5O4 + [M+H] + Calculated value: 486.21; Measured value: 486.20.

[0134] Example 22: Synthesis of (S)-3-(5-(7-(2-chlorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-070)

[0135] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-chlorobenzaldehyde to synthesize the target product. 1HNMR (400MHz, DMSO) δ11.03 (s, 1H), 7.76 (d, J = 7.1Hz, 2H), 7.65 (d, J = 8.2Hz, 1H), 7.59 (dd, J = 7. 3,1.6Hz,1H),7.48(dd,J=7.5,1.4Hz,1H),7.41–7.32(m,2H),7.19(s,1H),5.14(dd,J=13.3,5.0 Hz,1H),4.47(d,J=17.4Hz,1H),4.35(d,J=17.4Hz,1H),4.12(t,J=5.1Hz,2H),3.84(s,2H),3.7 6(s,2H),2.98–2.85(m,3H),2.64–2.54(m,1H),2.42(qd,J=13.3,4.4Hz,1H),2.05–1.95(m,1H). LCMS(ESI)C 26 H 25 ClN5O3 + [M+H] + Calculated value: 490.16; Measured value: 490.20.

[0136] Example 23: Synthesis of (S)-3-(5-(7-(2-fluorobenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (LC-03-071)

[0137] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-fluorobenzaldehyde to synthesize the target product. 1H NMR (400MHz, DMSO) δ11.05(s,1H),7.78(d,J=7.4Hz,2H),7.67(d,J=8.4Hz,1H),7.54(t,J=7.6Hz,1H) ,7.39(dt,J=7.3,4.2Hz,1H),7.25(dd,J=12.6,4.9Hz,2H),7.20(s,1H),5.16(dd,J=13.3,5.0Hz,1H) ,4.50(d,J=17.4Hz,1H),4.37(d,J=17.4Hz,1H),4.13(t,J=5.1Hz,2H),3.83(s,2H),3.73(s,2H),2.9 4(ddd,J=18.9,12.0,5.3Hz,3H),2.68–2.57(m,1H),2.44(qd,J=13.3,4.4Hz,1H),2.12–1.95(m,1H). LCMS(ESI)C 26 H 25 FN5O3 + [M+H] + Calculated value: 474.19; Measured value: 474.20.

[0138] Example 24: Synthesis of (S)-3-(1-oxo-5-(7-(pyridin-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindoline-2-yl)piperidin-2,6-dione (LC-03-072)

[0139] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with pyridinaldehyde to synthesize the target product. LCMS(ESI)C 25 H 25 N6O3 + [M+H] + Calculated value: 457.20; Measured value: 457.20.

[0140] Example 25: Synthesis of (S)-3-(1-oxo-5-(7-(4-phenoxybenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-073)

[0141] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 4-phenoxybenzaldehyde to synthesize the target product. 1HNMR(600MHz,DMSO)δ11.00(s,1H),7.76(d,J=7.5Hz,2H),7.65(d,J=8.2Hz,1H),7.42–7.37(m ,4H),7.21(s,1H),7.14(t,J=7.3Hz,1H),7.01(t,J=7.7Hz,4H),5.13(dd,J=13.3,5.1Hz,1H), 4.48(d,J=17.3Hz,1H),4.36(d,J=17.3Hz,1H),4.11(t,J=5.1Hz,2H),3.73(s,2H),3.69(s,2H ),2.95–2.85(m,3H),2.61(d,J=16.7Hz,1H),2.42(dt,J=13.4,8.9Hz,1H),2.04–1.99(m,1H). LCMS(ESI)C 32 H 30 N5O4 + [M+H] + Calculated value: 548.23; Measured value: 548.20.

[0142] Example 26: Synthesis of (S)-3-(5-(7-([1,1'-biphenyl]-4-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-074)

[0143] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with [1,1'-biphenyl]-4-formaldehyde to synthesize the target product. 1 H NMR (600MHz, DMSO) δ11.00 (s, 1H), 7.78–7.75 (m, 2H), 7.67 (dt, J = 8.6, 4.4Hz, 5H), 7.48 (dd ,J=16.6,8.1Hz,4H),7.36(t,J=7.4Hz,1H),7.23(s,1H),5.13(dd,J=13.3,5.1Hz,1H),4.48 (d,J=17.3Hz,1H),4.36(d,J=17.3Hz,1H),4.13(t,J=5.1Hz,2H),3.80(s,2H),3.73(s,2H) ,2.95–2.87(m,3H),2.60(d,J=16.6Hz,1H),2.44–2.39(m,1H),2.01(dd,J=8.9,3.5Hz,1H). LCMS(ESI)C 32 H30 N5O3 + [M+H] + Calculated value: 532.23; Measured value: 532.20.

[0144] Example 27: Synthesis of (S)-3-(5-(7-(2-(benzyloxy)benzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-075)

[0145] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2-(benzyloxy)benzaldehyde to synthesize the target product. 1 H NMR (600MHz, DMSO) δ11.00(s,1H),7.77–7.72(m,2H),7.64(d,J=8.0Hz,1H),7.49(d,J=7.4Hz,2H),7.42(d,J=7.4Hz,1 H),7.38(t,J=7.5Hz,2H),7.31(t,J=7.3Hz,1H),7.28–7.25(m,1H),7.18(s,1H),7.11(d,J=8.2Hz,1H),6.97(t,J=7.3H z,1H),5.16(s,2H),5.13(dd,J=13.3,5.1Hz,1H),4.47(d,J=17.3Hz,1H),4.36(d,J=17.3Hz,1H),4.10(t,J=5.1Hz,2H) ,3.79(s,2H),3.71(s,2H),2.95–2.87(m,3H),2.61(d,J=16.3Hz,1H),2.42(dd,J=13.1,4.4Hz,1H),2.04–2.00(m,1H). LCMS(ESI)C 33 H 32 N5O4 + [M+H] + Calculated value: 562.25; Measured value: 562.30.

[0146] Example 28: Synthesis of (S)-3-(5-(7-((2,3-dihydrobenzo[b][1,4]dioxin-6-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-03-076)

[0147] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2,3-dihydrobenzo[b][1,4]dioxane-6-formaldehyde to synthesize the target product. 1 H NMR(600MHz,DMSO)δ11.00(s,1H),7.77–7.73(m,2H),7.65(d,J=8.2Hz,1H),7.17(s,1H), 6.87(s,1H),6.83(s,2H),5.13(dd,J=13.3,5.1Hz,1H),4.47(d,J=17.3Hz,1H),4.35(d,J =17.3Hz,1H),4.23(s,4H),4.08(t,J=5.2Hz,2H),3.63(s,2H),3.61(s,2H),2.94–2.89(m ,1H),2.82(t,J=5.2Hz,2H),2.61(d,J=16.5Hz,1H),2.45–2.39(m,1H),2.03–1.99(m,1H). LCMS(ESI)C 28 H 28 N5O5 + [M+H] + Calculated value: 514.21; Measured value: 514.20.

[0148] Example 29: Synthesis of (S)-3-(1-oxo-5-(7-(quinoxalo-6-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-077)

[0149] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with quinoxaline-6-formaldehyde to synthesize the target product. 1HNMR (600MHz, DMSO) δ11.00(s,1H),8.95(d,J=7.8Hz,2H),8.11(d,J=8.2Hz,2H),7.93(d,J=9.2H z,1H),7.76(d,J=8.2Hz,2H),7.66(d,J=8.0Hz,1H),7.20(s,1H),5.13(dd,J=13.3,5.1Hz,1H),4 .47(d,J=17.4Hz,1H),4.36(d,J=17.3Hz,1H),4.14(t,J=5.1Hz,2H),4.03(s,2H),3.79(s,2H),2 .92(ddd,J=18.0,11.9,5.1Hz,3H),2.60(d,J=16.5Hz,1H),2.44–2.38(m,1H),2.04–1.99(m,1H). LCMS(ESI)C 28 H 26 N7O3 + [M+H] + Calculated value: 508.21; Measured value: 508.20.

[0150] Example 30: Synthesis of (S)-3-(1-oxo-5-(7-(thiazol-2-ylmethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-03-078)

[0151] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with thiazole-2-carboxaldehyde to synthesize the target product. LCMS(ESI)C 23 H 23 N6O3S + [M+H] + Calculated value: 463.16; Measured value: 463.20.

[0152] Example 31: Synthesis of (S)-3-(5-(7-((4'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-039)

[0153] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 4'-chloro-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product.

[0154] 1 H NMR(600MHz,DMSO)δ11.00(s,1H),7.79-7.72(m,2H),7.67-7.60(m,2H),7.537.4 7(m,4H),7.44-7.38(m,2H),7.29-7.27(m,1H),7.17(s,1H),5.15-5.12(m,1H),4. 49-4.35(m,2H),4.06(t,J=5.3Hz,2H),3.63(s,2H),3.60(s,2H),2.95-2.89(m,1H ), 2.77 (t, J = 5.3Hz, 2H), 2.65-2.58 (m, 1H), 2.46-2.38 (m, 1H), 2.03-1.99 (m, 1H). LCMS(ESI)C 32 H 29 ClN5O3 + [M+H] + Calculated value: 566.20; Measured value: 566.20.

[0155] Example 32: Synthesis of (S)-3-(5-(7-((4'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-040)

[0156] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 4'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1 HNMR(600MHz,DMSO-d6)δ11.00(s,1H),7.76-7.74(m,2H),7.64-7.61(m,2H),7.39-7.34(m,2H), 7.32-7.31(m,2H),7.26-7.24(m,3H),7.17(s,1H),5.13(dd,J=18.0,6.0Hz,1H),4.48(d,J=18.0 Hz,1H),4.36(d,J=18.0Hz,1H),4.06(t,J=6.0Hz,2H),3.65(s,2H),3.61(s,2H),2.95-2.89(m,1 H), 2.76 (t, J = 6.0Hz, 2H), 2.62-2.59 (m, 1H), 2.46-2.39 (m, 1H), 2.35 (s, 3H), 2.03-2.00 (m, 1H). LCMS(ESI)C33 H 32 N5O3 + [M+H] + Calculated value: 546.25; Measured value: 546.30.

[0157] Example 33: Synthesis of (S)-3-(5-(7-((4'-fluoro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-041)

[0158] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 4'-fluoro-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1 HNMR(600MHz,DMSO-d6)δ11.00(s,1H),7.77-7.74(m,2H),7.64(d,J=12.0Hz,1H),7.61(d,J=6.0Hz, 1H),7.50-7.48(m,2H),7.42-7.36(m,2H),7.29-7.26(m,3H),7.17(s,1H),5.13(dd,J=18.0,6.0Hz, 1H),4.48(d,J=18.0Hz,1H),4.36(d,J=18.0Hz,1H),4.06(t,J=6.0Hz,2H),3.63(s,2H),3.62(s,2H) ,2.95-2.89(m,1H),2.77(t,J=6.0Hz,2H),2.62-2.59(m,1H),2.46-2.38(m,1H),2.03-2.00(m,1H). LCMS(ESI)C 32 H 29 FN5O3 + [M+H] + Calculated value: 550.23; Measured value: 550.20.

[0159] Example 34: Synthesis of (S)-3-(1-oxo-5-(7-(2-(pyridin-4-yl)benzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-04-042)

[0160] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2-(pyridin-4-yl)benzaldehyde to synthesize the target product. 1 H NMR(400MHz,DMSO-d6)δ11.02(s,1H),8.64(m,2H),7.76-7.73(m,2H),7.65-7.62(m,2H),7.51-7 .49(m,2H),7.48-7.42(m,2H),7.33(d,J=4.0Hz,1H),7.17(s,1H),5.13(dd,J=12.0,4.0Hz,1H),4 .48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.04(t,J=4.0Hz,2H),3.67(s,2H),3.60(s,2H),2 .97-2.88(m,1H),2.76(t,J=4.0Hz,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 31 H 29 N6O3 + [M+H] + Calculated value: 533.23; Measured value: 533.20.

[0161] Example 35: Synthesis of (S)-3-(5-(7-((3'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-043)

[0162] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 3'-chloro-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1HNMR(600MHz,DMSO-d6)δ11.00(s,1H),7.76(d,J=6.0Hz,1H),7.73(s,1H),7.63-7.61(m,2H),7. 55(s,1H),7.49-7.39(m,5H),7.31(d,J=6.0Hz,1H),7.17(s,1H),5.13(dd,J=18.0,6.0Hz,1H),4 .48(d,J=18.0Hz,1H),4.36(d,J=18.0Hz,1H),4.05(t,J=6.0Hz,2H),3.64(s,2H),3.61(s,2H),2 .95-2.89(m,1H),2.78(t,J=6.0Hz,2H),2.62-2.59(m,1H),2.45-2.38(m,1H),2.03-2.00(m,1H). LCMS(ESI)C 32 H 29 ClN5O3 + [M+H] + Calculated value: 566.20; Measured value: 566.20.

[0163] Example 36: Synthesis of (S)-3-(5-(7-((3'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-044)

[0164] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 3'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1HNMR(600MHz,DMSO-d6)δ11.00(s,1H),7.76(d,J=6.0Hz,1H),7.73(s,1H),7.63-7.62(m,2H),7.41-7 .32(m,3H),7.26(d,J=12.0Hz,1H),7.23-7.18(m,3H),7.17(s,1H),5.13(dd,J=18.0,6.0Hz,1H),4.48 (d,J=18.0Hz,1H),4.36(d,J=18.0Hz,1H),4.05(t,J=6.0Hz,2H),3.65(s,2H),3.60(s,2H),2.95-2.8 9(m,1H),2.77(t,J=6.0Hz,2H),2.62-2.59(m,1H),2.45-2.38(m,1H),2.35(s,3H),2.03-2.00(m,1H). LCMS(ESI)C 33 H 32 N5O3 + [M+H] + Calculated value: 546.25; Measured value: 546.30.

[0165] Example 37: Synthesis of (S)-3-(5-(7-((2'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-045)

[0166] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-chloro-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1HNMR (400MHz, DMSO-d6) δ11.03(s,1H),7.75(d,J=8.0Hz,1H),7.71(s,1H),7.65(d,J=8.0Hz,1H),7.6 1(d,J=8.0Hz,1H),7.58-7.55(m,1H),7.46-7.34(m,5H),7.17(d,J=8.0Hz,1H),7.15(s,1H),5.13(dd, J=12.0,4.0Hz,1H),4.47(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.00(t,J=4.0Hz,2H),3.55-3.42( m,4H),2.96-2.87(m,1H),2.74-2.66(m,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 32 H 29 ClN5O3 + [M+H] + Calculated value: 566.20; Measured value: 566.20.

[0167] Example 38: Synthesis of (S)-3-(5-(7-((2'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-046)

[0168] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1HNMR(600MHz,DMSO-d6)δ11.00(s,1H),7.76(d,J=6.0Hz,1H),7.72(s,1H),7.65(d,J=6.0Hz,1H),7.62(d,J=6.0Hz,1 H),7.40(t,J=6.0Hz,1H),7.35(t,J=6.0Hz,1H),7.31-7.27(m,2H),7.24(t,J=6.0Hz,1H),7.16(s,1H),7.13-7.11(m, 2H),5.13(dd,J=12.0,6.0Hz,1H),4.48(d,J=18.0Hz,1H),4.36(d,J=18.0Hz,1H),4.01(t,J=6.0Hz,2H),3.52-3.38(m ,4H),2.95-2.89(m,1H),2.69(t,J=6.0Hz,2H),2.62-2.59(m,1H),2.45-2.38(m,1H),2.06-2.01(m,1H),2.00(s,3H). LCMS(ESI)C 33 H 32 N5O3 + [M+H] + Calculated value: 546.25; Measured value: 546.30.

[0169] Example 39: Synthesis of (S)-3-(5-(7-((2'-fluoro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-100)

[0170] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2'-fluoro-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1HNMR(400MHz,DMSO-d6)δ11.02(s,1H),7.76-7.71(m,2H),7.67(d,J=8.0Hz,1H),7.61(d,J=8.0Hz,1H ),7.46-7.44(d,J=4.0Hz,2H),7.40-7.37(m,2H),7.32-7.25(m,3H),7.15(s,1H),5.13(dd,J=12.0,4. 0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.00(t,J=4.0Hz,2H),3.57(s,2H),3.52(s,2 H), 2.96-2.87 (m, 1H), 2.68 (t, J = 4.0Hz, 2H), 2.62-2.58 (m, 1H), 2.46-2.36 (m, 1H), 2.03-2.00 (m, 1H). LCMS(ESI)C 32 H 29 FN5O + [M+H] + Calculated value: 550.61; Measured value: 550.60.

[0171] Example 40: Synthesis of (S)-3-(1-oxo-5-(7-((2'-(trifluoromethyl)-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-04-101)

[0172] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2'-trifluoromethyl-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1H NMR(400MHz,DMSO-d6)δ11.02(s,1H),7.85(d,J=4.0Hz,1H),7.76-7.61(m,6H),7.45(t,J =8.0Hz,1H),7.39(d,J=8.0Hz,1H),7.34(t,J=8.0Hz,1H),7.17-7.16(m,2H),5.13(dd,J= 12.0,4.0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.08-3.98(m,2H),3.56 -3.40(m,4H),2.97-2.88(m,1H),2.75-2.58(m,3H),2.47-2.36(m,1H),2.03-2.00(m,1H). LCMS(ESI)C 33 H 29 F3N5O3 + [M+H] + Calculated value: 600.62; Measured value: 600.60.

[0173] Example 41: Synthesis of (S)-3-(5-(7-((2'-methoxy-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-102)

[0174] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-methoxy-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. 1HNMR(400MHz,DMSO-d6)δ11.02(s,1H),7.76-7.72(m,2H),7.63-7.60(m,2H),7.39-7.35(m,2H),7 .31(t,J=8.0Hz,1H),7.17-7.11(m,3H),7.08(d,J=8.0Hz,1H),7.02(t,J=8.0Hz,1H),5.13(dd,J= 12.0,4.0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.00(t,J=4.0Hz,2H),3.69(s,3 H),3.57-3.44(m,4H),2.97-2.88(m,1H),2.70-2.54(m,3H),2.47-2.37(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 33 H 32 N5O4 + [M+H] + Calculated value: 562.65; Measured value: 562.70.

[0175] Example 42: Synthesis of (S)-3-(1-oxo-5-(7-((2'-(trifluoromethoxy)-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidine-2,6-dione (LC-04-103)

[0176] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2'-trifluoromethoxy-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1H NMR (400MHz, DMSO-d6) δ11.02(s,1H),7.76-7.72(m,2H),7.68(d,J=8.0Hz,1H),7.62(d,J=8.0Hz,1H ),7.57-7.53(m,1H),7.50-7.44(m,4H),7.38(t,J=8.0Hz,1H),7.21(d,J=8.0Hz,1H),7.16(s,1H),5 .13(dd,J=12.0,4.0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),4.02(t,J=8.0Hz,2H),3 .51(s,2H),3.50(s,2H),2.97-2.88(m,1H),2.74-2.58(m,3H),2.47-2.36(m,1H),2.05-2.00(m,1H). LCMS(ESI)C 33 H 29 F3N5O4 + [M+H] + Calculated value: 616.62; Measured value: 616.60.

[0177] Example 43: Synthesis of (S)-3-(5-(7-((2'-(difluoromethyl)-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindoline-2-yl)piperidine-2,6-dione (LC-04-104)

[0178] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2'-difluoromethyl-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1H NMR(400MHz, DMSO-d6)δ11.02(s,1H),7.76-7.70(m,3H),7.64-7.55(m,4H),7.47(t,J=8.0Hz,1H), 7.39(t,J=8.0Hz,1H),7.32(d,J=8.0Hz,1H),7.18(d,J=8.0Hz,1H),7.15(s,1H),6.49(t,J=56.0Hz, 1H),5.13(dd,J=12.0,4.0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),3.98(t,J=4.0Hz, 2H),3.47-3.40(m,4H),2.97-2.88(m,1H),2.71-2.58(m,3H),2.47-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 33 H 30 F2N5O3 + [M+H] + Calculated value: 582.63; Measured value: 582.60.

[0179] Example 44: Synthesis of (S)-2'-((3-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)-[1,1'-biphenyl]-2-carboxynitrile (LC-04-109)

[0180] This embodiment refers to the synthesis method of Example 1, but differs from Example 1 in that: in this embodiment, [1,1'-biphenyl]-2-formaldehyde in step 5 of Example 1 is replaced with 2'-cyano-[1,1'-biphenyl]-2-formaldehyde to synthesize the target product. 1HNMR(400MHz, DMSO-d6)δ11.02(s,1H),7.93(d,J=8.0Hz,1H),7.79-7.74(m,2H),7.70(s,1H),7.66(d,J=8.0 Hz,1H),7.61-7.55(m,3H),7.50(t,J=8.0Hz,1H),7.44(t,J=8.0Hz,1H),7.29(d,J=8.0Hz,1H),7.15(s,1H), 5.13(dd,J=12.0,4.0Hz,1H),4.48(d,J=16.0Hz,1H),4.35(d,J=16.0Hz,1H),3.98(t,J=4.0Hz,2H),3.59-3. 49(m,4H),2.96-2.87(m,1H),2.68(t,J=4.0Hz,2H),2.62-2.58(m,1H),2.47-2.36(m,1H),2.02-1.99(m,1H). LCMS(ESI)C 33 H 29 N6O3 + [M+H] + Calculated value: 557.63; Measured value: 557.60.

[0181] Example 45: Synthesis of (S)-3-(5-(7-((2'-chloro-4'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-156)

[0182] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-chloro-4'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. LCMS(ESI)C 33 H 31 ClN5O3 + [M+H] + Calculated value: 581.10; Measured value: 581.20.

[0183] Example 46: Synthesis of (S)-3-(5-(7-([1,1'-biphenyl]-2-carbonyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-158)

[0184] (S)-3-(1-oxo-5-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)isoindololin-2-yl)piperidin-2,6-dione (LC-03-041, 1 eq.) and [1,1'-biphenyl]-2-carboxylic acid (1 eq.) were dissolved in DMF. HATU (1.5 eq.) and DIPEA (5 eq.) were added to the solution. The reaction mixture was stirred at room temperature for 1 hour. The reaction was monitored by thin-layer chromatography. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by pre-TLC to give a white solid (S)-3-(5-(7-([1,1'-biphenyl]-2-carbonyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidin-2,6-dione (35.00 mg, yield 46.88%). LCMS(ESI)C 32 H 28 N5O4 + [M+H] + Calculated value: 546.61; Measured value: 546.60.

[0185] Example 47: Synthesis of (S)-3-(5-(7-((2'-chloro-5'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindoline-2-yl)piperidine-2,6-dione (LC-04-159)

[0186] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-chloro-5'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. LCMS(ESI)C 33 H 31 ClN5O3 + [M+H] + Calculated value: 581.10; Measured value: 581.20.

[0187] Example 48: Synthesis of (S)-3-(5-(7-((2'-chloro-3'-methyl-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-04-171)

[0188] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2'-chloro-3'-methyl-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. LCMS(ESI)C 33 H 31 ClN5O3 + [M+H] + Calculated value: 581.10; Measured value: 581.20.

[0189] Example 49: Synthesis of (S)-3-(5-(7-(2-morpholinylbenzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-05-034)

[0190] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 2-morpholinobenzaldehyde to synthesize the target product. LCMS(ESI)C 30 H 33 N6O4 + [M+H] + Calculated value: 541.63; Measured value: 541.60.

[0191] Example 50: Synthesis of (S)-3-(5-(7-((2'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)-1-methylpiperidin-2,6-dione (LC-05-096)

[0192] (S)-3-(5-(7-((2'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (1 eq.) was dissolved in toluene, and DMF-DMA (1.5 eq.) was added to the solution. The reaction mixture was heated to 100 °C and stirred for 20 hours. The reaction was monitored for completion by thin-layer chromatography. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, and the two organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by pre-TLC to give a white solid (S)-3-(5-(7-((2'-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)-1-methylpiperidin-2,6-dione (21.00 mg, yield 40.98%). 1 H NMR (400MHz, DMSO-d6) δ7.77(d,J=8.0Hz,1H),7.73(s,1H),7.68(d,J=4.0Hz,1H),7.63(d ,J=8.0Hz,1H),7.60-7.57(m,1H),7.48-7.36(m,5H),7.18-7.20(m,2H),5.21(dd,J=12.0 ,4.0Hz,1H),4.49(d,J=16.0Hz,1H),4.36(d,J=16.0Hz,1H),4.02(t,J=4.0Hz,2H),3.57- 3.44(m,4H),3.06-2.97(m,4H),2.80-2.65(m,3H),2.49-2.38(m,1H),2.06-2.01(m,1H). LCMS(ESI)C 33 H 31 ClN5O3 + [M+H] + Calculated value: 581.10; Measured value: 581.20.

[0193] Example 51: Synthesis of (S)-3-(5-(7-((6-chloro-[1,1'-biphenyl]-2-yl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-05-097)

[0194] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with 6-chloro-[1,1'-biphenyl]-2-carboxaldehyde to synthesize the target product. LCMS(ESI)C 32 H 29 ClN5O3 + [M+H] + Calculated value: 567.07; Measured value: 567.10.

[0195] Example 52: Synthesis of (S)-3-(5-(7-(2-((S)-3-methylmorpholinyl)benzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (LC-05-107)

[0196] This embodiment refers to the synthesis method of Example 1, except that in this embodiment, [1,1'-biphenyl]-2-carboxaldehyde in step 5 of Example 1 is replaced with (S)-2-(3-methylmorpholino)benzaldehyde to synthesize the target product. LCMS(ESI)C 31 H 35 N6O4 + [M+H] + Calculated value: 555.66; Measured value: 555.70.

[0197] Example 53: Synthesis of (S)-3-(5-(7-(2'-chloro-[1,1'-biphenyl]-2-carbonyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)-1-oxoisoindoline-2-yl)piperidine-2,6-dione (LC-05-119)

[0198] This embodiment refers to the synthesis method of Example 46, except that in this embodiment, the [1,1'-biphenyl]-2-carboxylic acid in step 5 of Example 46 is replaced with 2'-chloro-[1,1'-biphenyl]-2-carboxylic acid to synthesize the target product. LCMS(ESI)C 32 H 27 ClN5O4 + [M+H] + Calculated value: 581.05; Measured value: 581.10.

[0199] Example 54: Construction and testing of NEK7-N-HiBiT cell line

[0200] 1. Construction of NEK7-N-HiBiT cell line

[0201] 2 μg of NLS-Cas9-EGFP nuclease (Novoprotein, #E379-01A), 50 pmol of sgRNA (5'-mG*mU*mU*CCUGUUGCUUCAGACAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3', see SEQ NO.ID:1, * indicates thiomodification: thiomodification of primers prevents digestion by exonucleases, m indicates methylation of the following nucleotides) and 50 pmol of Donor DNA (5'-TTACATTTTTGCAGAGTTCTAAAGTTCCTGTTGCTTCAGACAATGGTCTCCGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCGATGAGCAATCACAAGGAATGCAAGGGCCACCTGTTCCTC-3', see SEQ NO.ID:1, * indicates thiomodification: thiomodification of primers prevents digestion by exonucleases, m indicates methylation of the following nucleotides) were added. NO. ID: 2) was added to 10 μL of electroporation buffer. After incubation for 10 minutes, 2 million MOLT4 cells were resuspended in 10 μL of electroporation buffer and then mixed with 10 μL of ribonucleoprotein (RNP) complex. The RNP complex was then electroporated into the cells using a Celerix SP100 electroporator. The cells were then transferred to antibiotic-free 1640 complete medium and cultured overnight in an incubator. EGFP-positive cells were sorted using a Sony MA900 cell sorter, and EGFP-positive single-cell clones were selected using a Nano-Glo® HiBiT lysis detection kit (Promega, #N3030).

[0202] 2. Compound testing:

[0203] Dilute EGFP-positive cells to 1×10⁻⁶ 5 / mL, 100μL was spread into each well of a 96-well plate, and the diluted compound solution was added to form the experimental group;

[0204] Dilute EGFP-positive cells to 1×10⁻⁶ 5 / mL, 100μL was spread into each well of a 96-well plate, and 0.1% DMSO was added as a control group.

[0205] The experimental and control groups were incubated in an incubator for 6 hours, and then detected by the Nano-Glo® HiBiT lysis detection kit. Data analysis was performed using Graphpad Pism 9.5.

[0206] Table 3. Bioactivity of the compounds prepared in this invention in NEK7-N-HiBiT cells during degradation.

[0207]

[0208]

[0209] DC 50 represents the degradation concentration at half maximum; D max represents the maximum target degradation level; A represents D max ≤30%; B represents 30% < Dmax ≤ 70%; C represents D max > 70%; + represents DC 50 > 500 nM; ++ represents 200 nM < DC50 ≤ 500 nM; +++ represents DC 50 ≤ 200 nM; - represents not detected.

[0210] Example 55: Phenotypic verification of NEK7 degrader:

[0211] 1. Construction of an inflammatory model

[0212] Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh human whole blood, and monocytes were further isolated. The cells were resuspended in RPMI - 1640 complete medium, adjusted to a density of 1×10 6 / mL, plated into 10 - cm culture dishes, and macrophage colony - stimulating factor (M - CSF) was added and induced for 6 days. On the sixth day, the macrophages were collected by trypsin digestion and plated into 96 - well plates. After the cells adhered overnight, compounds and the commercially available NLRP3 inhibitor MCC950 were added to the experimental wells respectively, and 1640 medium containing 0.1% DMSO was added to the control wells. The plates were incubated in an incubator for 12 hours. Then, 500 ng / mL lipopolysaccharide (LPS) was added and incubated for 3 hours, and then the commercially available NLRP3 agonist Nigericin (final concentration 5 μM) was added and incubated for 1 hour. The supernatants were collected for detecting the secretion levels of IL-1β and IL-18.

[0213] 2. ELISA detection of IL-1β secretion

[0214] The Human IL-1β ELISA Kit (EK101B) from Bioteke Corporation was used to detect the secretion level of IL-1β.

[0215] (1) Experiment preparation:

[0216] Before detection, all reagents and samples should be restored to room temperature (25°C ± 3°C). If crystals appear in the concentrated reagents, warm them in a 37°C water bath until all the crystals dissolve.

[0217] 1× Washing Solution: Pipette 50 mL of 20× concentrated washing solution into a 1 L graduated cylinder, add distilled water to a final volume of 1,000 mL, and mix gently, avoiding foaming. Transfer to a clean bottle. Store at 2-8°C; 1× washing solution is stable for 30 days.

[0218] 1× Detection Buffer: Pipette 5 mL of 10× concentrated detection buffer into a 100 mL graduated cylinder, add distilled water to a final volume of 50 mL, and mix gently, avoiding foaming. Store at 2-8℃. 1× detection buffer is stable for 30 days.

[0219] Antibody preparation: Mix thoroughly before dilution. Dilute the concentrated antibody 1:100 with 1× test buffer, depending on the quantity of standards and samples to be tested. Use the diluted antibody within 30 minutes.

[0220] Horseradish peroxidase-labeled streptavidin: Mix thoroughly before dilution. Dilute the concentrated horseradish peroxidase-labeled streptavidin 1:100 with 1× test buffer, depending on the number of standards and test samples. Use the diluted horseradish peroxidase-labeled streptavidin within 30 minutes.

[0221] Standards: Briefly centrifuge before opening, then reconstitute the standard with distilled water, labeling the reconstituted volume on the standard label. Gently vortex to ensure thorough mixing; the reconstituted standard concentration is 500 pg / mL. Let stand for 10-30 minutes after reconstitution. Mix thoroughly before dilution. Take 200 μL of concentrated human IL-1β standard and add 200 μL of standard diluent to obtain the highest concentration (250 pg / mL) of the standard curve. Add 200 μL of standard diluent to each test tube. Perform 1:1 serial dilutions using the high-concentration standard. Ensure thorough mixing after each pipetting. Use the standard diluent as the zero concentration of the standard curve. Take 200 μL of concentrated human IL-1β standard and add 200 μL of cell culture medium to obtain the highest concentration (IL-1β: 250 pg / mL) of the standard curve. Add 200 μL of cell culture medium to each test tube. Perform 1:1 serial dilutions using the high-concentration standard. Ensure thorough mixing with each pipette. Use cell culture medium as the zero concentration for the standard curve.

[0222] (2) Formal testing

[0223] Before testing, equilibrate all reagents and samples to room temperature (25℃±3℃).

[0224] 1) Prepare all necessary reagents and working concentration standards.

[0225] 2) Remove the unwanted slats, put them back into the aluminum foil bag containing the desiccant, and reseal the bag.

[0226] 3) Add 300 μL of 1× washing buffer and let it soak for 30 seconds. Soaking is necessary to obtain ideal experimental results. After discarding the washing buffer, pat the microplate dry on absorbent paper. Use the microplate immediately after washing; do not allow it to dry.

[0227] 4) Add 100 μL of serially diluted standard to the standard wells. Add 100 μL of standard dilution buffer (serum / plasma sample) or culture medium (cell culture supernatant sample) to the blank wells.

[0228] 5) Add 100 μL of cell culture supernatant to the sample well.

[0229] 6) Add 50 μL of diluted detection antibody (1:100) to each well. Ensure that steps 4, 5, and 6 are performed consecutively without interruption. The sample addition process should be completed within 15 minutes.

[0230] 7) Seal the plate using a sealing film. Shake at 100-300 rpm (ensure that the solution in each well is not spilled and is thoroughly mixed), and incubate at room temperature (25℃±3℃) for 2 hours.

[0231] 8) Discard the liquid, add 300 μL of washing buffer to each well, and wash the plate 6 times. After each wash, pat the plate dry on absorbent paper. To obtain ideal experimental performance, residual liquid must be completely removed.

[0232] 9) Add 100 μL of diluted horseradish peroxidase-labeled streptavidin (1:100) to each well.

[0233] 10) Seal the plate using a new sealing film. Shake at 100-300 rpm (ensure that the solution in each well is not spilled and is thoroughly mixed), and incubate at room temperature (25℃±3℃) for 45 minutes.

[0234] 11) Repeat step 8.

[0235] 12) Add 100 μL of chromogenic substrate TMB to each well, protect from light, and incubate at room temperature (25℃±3℃) for 5-30 minutes.

[0236] 13) Add 100 μL of stop solution to each well. The color will change from blue to yellow. If the color is green or the color change is significantly uneven, gently tap the plate frame to mix thoroughly.

[0237] 14) Within 30 minutes, perform dual-wavelength detection using a microplate reader, measuring the OD value at the maximum absorption wavelength of 450 nm and the reference wavelength of 570 nm or 630 nm. The calibrated OD value is the measurement value at 450 nm minus the measurement value at 570 nm or 630 nm. Using only 450 nm for measurement will result in an overestimation of the OD value and reduced accuracy.

[0238] 15) First, fit the standard curve, then generate the sample concentrations. Use Graphpad Pism 9.5 for data analysis.

[0239] 3. ELISA detection of IL-18 secretion:

[0240] The secretion of IL-18 was detected using the Human IL-18 ELISA Kit (EK118 / 2) from Linko Biotechnology.

[0241] (1) Experimental preparation:

[0242] Before testing, please bring all reagents and samples to room temperature (25℃±3℃). If concentrated reagents crystallize, incubate at 37℃ until all crystals dissolve.

[0243] 1× Washing Solution: Pipette 50 mL of 20× concentrated washing solution into a 1 L graduated cylinder, add distilled water to a final volume of 1,000 mL, and mix gently, avoiding foaming. Transfer to a clean bottle. Store at 2-8°C; 1× washing solution is stable for 30 days.

[0244] 1× Detection Buffer: Pipette 5 mL of 10× concentrated detection buffer into a 100 mL graduated cylinder, add distilled water to a final volume of 50 mL, and mix gently, avoiding foaming. Store at 2-8℃. 1× detection buffer is stable for 30 days.

[0245] Antibody preparation: Mix thoroughly before dilution. Dilute the concentrated antibody 1:100 with 1× test buffer, depending on the quantity of standards and samples to be tested. Use the diluted antibody within 30 minutes.

[0246] Standards: Briefly centrifuge before opening, then reconstitute the standard with distilled water, labeling the reconstituted volume on the standard label. Gently vortex to ensure thorough mixing; the reconstituted standard concentration is 20 ng / mL. Let stand for 10-30 minutes after reconstitution. Mix thoroughly before dilution. Take 200 μL of concentrated human IL-18 standard and add 200 μL of standard diluent to obtain the highest concentration of the standard curve (IL-18: 10 ng / mL). Add 200 μL of standard diluent to each test tube. Perform 1:1 serial dilutions using the high-concentration standard. Ensure thorough mixing after each pipette transfer. Use the standard diluent as the zero concentration of the standard curve. Take 200 μL of concentrated human IL-18 standard and add 200 μL of cell culture medium to obtain the highest concentration of the standard curve (IL-18: 10 ng / mL). Add 200 μL of cell culture medium to each test tube. Perform 1:1 serial dilutions using the high-concentration standard. Ensure thorough mixing with each pipette. Use cell culture medium as the zero concentration for the standard curve.

[0247] (2) Formal testing

[0248] Before testing, equilibrate all reagents and samples to room temperature (25℃±3℃).

[0249] 1) Prepare all necessary reagents and working concentration standards.

[0250] 2) Remove the unwanted slats, put them back into the aluminum foil bag containing the desiccant, and reseal the bag.

[0251] 3) Add 300 μL of 1× washing buffer and let it soak for 30 seconds. Soaking is necessary to obtain ideal experimental results. After discarding the washing buffer, pat the microplate dry on absorbent paper. Use the microplate immediately after washing; do not allow it to dry.

[0252] 4) Add 100 μL of serially diluted standard to the standard wells. Add 100 μL of standard dilution buffer (serum / plasma sample) or culture medium (cell culture supernatant sample) to the blank wells.

[0253] 5) Add 100 μL of cell culture supernatant to the sample well.

[0254] 6) Add 50 μL of diluted detection antibody (1:100) to each well. Ensure that steps 4, 5, and 6 are performed consecutively without interruption. The sample addition process should be completed within 15 minutes.

[0255] 7) Seal the plate using a sealing film. Shake at 100-300 rpm (ensure that the solution in each well is not spilled and is thoroughly mixed), and incubate at room temperature (25℃±3℃) for 2 hours.

[0256] 8) Discard the liquid, add 300 μL of washing buffer to each well, and wash the plate 6 times. After each wash, pat the plate dry on absorbent paper. To obtain ideal experimental performance, residual liquid must be completely removed.

[0257] 9) Add 100 μL of chromogenic substrate TMB to each well, protect from light, and incubate at room temperature (25℃±3℃) for 5-30 minutes.

[0258] 10) Add 100 μL of stop solution to each well. The color will change from blue to yellow. If the color is green or the color change is significantly uneven, gently tap the plate frame to mix thoroughly.

[0259] 11) Within 30 minutes, perform dual-wavelength detection using a microplate reader, measuring the OD value at the maximum absorption wavelength of 450 nm and the reference wavelength of 570 nm or 630 nm. The calibrated OD value is the 450 nm measurement value minus the 570 nm or 630 nm measurement value. Using only 450 nm for measurement will result in an overestimation of the OD value and reduced accuracy.

[0260] 12) First, fit the standard curve, then generate the sample concentrations. Use Graphpad Pism 9.5 for data analysis.

[0261] Table 4. Inhibitory effects of compounds on the release of IL-1β and IL-18

[0262] Compound numbering <![CDATA[IL-1β inhibition rate IC 50 (nM)]]> <![CDATA[IL-18 inhibition rate IC 50 (nM)]]> LC-04-045 25.34 30.99 MCC950 36.81 24.64

[0263] As shown in Table 4, compound LC-04-045 significantly downregulated the levels of cytokines IL-1β and IL-18 in human primary peripheral blood mononuclear cells (hPBMCs).

[0264] Figure 1 and Figure 2 The results of Western blotting analysis of the compounds of this invention, as well as the detection results of IL-1β and IL-18, are shown. The compounds of this invention are able to effectively degrade the substrate protein NEK7 in human acute lymphoblastic leukemia cells (Molt-4) and human primary peripheral blood mononuclear cells (hPBMCs).

[0265] It should be noted that, in the description herein, unless otherwise stated, "above" and "below" include the number itself, and "multiple" in "one or more" means two or more. Relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0266] In the description of this specification, the references to terms such as "any embodiment / mode," "one embodiment / mode," "some embodiments / modes," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment / mode or example is included in at least one embodiment / mode or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment / mode or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments / modes or examples. Furthermore, without contradiction, those skilled in the art can combine and integrate the different embodiments / modes or examples described in this specification, as well as the features of different embodiments / modes or examples.

[0267] The above description of the invention is not intended to describe every disclosed embodiment or implementation. Instead, exemplary embodiments are described in more detail below. These embodiments can be used in various combinations. The examples listed are representative only and should not be construed as exhaustive.

[0268] The above are merely specific embodiments of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. An imidazopiperazine heterocyclic compound, characterized in that, It has the structure shown in equation (I): in: X represents carbonyl or methylene; W represents H or methyl; R represents one or more of H, -CO-Y, and -CH2-Y; Y represents one or more of the following: substituted or unsubstituted cyclic hydrocarbon group, saturated heterocyclic group, and aromatic group; The number of substituents in Y ranges from 0 to 4, and the types of substituents may be the same or different.

2. The imidazopiperazine heterocyclic compound according to claim 1, characterized in that: The cyclic hydrocarbon group is a cycloalkane having 3 to 7 carbon atoms; and / or, The saturated heterocyclic group is a saturated five- to seven-membered ring group having one or two heteroatoms, wherein the heteroatoms are one or more of O, N, and S; and / or, The aromatic group is one or more of phenyl, heteroaryl, and fused-ring aryl.

3. The imidazopiperazine heterocyclic compound according to claim 2, characterized in that: The saturated heterocyclic group is an alkylene oxide or a cyclooxygenated alkylene oxide; and / or... The heteroaryl group is an unsaturated five- or six-membered ring having one or two heteroatoms; the heteroatoms are one or more of O, N, and S; and / or, The fused-ring aryl group includes one or more of the following: fused-ring alkyl phenyl, fused-ring heteroaryl, fused-ring heterophenyl, fused-ring heteroaryl, benzo[a]heteroaryl, fused-ring alkyl naphthyl, fused-ring heteroaryl naphthyl, fused-ring alkyl anthracel, and fused-ring heteroaryl anthracel.

4. The imidazopiperazine heterocyclic compound according to claim 3, characterized in that: The saturated heterocyclic group is one or more of epoxypentyl, cyclothiopentyl, p-thionitrohexacycloyl, and p-oxynitrohexacycloyl; and / or, The heteroaryl group is one or more of pyrroleyl, thiophenyl, furanyl, thiazolyl, pyrazolyl, imidazoleyl, pyridinyl, pyridinyl, pyrazinyl, oxazolyl, and pyrimidinyl; and / or, The fused-ring aryl group is one or more of benzopyrazinyl, naphthyl, pyridylpyrrole, benzimidazolyl, benzo-p-oxohexaneyl, and imidazo-p-nitrohexaneyl.

5. The imidazopiperazine heterocyclic compound according to claim 1, characterized in that: The substituent of Y is one or more of a halogen atom, a cyano group, or a substituted or unsubstituted Z group, wherein the Z group is one of a lower alkyl group, a lower alkoxy group, a saturated heterocyclic group, a phenoxy group, a benzoxy group, an aniline group, a heteroaryl group, or a phenyl group; and / or, The number of substituents in the Z group is 0–4, and each substituent is independently selected from halogen, cyano, alkyl, and alkoxy groups; and / or, Lower alkyl and / or lower alkoxy groups have 1 to 6 carbon atoms.

6. The imidazopiperazine heterocyclic compound according to claim 1, characterized in that: The imidazopiperazine heterocyclic compounds include at least one of the following compounds:

7. A pharmaceutical composition, characterized in that: The compound comprises one or more of the imidazopiperazine heterocyclic compounds of any one of claims 1 to 6, or pharmaceutically acceptable salts, enantiomers, stereoisomers, solvates, deuterates, and polymorphs thereof, in a therapeutically effective amount.

8. Use of the imidazopiperazine heterocyclic compound according to any one of claims 1 to 6 in the preparation of a medicament for the prevention and / or treatment of diseases related to the NEK7 protein.

9. Use of the imidazopiperazine heterocyclic compound according to any one of claims 1 to 6 in the preparation of a medicament for the prevention and / or treatment of diseases associated with NLRP3 inflammasomes.

10. Use of the imidazopiperazine heterocyclic compound according to any one of claims 1 to 6 in the preparation of a medicament for the prevention and / or treatment of IL-1β and / or IL-18-mediated related diseases.

Images