Recombinant adeno-associated virus vector for targeted delivery of VEGF-C (vascular endothelial growth factor-C) and application of recombinant adeno-associated virus vector in promoting endocardial differentiation to treat coronary heart disease

By specifically expressing VEGF-C in cardiac endothelial cells through the targeted delivery of a recombinant adeno-associated virus vector, the problems of short half-life and large side effects of VEGF-C protein in existing technologies have been solved. This enables endocardial differentiation and regeneration of coronary vessels in the myocardium, improving the treatment effect of myocardial infarction and heart failure.

CN121653188AActive Publication Date: 2026-03-13CHINA PHARM UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing technologies for treating myocardial infarction and heart failure have problems such as reperfusion injury risk, difficulty in controlling immune inflammatory response, large drug side effects, vascular leakage and over-dilation in VEGF-A therapy, and the short half-life of VEGF-C protein makes it difficult to apply effectively.

Method used

A recombinant adeno-associated virus vector (rAAV) targeting VEGF-C was constructed and packaged into rAAV particles for cardiac gene therapy. The VEGF-C protein or its functional variants were specifically expressed in cardiac endothelial cells by a tissue-specific promoter such as the ICAM2 promoter.

Benefits of technology

It significantly promotes endocardial differentiation and regeneration of intramyocardial coronary vessels, improves cardiac pumping function, reduces cardiac fibrosis, inhibits inflammatory response, and enhances cardiac function recovery, which is superior to direct administration of VEGF-C protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653188A_ABST
    Figure CN121653188A_ABST
Patent Text Reader

Abstract

The invention discloses a recombinant adeno-associated virus vector for targeted delivery of VEGF-C (vascular endothelial growth factor-C) and application of the recombinant adeno-associated virus vector in promoting endocardial differentiation to treat coronary heart disease. The rAAV vector comprises transgene for coding VEGF-C protein or VEGF-C protein functional variant and a tissue-specific promoter operably connected to the transgene, wherein the tissue specific promoter is capable of driving the transgene to be specifically expressed in the heart endothelial cells. According to the treatment method developed by the invention, specific expression of the Vegfc gene in the heart is driven by using an ICAM2 promoter with targeting to endothelial cells, and a remarkable curative effect is shown in a myocardial infarction model mouse. The therapeutic scheme provides a new effective strategy for intervention and treatment of myocardial infarction and chronic heart failure, and has the advantages of high safety, long gene expression duration, extremely low immune response to a host and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to a recombinant adeno-associated virus vector (rAAV) that targets and delivers VEGF-C (vascular endothelial growth factor C) and its application in promoting endocardial differentiation to treat coronary heart disease. Background Technology

[0002] Cardiovascular disease is a leading cause of death worldwide, with acute myocardial infarction and heart failure being major causes of death and disability. In the treatment of acute myocardial infarction, percutaneous coronary intervention (PCI) and coronary artery bypass grafting (CABG) are key measures to restore myocardial blood flow. However, while these revascularization techniques can open blocked vessels, they may carry the risk of reperfusion injury and are difficult to completely control the subsequent immune inflammatory response. Current drug treatments for heart failure include inotropic drugs and diuretics, but long-term use of drugs such as cardiac glycosides may carry the risk of toxicity, while diuretics may cause electrolyte disturbances. Despite the emergence of new drugs, heart failure patients may still face problems such as relapse and high readmission rates. Endothelial cell dysfunction and even vascular remodeling promote abnormal cardiac microcirculation, further inhibiting cardiac function. Promoting coronary angiogenesis can improve blood supply to the damaged heart, which is beneficial for the treatment of myocardial infarction and heart failure. However, coronary angiogenesis capacity is limited. Some classic pro-angiogenic factors, such as vascular endothelial growth factor A (VEGF-A), are currently not effective in promoting the formation of new coronary vessels in patients with myocardial infarction and have significant side effects. Vascular endothelial growth factor C (VEGF-C), a member of the VEGF family, not only promotes lymphangiogenesis but also stimulates angiogenesis during cardiac development. It also possesses anti-inflammatory properties and is less likely to cause vascular leakage and excessive dilation that may occur with VEGF-A therapy. After myocardial infarction, VEGF-C helps clear excess fluid and inflammatory cells from the interstitial space by stimulating lymphangiogenesis, reducing the inflammatory response, thereby improving cardiac function and inhibiting ventricular remodeling.

[0003] Recent studies have shown that coronary microvascular dysfunction is a key pathogenic factor in non-obstructive coronary artery disease and affects patient prognosis. VEGF-A, another major member of the VEGF family, while highly effective at stimulating angiogenesis, is prone to causing vascular leakage and excessive dilation. VEGF-C, on the other hand, not only promotes lymphangiogenesis but also stimulates angiogenesis and possesses certain anti-inflammatory properties. However, VEGF-C protein has a short half-life and rapidly degrades in vivo, limiting the clinical application of direct protein therapy; this provides a significant opportunity for gene therapy. Furthermore, the endocardium develops into partial coronary vessels during the embryonic and neonatal periods. However, in the adult heart, endocardial cells lose this ability. Finding new methods to promote coronary angiogenesis will be helpful in the clinical treatment of myocardial infarction or heart failure. Summary of the Invention

[0004] There is a need for improved treatment options for patients with myocardial infarction or heart failure. The purpose of this invention is to address the shortcomings of existing technologies by providing a recombinant adeno-associated virus vector (rAAV) that targets and delivers VEGF-C (vascular endothelial growth factor C) and its application in promoting endocardial differentiation to treat coronary heart disease.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] In a first aspect, the present invention claims protection for a recombinant adeno-associated virus vector for targeted delivery of VEGF-C, the vector comprising a transgene encoding a VEGF-C protein or a functional variant of the VEGF-C protein, and a tissue-specific promoter operatively linked to said transgene, wherein said tissue-specific promoter is capable of driving said transgene to be specifically expressed in cardiac endothelial cells.

[0007] The functional variant of the VEGF-C protein is a protein that has at least 70% sequence identity with wild-type VEGF-C and retains the function of promoting endocardial differentiation and angiogenesis.

[0008] As a preferred technical solution, the vector comprises, from 5' to 3', the following sequence: a first adeno-associated virus inverted terminal repeat (ITR) sequence, the tissue-specific promoter, the transgene, a Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), a polyadenylation (polyA) signal, and a second adeno-associated virus inverted terminal repeat (ITR) sequence.

[0009] Furthermore, the tissue-specific promoter is the ICAM2 promoter or the Tie2 promoter. Even further, the nucleotide sequence of the ICAM2 promoter is shown in SEQ ID NO:5 or SEQ ID NO:6.

[0010] Furthermore, the nucleotide sequence of the transgene encoding the VEGF-C protein is as shown in SEQ ID NO:1 (mouse Vegfc), SEQ ID NO:2 (human Vegfc), SEQ ID NO:3 (optimized human Vegfc sequence), or SEQ ID NO:4 (optimized mouse Vegfc sequence).

[0011] Furthermore, the nucleotide sequence of the first adeno-associated virus inverted terminal repeat sequence is shown in SEQ ID NO:7; the nucleotide sequence of the Woodchuck hepatitis virus posttranscriptional regulatory element is shown in SEQ ID NO:8; the nucleotide sequence of the polyadenylation signal is shown in SEQ ID NO:9; and the nucleotide sequence of the second adeno-associated virus inverted terminal repeat sequence is shown in SEQ ID NO:10.

[0012] Secondly, the present invention claims protection for a method for constructing the aforementioned recombinant adeno-associated virus vector, the method comprising: inserting a transgene encoding VEGF-C protein or a functional variant of VEGF-C protein into a linearized viral vector backbone psubCMV via seamless cloning; screening to obtain recombinant plasmids psubCMV-hVEGFC or psubCMV-mVegfc containing the transgene; and replacing the universal strong promoter in the recombinant plasmids psubCMV-hVEGFC or psubCMV-mVegfc with a tissue-specific promoter to obtain a recombinant adeno-associated virus vector that targets the delivery of VEGF-C.

[0013] In a specific embodiment of the present invention, the construction process of the recombinant adeno-associated virus vector is as follows: the hVEGFC or mVegfc cDNA fragment is seamlessly cloned into the viral vector backbone psubCMV, which has undergone corresponding linearization treatment, to obtain the recombinant plasmid psubCMV-hVEGFC or psubCMV-mVegfc; then, a tissue-specific promoter (such as the ICAM2 promoter) is used to replace the universal strong promoter (such as CMV): the ICAM2 promoter fragment is amplified from genomic DNA by PCR technology, and seamless cloning technology is used again to replace it in the position of the original promoter in the constructed psubCMV-hVEGFC or psubCMV-mVegfc plasmid, thereby constructing a new targeting vector psubICAM2-hVEGFC or psubICAM2-mVegfc.

[0014] More specifically, the construction process of the recombinant adeno-associated virus vector described above is as follows:

[0015] (1) Design primers to amplify the Vegfc cDNA fragment by high-fidelity PCR, or directly synthesize the optimized Vegfc gene codon sequence;

[0016] Taking mouse Vegfc (mVegfc, SEQ ID NO:1) and human VEGFC (hVEGFC, SEQ ID NO:2) as examples, the primers for amplifying the mVegfc DNA coding sequence include psubCMV-mVegfc_F and psubCMV-mVegfc_R; the primers for amplifying the hVEGFC DNA coding sequence include psubCMV-hVEGFC_F and psubCMV-hVEGFC_R.

[0017] Amplify the mVegfc DNA coding sequence:

[0018] psubCMV-mVegfc_F: GCGGCCGCTAGCGCCACCATGCACTTGCTGTGCTTCTTG

[0019] psubCMV-mVegfc_R: GATTATGCACGCGTTCAGTTCAGATGTGGCCTTT.

[0020] Amplification of hVEGFC DNA coding sequence:

[0021] psubCMV-hVEGFC_F: GCGGCCGCTAGCGCCACCATGATGCACTTGCTGGGCTTCTTCTCTG

[0022] psubCMV-hVEGFC_R: GATTATGCACGCGTTCATTAGCTCATTTGTGGTC;

[0023] (2) Primers were designed, and the linearized viral vector backbone was obtained by high-fidelity PCR amplification using psubCMV plasmid as a template. The primers for amplifying the linearized viral vector backbone are shown below:

[0024] psubCMV-Vector_F: TGAACGCGTGCATAATCAACC

[0025] psubCMV-Vector_R: CATGGTGGCGCTAGCGGCCGCGGGTAC;

[0026] (3) The linearized viral vector backbone obtained in step (2) is mixed with the Vegfc cDNA fragment or the optimized Vegfc gene codon sequence obtained in step (1) at a molar ratio of 1:1, and incubated with seamless cloning enzyme premix to obtain recombinant plasmid psubCMV-hVEGFC or psubCMV-mVegfc.

[0027] (4) Obtaining promoter fragments: Genomic DNA was extracted from human umbilical vein endothelial cells (HUVECs), and primers were designed using the extracted genomic DNA as a template to amplify the ICAM2 promoter sequence by high-fidelity PCR; the primer sequences were either long or short ICAM2 primers.

[0028] ICAM2 promoter long sequence primers:

[0029] hICAM2Promoter_L_F: CCATGGGATTTGGGGTTCCCC

[0030] hICAM2Promoter_L_R: AGATGGTGGGCGCAGGTCTG

[0031] ICAM2 promoter short sequence primers:

[0032] hICAM2Promoter_S_F: CCAAGGGCTGCCTGGAGG

[0033] hICAM2Promoter_S_R: CTAGAACGAGCTGGTGCACG

[0034] (5) Preparation of linearized vector backbone: Using the recombinant plasmid psubCMV-Vegfc constructed in step (3) as a template, primers were designed and amplified by high-fidelity PCR to obtain a linearized vector backbone without promoter; the primers are the primers required for the preparation of long linearized vector fragments of ICAM2 promoter or the primers required for the preparation of short linearized vector fragments of ICAM2 promoter.

[0035] Primers required for preparing ICAM2 promoter long sequence linearized vector fragments:

[0036] psubCMV-promoter_L_F: GACCTGCGCCCACCATCTCGTTTAGTGAACCGTCAG

[0037] psubCMV-promoter_L_R:GAACCCCAAATCCCATGGCATGGTAATAGCGATGAC

[0038] Primers required for preparing ICAM2 promoter short sequence linearized vector fragments:

[0039] psubCMV-promoter_S_F:CCCTCCAGGCAGCCCTTGGCATGGTAATAGCGATGAC

[0040] psubCMV-promoter_S_R: CACCAGCTCGTTCTAGCGTTTAGTGAACCGTCAG.

[0041] (6) Seamless cloning assembly: The ICAM2 promoter fragment obtained in step (4) and the linearized vector skeleton obtained in step (5) are mixed in a 1:1 molar ratio and connected using seamless cloning technology to obtain the targeting vector psubICAM2-hVEGFC or psubICAM2-mVegfc.

[0042] Thirdly, the present invention claims protection for a recombinant adeno-associated virus particle, the virus particle comprising the aforementioned recombinant adeno-associated virus vector, and an AAV capsid protein packaging the vector. Further, the AAV capsid protein is the AAV9 serotype capsid protein.

[0043] The preparation process of this recombinant adeno-associated virus (rAAV) particle can be as follows: The constructed recombinant adeno-associated virus vector psubICAM2_S-mVegfc targeting VEGF-C delivery, a plasmid providing the serotype capsid protein, and an adenovirus gene plasmid providing necessary helper functions are co-transfected into HEK293T (or 293AAV) packaging cells at a molar ratio of 1:1:1. Within the packaging cells, the recombinant vector replicates and is packaged under the influence of the helper plasmid and the intracellular environment, forming infective rAAV virus particles. These particles are then purified to obtain the rAAV virus particles.

[0044] Fourthly, the present invention claims protection for a pharmaceutical composition for treating heart disease, the pharmaceutical composition comprising the above-described recombinant adeno-associated virus particles, and a pharmaceutically acceptable carrier or excipient.

[0045] Fifthly, the present invention claims protection for the use of the above-described recombinant adeno-associated virus vector, the above-described recombinant adeno-associated virus particles, or the above-described pharmaceutical composition in the preparation of a medicament for treating heart disease.

[0046] In a sixth aspect, the present invention claims protection for a method of treating heart disease in a subject, the method comprising administering to a subject in need a therapeutically effective amount of the above-described recombinant adeno-associated virus (rAAV) particles, or the above-described pharmaceutical composition.

[0047] Furthermore, the administration method is intravenous injection, intraperitoneal injection, or intramyocardial injection.

[0048] In the technical solution of this invention, the heart disease is coronary heart disease, myocardial infarction, or heart failure.

[0049] This invention develops compositions and methods for cardiac gene therapy in subjects with heart disease (e.g., coronary artery disease, myocardial infarction, and heart failure). The core of this approach lies in utilizing a modified recombinant adeno-associated virus vector (rAAV) to efficiently target and express the Vegfc gene into cardiac endothelial cells, thereby activating the VEGFR2 / 3 signaling pathway, promoting endocardial differentiation and regeneration of coronary vessels within the myocardium, inhibiting inflammatory responses and myocardial fibrosis, and promoting the recovery of cardiac function.

[0050] The compositions and methods of this invention are based on the discovery that VEGF-C protein can effectively promote endocardial differentiation and regeneration of coronary vessels within the myocardium in newborn and adult mice. Specific expression in cardiac endothelial tissue significantly improves cardiac pumping function after myocardial infarction or heart failure, reduces the occurrence of cardiac fibrosis, promotes endocardial differentiation and regeneration of coronary vessels within the myocardium and functional recovery of the endothelium (including inhibiting lipid uptake and restoring vascular remodeling capacity), and reduces inflammatory cell infiltration. The multiple biological effects of VEGF-C protein collectively contribute to the long-term improvement of cardiac function.

[0051] This invention further provides a specific method for preparing the aforementioned recombinant adeno-associated virus particle rAAV-ICAM2-Vegfc. This rAAV particle contains a recombinant AAV genome packaged with a capsid protein, which integrates a transgene encoding the VEGF-C protein or a functional variant thereof. The vector design includes a tissue-specific promoter to ensure targeted expression of the transgene in cardiac endothelial cells. Such rAAV particles can be used for the development of drugs for the treatment of heart disease. In the rAAV vector of this invention, the rep / cap is removed and replaced with an expression cassette (containing the promoter -Vegfc-WRPE-polyA), while the ITR is retained to mediate genome packaging and replication. The viral capsid can be selected from serotypes such as AAV9 to improve the transfection efficiency of cardiac endothelial cells.

[0052] The present invention also provides a recombinant adeno-associated virus (rAAV) vector for delivering a transgene into the cardiac endothelium of a subject. The rAAV vector contains a transgene encoding a VEGF-C protein. The rAAV vector may, from 5' to 3', sequentially comprise: a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operatively linked to the transgene, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the transgene is linked to a single promoter. In other embodiments, the transgene is operatively linked to a tandem dual promoter system to enhance its specificity. In some embodiments, the rAAV vector further contains at least one polyadenylation signal (e.g., at 3' of two transgenes expressed from a single promoter, or at 3' of one or two transgenes expressed from different promoters). In one specific embodiment, the rAAV vector comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a transgene sequence, and a promoter operatively linked to the transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence, wherein the transgene contains Vegfc.

[0053] In this invention, "transgenic" refers to a gene or genetic material that has been naturally or through any of a variety of genetic engineering techniques transferred from one organism to another. The transgenic can be a gene encoding a target protein or polypeptide (e.g., VEGF-C) or a target RNA (e.g., siRNA or microRNA). The rAAV vector of this invention contains the target protein VEGF-C and its variants, along with an optimized coding sequence. By rationally designing the rAAV vector structure, selecting a specific promoter, and optimizing the transgenic sequence, this invention achieves efficient and specific expression of VEGF-C in cardiac endothelial cells, providing a new and effective means for gene therapy of heart disease.

[0054] As used in this invention, the term "variant" refers to a nucleic acid that deviates from the characteristics of naturally occurring nucleic acids. For example, a "variant" has at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or at least about 99.9% identity with a wild-type nucleic acid. For example, a transgenic variant is a nucleic acid that contains one or more nucleotide substitutions relative to its wild-type sequence. These substitutions can be silent, i.e., they do not modify any amino acid sequence encoding a protein (or otherwise produce a variant amino acid sequence). Alternatively, these substitutions can result in modification of the amino acid sequence encoding a protein, resulting in the encoded protein having one or more amino acid substitutions relative to the wild-type protein sequence (e.g., having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10 to 15, or 15 to 20 amino acid substitutions). These substitutions include chemical modifications and truncation. In some embodiments, proteins with one or more amino acid substitutions retain the function of wild-type proteins, or retain substantially the same function as wild-type proteins (e.g., at least 25%, at least 50%, at least 75%, such as 50% to 75%, or 75% to 100% of the function). The term also includes functional fragments of wild-type nucleic acid sequences.

[0055] In some embodiments, the disclosed transgene is a naturally occurring sequence. In some embodiments, one or more transgenes are modified to be species-specific (e.g., mouse, human). In some embodiments, the Vegfc gene is codon-optimized. Some non-limiting examples of Vegfc cDNA sequences are listed in the sequence listing.

[0056] This invention also relates to recombinant AAV vectors for gene therapy of coronary artery disease (primarily myocardial infarction and heart failure) that can be used to promote endocardial differentiation and regeneration. The term "vector" as used herein can refer to a nucleic acid vector (e.g., a plasmid or recombinant viral genome), a wild-type AAV genome, or a virus containing a viral genome.

[0057] The wild-type AAV genome is a single-stranded deoxyribonucleic acid (ssDNA) with either a sense or a sense negative. The genome contains two inverted terminal repeats (ITRs) (one at each end of the DNA strand) and two open reading frames (ORFs) between the ITRs: rep and cap. The rep ORF contains four overlapping genes encoding the Rep protein required for the AAV life cycle. The cap ORF contains overlapping genes encoding capsid proteins: VP1, VP2, and VP3, which interact to form the viral capsid. VP1, VP2, and VP3 are translated from an mRNA transcript that can be spliced ​​in two different ways. Longer or shorter introns can be excised, resulting in two mRNA isoforms: approximately 2.3 kb- and approximately 2.6 kb-long mRNA isoforms. The capsid forms a supramolecular assembly of approximately 60 individual capsid protein subunits, forming a non-enveloped T-1 icosahedral lattice that protects the AAV genome. Mature AAV capsids are composed of VP1, VP2 and VP3 (with molecular weights of approximately 87, 73 and 62 kDa, respectively) in a ratio of approximately 1:1:10.

[0058] Recombinant AAV (rAAV) particles may comprise a recombinant nucleic acid vector (hereinafter referred to as "rAAV vector"), which may comprise at least: (a) one or more heterologous nucleic acid regions containing a sequence encoding a transgene; and (b) one or more regions containing a sequence that promotes the integration of the heterologous nucleic acid region (optionally with one or more nucleic acid regions containing a sequence that promotes expression) into the genome of the target. In some embodiments, the sequence that promotes the integration of the heterologous nucleic acid region (optionally with one or more nucleic acid regions containing a sequence that promotes expression) into the genome of the target is an inverted terminal repeat (ITR) sequence (e.g., a wild-type ITR sequence or a modified ITR sequence) flanking one or more nucleic acid regions (e.g., the heterologous nucleic acid region). The ITR sequence may be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). The first serotype provided herein is AAV9 serotype.

[0059] In some embodiments, the rAAV vector of the present invention contains a Vegfc transgene for delivery and expression in a target. Therefore, in some embodiments, the rAAV vector contains one or more regions containing a sequence that promotes the expression of the transgene (e.g., a heterologous nucleic acid), such as an expression control sequence operatively linked to a nucleic acid. Many such sequences are known in the art. Expression control sequences include promoters, response elements, introns, start sites, termination sequences, WPRE elements, and poly(A) signals. In some embodiments, the rAAV vector contains a promoter operatively linked to a coding sequence of the transgene and promoting the expression of that transgene.

[0060] As used herein, a “promoter” refers to a control region of a nucleic acid where the initiation and rate of transcription of the remainder of the nucleic acid sequence are controlled. A promoter drives the transcription of the nucleic acid sequence it regulates; therefore, it is typically located at or near the gene transcription start site. Promoters can have a length of, for example, 100 to 1000 nucleotides. In some embodiments, the promoter is operatively linked to a nucleic acid or nucleic acid sequence (nucleotide sequence). A promoter is considered “operatively linked” to a sequence when it is in the correct functional position and orientation relative to the nucleic acid sequence it regulates, for example, to control (“drive”) the initiation and / or expression of that sequence.

[0061] The promoters used in this invention may include any promoter capable of driving transgene expression in the cardiac endothelium of a subject. In some embodiments, the promoter may be a tissue-specific promoter. As used herein, a “tissue-specific promoter” refers to a promoter that functions only in a specific tissue type, such as endothelial cells. Therefore, a “tissue-specific promoter” cannot drive transgene expression in other tissue types. For example, the promoter may be, but is not limited to, a promoter derived from one of the following genes: tyrosine kinase receptor 2 (Tie2) and intercellular adhesion molecule (ICAM2) promoters.

[0062] In some embodiments, the rAAV vector of this disclosure also includes a WPRE element and a polyadenylation (pA) signal. Eukaryotic mRNA is typically transcribed into precursor mRNA. Processing of the precursor mRNA to produce mature mRNA includes a polyadenylation process. The polyadenylation process begins upon termination of gene transcription. First, the 3' end of the newly generated precursor mRNA is cleaved by a set of proteins. These proteins then synthesize a poly(A) tail at the 3' end of the RNA. The cleavage site typically contains a polyadenylation signal, such as AAUAAA. The poly(A) tail is important for nuclear export, translation, and stability of mRNA. The WPRE element can increase viral yield.

[0063] In some specific embodiments, the rAAV vector of the present invention comprises at least: from 5' to 3' a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operatively linked to the first transgene, a WPRE element, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0064] This invention provides a targeted gene therapy for treating myocardial infarction or heart failure. The method involves administering a recombinant adeno-associated virus (rAAV) vector targeting cardiac endothelial cells to the recipient to achieve specific expression of the Vegfc gene in the heart, thereby promoting endocardial differentiation and regeneration and vascular remodeling, and ultimately improving cardiac function.

[0065] The core advantage of the method described in this invention lies in its ability to significantly reduce cardiac endothelial dysfunction, inhibit myocardial fibrosis, and effectively promote cardiac function recovery after myocardial infarction or chronic heart failure, through the aforementioned mechanism. This treatment regimen simultaneously targets key pathological processes in the occurrence and development of coronary heart disease, providing a new and effective strategy for the intervention and treatment of myocardial infarction and chronic heart failure. Gene therapy based on recombinant adeno-associated virus (rAAV) has advantages such as high safety, long-lasting gene expression, and extremely low host immune response.

[0066] The key technical point of this invention is:

[0067] 1. The effectiveness of VEGF-C protein in promoting endocardial differentiation and the formation of intramyocardial coronary vessels;

[0068] 2. VEGF-C was delivered via an AAV vector targeting endothelial cells using the ICAM2 promoter to achieve endothelial cell-specific expression.

[0069] 3. The effectiveness of rAAV vector delivery of Vegfc in promoting the formation of intramyocardial coronary vessels in the endocardium and promoting the recovery of cardiac function after myocardial infarction or heart failure.

[0070] The beneficial effects of this invention are:

[0071] Under the same dosage conditions, the endothelial-targeted rAAV9-ICAM2_S-mVegfc treatment group provided by this invention, compared with the empty vector control group, significantly promoted angiogenesis and lymphatic regeneration in the hearts of mice with myocardial infarction, and effectively reduced the ischemic area of ​​the heart by 60%–70%. Simultaneously, cardiac function was significantly improved, with ejection fraction (EF) and left ventricular shortening fraction (FS) increasing by 50%, respectively. Its effect on promoting vascular remodeling and functional recovery was superior to intravenous administration of VEGF-C protein. Furthermore, this invention uses codon-optimized mouse / human Vegfc gene sequences (SEQ ID NO: 3, 4) and prepares high-purity, high-titer rAAV viral particles using a eukaryotic system. Attached Figure Description

[0072] Figure 1 This is the original plasmid map;

[0073] In this image, A represents the original psubCMV plasmid map; B represents the original psubICAM2_L plasmid map; and C represents the original psubICAM2_S plasmid map.

[0074] Figure 2 Electrophoretic patterns of the human ICAM2 promoter, Vegfc gene, and psubCMV-hVEGFC linearized DNA product of the present invention; schematic diagrams of the construction of psubCMV-mVegfc plasmid and psubCMV-hVEGFC plasmid; and schematic diagram of psubCMV-mVegfc / psubCMV-hVEGFC plasmid replacing the ICAM2 promoter.

[0075] In Example 2, A represents the linearized fragments of the hVEGFC-cDNA fragment and the psubCMV vector backbone, along with the mVegfc-cDNA fragment and the psubCMV vector backbone, cloned using a high-fidelity enzyme; B represents the human ICAM2 promoter fragment and its short fragment obtained in Example 3; C represents the recombinant plasmid psubCMV-mVegfc constructed by ligating the mVegfc-cDNA fragment to the original psubCMV plasmid in Example 1; D represents the recombinant plasmid psubCMV-hVEGFC constructed by ligating the hVEGFC-cDNA fragment to the original psubCMV plasmid in Example 2; and E represents the splicing of the psubCMV-mVegfc or psubCMV-hVEGFC linearized fragments with homologous adapters to the human ICAM2 promoter fragment and its short fragment obtained in Example 3.

[0076] Figure 3The graph shows the statistical changes in Vegfc expression verified by real-time quantitative PCR after HEK.293T cells were transfected with psubCMV, psubCMV-hVEGFC, psubICAM2_S-hVEGFC, and psubICAM2_L-hVEGFC of the present invention.

[0077] Figure 4 To verify the statistical graph of Vegfc gene expression changes after HEK.293T cells were infected with rAAV9-ICAM2_S (empty vector control), rAAV9-CMV-mVgefc and rAAV9-ICAM2_S-mVegfc of the present invention, real-time quantitative PCR was used.

[0078] Figure 5 Using the rAAV9-ICAM2_S-mVegfc of the present invention to infect the hearts of newborn mice, it was found that cardiac endothelial cells (red) generated coronary vessels in the inner lining of the hearts of newborn mice in the VEGF-C group;

[0079] In this figure, A shows the expression changes of Ki67 (white) in vascular endothelial cells (green) and Ki67 (white) in endocardial marker endothelial cells (red) in neonatal mice after infection with rAAV9-ICAM2_S-mVegfc; B shows the distribution changes of endocardial marker endothelial cells (red) and endocardial molecular marker Plvap (cyan) in the endocardial region after infection of the heart of neonatal mice with rAAV9-ICAM2_S-mVegfc (mouse).

[0080] Figure 6 After infecting mice with the rAAV9-ICAM2_S-mVegfc of this invention, it was found that cardiac endothelial cells (red) generated adult cardiac inner coronary vessels in the VEGF-C group; the rAAV9-ICAM2_S-mVegfc group significantly promoted the normalization of coronary vessels after myocardial infarction and reduced the infiltration of inflammatory cells;

[0081] In the figure, A shows the distribution changes of the right ventricular endothelial cells (red) and the lymphatic endothelial cell molecular marker Lyve1 (white) after mice were infected with rAAV9-ICAM2_S-mVegfc; B and C show the distribution changes of the blood vessels (green, B) and lymphatic vessels (white, C) on the surface of the myocardial infarction area after mice were infected with rAAV9-ICAM2_S-mVegfc; D and E show the distribution changes of T lymphocytes (red, D) and macrophages (green, E) in the myocardial infarction area after mice were infected with rAAV9-ICAM2_S-mVegfc.

[0082] Figure 7The use of the rAAV9-ICAM2_S-mVegfc of the present invention to infect mice resulted in a significant recovery in cardiac M-mode ultrasound images, ejection fraction (EF%), and short-axis contraction rate (FS%) 14 days after myocardial infarction surgery.

[0083] Figure 8 To infect mice with myocardial infarction using the rAAV9-ICAM2_S-mVegfc of the present invention;

[0084] In A, a transverse section of the heart stained with TTC within 14 days after myocardial infarction showed a significant reduction in the area of ​​myocardial infarction; in B, a transverse section of the heart stained with Masson's stain showed a significant reduction in the area of ​​myocardial infarction.

[0085] Figure 9 M-mode ultrasound images and ejection fraction (EF%) and short-axis contraction rate (FS%) of mice with aortic coarctation induced by the present invention were obtained by infecting mice with rAAV9-ICAM2_S-mVegfc of the present invention. The ejection fraction (EF%) and short-axis contraction rate (FS%) were significantly restored. Detailed Implementation

[0086] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make equivalent changes to the disclosed technical content to create equivalent embodiments. Any modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the present invention fall within the protection scope of the present invention.

[0087] Example 1: Obtaining the mouse Vegfc gene cDNA sequence and constructing the psubCMV-mVegfc delivery vector

[0088] Fresh bEND.3 cells (ATCC Cat. No CRL-2299) were used. Total RNA was extracted from the cells using Trizol, and cDNA was obtained by reverse transcription from the total RNA sample using the Abclone mRNA Reverse Transcriptase Kit. Vegfc cDNA (SEQ ID NO: 1) was further synthesized using a high-fidelity enzyme from Novizan, with upstream and downstream homologous adapters of psubCMV added to both ends. The adapter-added cDNA was then purified using the Novizan FastPure Gel DNA Extraction MiniKit. Specifically, a suitable region was selected as the insertion site at the multiple cloning site of the vector. In this vector, the insertion site was approximately 60 bp after the modified SV40 intron region containing splicing donor and acceptor sites following the CMV promoter sequence. In the design of the target gene sequence, a Kozak sequence was inserted to improve transcription efficiency; that is, GCCACC was inserted before the promoter codon of the inserted gene. The primers were designed using an 18 bp vector homologous sequence plus an 18 bp target gene sequence to synthesize the Vegfc cDNA and the linearized vector fragment. The reaction system uses a total volume of 50 μL, adding 1 unit of high-fidelity polymerase, 25 μL of premixed reaction solution, 1 μL each of the front and rear primers, and the template (5 μL for cDNA, or 0.75 μL for plasmid at a concentration of 20 ng / μL). The remaining volume is made up with pure water. For the preparation of linearized vector fragments, the reaction system should consist of 1 unit of high-fidelity polymerase, 25 μL of premixed reaction solution, 1 μL each of psubCMV-Vector_F / R primers (10 μM), and the template, i.e., the original psubCMV vector (AddGene Plasmid #119226, plasmid map shown). Figure 1Add 0.75 μL (20 ng / μL) of the premixed reaction solution (as shown in A) and bring the total volume to 10 μL with water. Pre-denature at 98°C for 30 seconds, then begin 25 reaction cycles: denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 120 seconds (extension rate 10 s / kb), and a final extension at 72°C for 1 min after each cycle. For cDNA fragment preparation, the reaction system should consist of 1 unit of high-fidelity polymerase, plus 25 μL of premixed reaction solution and 1 μL (10 μM) each of psubCMV-mVegfc_F / R primers. Add the template, i.e., 5 μL of the bEND.3 cell cDNA solution mentioned above (concentration not required). Pre-denature at 98°C for 30 seconds, then begin 35 reaction cycles: denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 15 seconds (extension rate 10 s / kb), and a final extension at 72°C for 1 min after each cycle. After the reaction, agarose gel electrophoresis (0.8%) was performed. The linearized vector fragment should be around 12000 bp, and the Vegfc cDNA fragment should be around 1200 bp. Following the FastPure Gel DNAExtraction Mini Kit manual, the linearized vector fragment and Vegfc-cDNA fragment were then gel-extracted to obtain the DNA fragment. After determining the concentration, seamless cloning was used to clone them into psubCMV (AddGene Plasmid #119226). Specifically, the linearized vector fragment and mVegfc DNA fragment were added to the reaction tube at a 1:1 molar ratio, along with an equal volume of seamless cloning enzyme premix. The mixture was incubated at 50°C for 15 minutes. The cells were then transformed into Stbl3 competent cells, plated on LB plates, and incubated at 37°C for 12 hours. Single colonies were then selected. These colonies were expanded, plasmids were extracted, and primers designed with 100 bp before and after the insertion site were used in an ABI 3730 gene sequencer for sequencing and alignment of the inserted fragment. Figure 2 As shown.

[0089] Primers required for linearized vector fragment preparation:

[0090] psubCMV-Vector_F: TGAACGCGTGCATAATCAACC

[0091] psubCMV-Vector_R: CATGGTGGCGCTAGCGGCCGCGGGTAC

[0092] Primers required for mVegfc cDNA sequence preparation:

[0093] psubCMV-mVegfc_F: GCGGCCGCTAGCGCCACCATGCACTTGCTGTGCTTCTTG

[0094] psubCMV-mVegfc_R:GATTATGCACGCGTTCAGTTCAGATGTGGCCTTT.

[0095] Example 2: Obtaining the human Vegfc gene cDNA sequence and constructing the psubCMV-hVEGFC delivery vector

[0096] Fresh HUVEC cells (AddGene Cat. No CRL-1730) were used. Total RNA was extracted from the cells using Trizol, and cDNA was obtained by reverse transcription from the total RNA sample using the Abclone mRNA Reverse Transcriptase Kit. VEGFC cDNA (SEQ ID NO: 2) was further synthesized using a Novozymes high-fidelity enzyme. Homologous adapters upstream and downstream of psubCMV were added to both ends of the cDNA, and the adapter-added cDNA was purified using the Novozymes FastPure Gel DNA Extraction MiniKit. Specifically, a suitable region was selected as the insertion site at the multiple cloning site of the vector. In this vector, the insertion site was approximately 60 bp after the modified SV40 intron region containing splicing donor and acceptor sites following the CMV promoter sequence. In the design of the target gene sequence, a Kozak sequence was inserted to improve transcription efficiency; that is, GCCACC was inserted before the promoter codon of the inserted gene. The primers were designed using an 18 bp vector homologous sequence plus an 18 bp target gene sequence to synthesize the VEGFC cDNA and the linearized vector fragment. The reaction system uses a total volume of 50 μL, adding 1 unit of high-fidelity polymerase, 25 μL of premixed reaction solution, 1 μL each of the front and rear primers, and template (5 μL for cDNA, or 0.75 μL for plasmid at a concentration of 20 ng / μL). The remaining volume is made up with pure water. For the preparation of linearized vector fragments, the reaction system should use 1 unit of high-fidelity polymerase, 25 μL of premixed reaction solution, 1 μL each of psubCMV-Vector_F / R primers (10 μM), and template (0.75 μL of the original psubCMV vector, 20 ng / μL). The total volume is then made up with water. Pre-denaturation is performed at 98 °C for 30 seconds, followed by 25 reaction cycles: denaturation at 98 °C for 10 seconds, annealing at 60 °C for 5 seconds, extension at 72 °C for 120 seconds (extension rate 10 s / kb), and a final extension at 72 °C for 1 minute. The reaction system for cDNA fragment preparation should consist of 1 unit of high-fidelity polymerase, plus 25 μL of premixed reaction solution and 1 μL (10 μM) each of psubCMV-hVEGFC_F / R primers. Add the template, i.e., 5 μL of the above HUVEC cell cDNA solution (concentration not required). Perform pre-denaturation at 98°C for 30 seconds, followed by 35 reaction cycles: denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 15 seconds (extension rate 10 s / kb), and a final extension at 72°C for 1 minute. Immediately after the reaction, perform agarose gel electrophoresis (0.8%). The linearized vector fragment should be approximately 12000 bp, and the VEGFC cDNA should be approximately 1200 bp.Following the FastPure Gel DNA Extraction Mini Kit user manual, the linearized vector fragment and VEGFC-cDNA fragment were then subjected to gel extraction to obtain DNA fragments. After concentration determination, the fragments were cloned into psubCMV (AddGene Plasmid #119226) using seamless cloning. Specifically, the linearized vector fragment and hVEGFC DNA fragment were added to a reaction tube at a 1:1 molar ratio, along with an equal volume of seamless cloning enzyme premix. The mixture was incubated at 50°C for 15 minutes. The resulting fragments were then transformed into Stbl3 competent cells, plated on LB agar plates, and incubated at 37°C for 12 hours. Single colonies were then selected. These colonies were expanded, plasmids were extracted, and primers designed with 100 bp before and after the insertion site were used in an ABI 3730 gene sequencer for sequencing and alignment of the inserted fragment.

[0097] Primers required for linearized vector fragment preparation:

[0098] psubCMV-Vector_F: TGAACGCGTGCATAATCAACC

[0099] psubCMV-Vector_R: CATGGTGGCGCTAGCGGCCGCGGGTAC

[0100] Primers required for hVEGFC cDNA sequence preparation:

[0101] psubCMV-hVEGFC_F: GCGGCCGCTAGCGCCACCATGATGCACTTGCTGGGCTTCTTCTCTG

[0102] psubCMV-hVEGFC_R: GATTATGCACGCGTTCATTAGCTCATTTGTGGTC.

[0103] Example 3: Obtaining the long and short sequences of the ICAM2 promoter and constructing the psubICAM2_L-hVEGFC / psubICAM2_S-hVEGFC and psubICAM2_S-mVegfc delivery vectors.

[0104] Fresh HUVEC cells were collected, digested using proteinase K and ribonuclease, and genomic DNA was enriched and purified using a commercially available tissue genomic extraction kit. Promoter primers (Gene ID: 3384) were designed based on the human ICAM2 promoter sequence near the 5' UTR region in the NCBI database. The promoter sequence and vector linearized fragment were synthesized using a high-fidelity enzyme from Novizan, such as... Figure 2 As shown.

[0105] Based on the psubCMV-hVEFGC vector obtained in Example 2, the original CMV sequence was replaced with the ICAM2 sequence. Specifically, primers with homologous sequences to the ICAM2 sequence were designed upstream and downstream of the CMV promoter in psubCMV-hVEFGC. The primer design used an 18bp vector homologous sequence plus an 18bp target gene sequence to synthesize human ICAM2 and the linearized vector fragment. The reaction system consisted of a total volume of 50µl, with 1 unit of high-fidelity polymerase added, 25µl of premixed reaction solution, 1µl each of the front and rear primers, and template (5µl for genomic DNA, or 0.75µl for plasmids at a concentration of 20ng / µl). The remaining volume was made up with pure water.

[0106] Taking the short-sequence ICAM2 promoter as an example, the reaction system for preparing the linearized vector fragment should consist of 1 unit of high-fidelity polymerase, plus 25 μL of premixed reaction solution and 1 μL (10 μM) each of psubCMV-promoter_S_F / R primers. Then, add the template, i.e., 0.75 μL (20 ng / μL) of psubCMV-hVEGFC, and bring the total volume to the desired level with water. Perform pre-denaturation at 98 °C for 30 seconds, followed by 25 reaction cycles: denaturation at 98 °C for 10 seconds, annealing at 60 °C for 5 seconds, extension at 72 °C for 120 seconds (extension rate 10 s / kb), and a final extension at 72 °C for 1 min after each cycle. The reaction system for preparing the short ICAM2 promoter DNA fragment should consist of 1 unit of high-fidelity polymerase, plus 25 μL of premixed reaction solution and 1 μL each of hICAM2Promoter_S_F / R primers (10 μM). Add the template, i.e., 5 μL of the HUVEC cell genomic DNA solution mentioned above (concentration not required). Perform pre-denaturation at 98°C for 30 seconds, followed by 35 reaction cycles: denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 10 seconds (extension rate 10 s / kb), and a final extension at 72°C for 1 minute. Immediately after the reaction, perform agarose gel electrophoresis (0.8%). The linearized vector fragment should be approximately 12000 bp, and the short ICAM2 promoter DNA fragment should be approximately 140 bp. Then, follow the FastPure Gel DNA Extraction Mini Kit user manual for gel extraction to obtain the DNA fragment. After determining the concentration, the plasmid was cloned into the psubCMV-hVEGFC vector using seamless cloning, replacing the CMV promoter. Specifically, using psubCMV-hVEGFC as a template, the linearized vector fragment amplified using psubCMV-promoter_S_F / R primers and the short ICAM2 promoter DNA fragment were added to a reaction tube at a 1:1 molar ratio, along with an equal volume of seamless cloning enzyme premix. The mixture was incubated at 50°C for 15 minutes. The resulting fragments were then transformed into Stbl3 competent cells, plated on LB agar plates, and incubated at 37°C for 12 hours. Single colonies were then selected. These colonies were expanded, and the plasmid was extracted. Primers designed with 100 bp before and after the insertion site were used in conjunction with the ABI 3730 gene sequencer for sequencing and alignment of the inserted fragment. The plasmid obtained using this method is psubICAM2_S-hVEGFC.

[0107] The modification method for replacing the CMV promoter in psubCMV-hVEGFC with a long-sequence ICAM2 promoter is the same as described above. The linearized vector fragment amplified using psubCMV-hVEGFC as a template and psubCMV-promoter_L_F / R as primers, and the long-sequence ICAM2 promoter DNA fragment cloned using hICAM2Promoter_L_F / R as a template, are seamlessly cloned at a molar ratio of 1:1. After transformation, single-clone screening, and sequencing alignment, the psubICAM2_L-hVEGFC plasmid with the long-sequence ICAM2 promoter is obtained.

[0108] The materials used for modifying psubICAM2_S-mVegfc were the same as described above. A linearized vector fragment amplified using psubCMV-mVegfc as a template and psubCMV-promoter_S_F / R as primers, and a short-sequence ICAM2 promoter DNA fragment cloned using HUVEC genomic DNA as a template and hICAM2Promoter_S_F / R as primers were seamlessly cloned at a molar ratio of 1:1. After transformation, single-clone screening, and sequencing comparison, the psubICAM2_S-mVegfc plasmid with the short-sequence ICAM2 promoter was obtained.

[0109] The materials used for modifying psubICAM2_L were the same as described above. The linearized vector fragment amplified using the original psubCMV vector (AddGene Plasmid #119226) mentioned in Example 1 as a template and psubCMV-promoter_L_F / R as primers, and the long-sequence ICAM2 promoter DNA fragment cloned using HUVEC genomic DNA as a template and hICAM2Promoter_L_F / R as primers, were seamlessly cloned at a molar ratio of 1:1. After transformation, single-clone screening, and sequencing comparison, the psubICAM2_L plasmid with the long-sequence ICAM2 promoter was obtained, and its plasmid map is shown below. Figure 1 As shown in B in the diagram.

[0110] The materials used for modifying psubICAM2_S were the same as described above. The linearized vector fragment amplified using the original psubCMV vector (AddGene Plasmid #119226) mentioned in Example 1 as a template and psubCMV-promoter_S_F / R as primers, and the short-sequence ICAM2 promoter DNA fragment cloned using HUVEC genomic DNA as a template and hICAM2Promoter_S_F / R as primers, were seamlessly cloned at a molar ratio of 1:1. After transformation, single-clone screening, and sequencing comparison, the psubICAM2_S plasmid with the short-sequence ICAM2 promoter was obtained, and its plasmid map is shown below. Figure 1 As shown in C.

[0111] Primers required for constructing plasmids psubICAM2-_L-hVEGFC / psubICAM2-_S-hVEGFC and psubICAM2-_S-mVegfc:

[0112] Primers required for preparing ICAM2 long-sequence linearized vector fragments:

[0113] psubCMV-promoter_L_F: GACCTGCGCCCACCATCTCGTTTAGTGAACCGTCAG

[0114] psubCMV-promoter_L_R:GAACCCCAAATCCCATGGCATGGTAATAGCGATGAC

[0115] ICAM2 long sequence primers:

[0116] hICAM2Promoter_L_F: CCATGGGATTTGGGGTTCCCC

[0117] hICAM2Promoter_L_R: AGATGGTGGGCGCAGGTCTG

[0118] Primers required for preparing ICAM2 short sequence linearized vector fragments:

[0119] psubCMV-promoter_S_F:CCCTCCAGGCAGCCCTTGGCATGGTAATAGCGATGAC

[0120] psubCMV-promoter_S_R: CACCAGCTCGTTCTAGCGTTTAGTGAACCGTCAG

[0121] ICAM2 short sequence primers:

[0122] hICAM2Promoter_S_F: CCAAGGGCTGCCTGGAGG

[0123] hICAM2Promoter_S_R: CTAGAACGAGCTGGTGCACG.

[0124] Example 4: Screening of ICAM2 promoter transcription efficiency

[0125] The selected positive clones containing the encoded protein sequence were cultured and expanded. Plasmids were extracted from *E. coli* using the Novizumab FastPure EndoFree Plasmid Mini Plus kit. These plasmids were then transfected into HEK.293T (Chinese Academy of Sciences Cell Bank, catalog number SCSP-502) or HUVEC cells for 8 hours using the Novizumab Perfect Transfection Kit, followed by normal culture for 48 hours. Real-time quantitative PCR was then used to examine the expression efficiency of the psubCMV-hVEGFC vector prepared in Example 2 and the psubICAM2_S-hVEGFC and psubICAM2_L-hVEGFC vectors prepared in Example 3. Figure 3 As shown, the short-sequence version psubICAM2_S-hVEGFC and the long-sequence versions psubICAM2_L-hVEGFC and psubCMV-hVEGFC all induced nearly a million-fold increase in the expression of human Vegfc in HUVEC cells. Since the expression level of the short ICAM2 sequence is higher than that of the long ICAM2 sequence, the short sequence was selected for in vivo experiments.

[0126] Example 5: Packaging, purification, and transfection efficiency verification of rAAV9-CMV-mVegfc and rAAV9-ICAM2_S-mVegfc

[0127] Prepare a plasmid mixture by mixing psubCMV-mVegfc or psubICAM2_S-mVegfc with AAV packaging / helper plasmids pBS-E2A-VAE4 (Addgene 112867) / p5E18-VP2 / 9 (Addgene 112865) at a molar ratio of 1:1:1 and a total plasmid amount of 34.5ug per 10cm culture dish. HEK.293T cells were transfected 8 h using the Novizan Perfect Transfection Kit and cultured normally for 48 h. Recombinant adeno-associated virus (AAV) particles prepared by packaging the AAV capsid protein into a recombinant AAV vector were obtained by ultracentrifugation with iodixanol. Iodixanol (Sigma, D1556) solutions were prepared in gradients of 15% (m / v), 25%, 40%, and 57%, with phenol red added to the 25% and 50% iodixanol solutions for colorimetric analysis. Cell lysis buffer was then loaded into Beckman ultracentrifuge tubes (C14304) at 15%, 25%, 40%, and 57% concentrations. The cells were centrifuged at 40,000 rpm for 2.5 h at 18°C ​​using a 50.2 Ti rotor. The purified AAV was extracted at 40% concentration (40%) and aliquoted into sterile tubes (200 μL per tube) and stored at -80°C. The titer was determined using real-time quantitative PCR. Primers were derived from the WPRE region of the psubCMV plasmid (Forward: 5'-TGAGTTTGGACAAACCACAAC-3'; Reverse: 5'-TTGTTGTTAACTTGTTTATTGCAGC-3'). Linearized plasmids were used as standards, and a standard curve was prepared by serial dilutions of 1:9 tenfold. Virus samples were diluted 10,000-fold, and after real-time quantitative PCR, the Ct values ​​were compared with the standard curve to obtain the viral copy number. Specifically, in this example, Ibrex SYBR enzyme RK21203 was used. In a 20µl system, 2µl of AAV sample or diluted standard was added, along with 0.4µl each of the primers and 10µl of SYBR enzyme, and the volume was brought to a minimum with water. The standard real-time quantitative PCR procedure was then performed according to the user manual to obtain the standard curve and the Ct values ​​of the samples. The x-axis of the standard curve is typically the logarithm of the plasmid copy number to the base ten. Real-time quantitative PCR is an economical and efficient method. Compared with other traditional methods for titer determination, such as UV absorbance and ELISA, real-time quantitative PCR directly amplifies the target DNA sequence, which can effectively reduce the influence of empty shell viruses. At the same time, it is more operable than ddPCR and requires less cost and equipment.

[0128] The obtained rAAV9-CMV-mVgefc and rAAV9-ICAM2_S-mVegfc were compared using a 1×10⁻⁶ mVegfc. 10Infection efficiency was verified in 293T cells using vg / ml, and the results were as follows: Figure 4 As shown, both rAAV9-CMV-mVgefc and rAAV9-ICAM2_S-mVegfc significantly promoted the expression of Vegfc in 293T cells.

[0129] Example 6: VEGF-C promotes the differentiation and proliferation of endocardium in newborn mice into coronary vessels of the myocardial lining.

[0130] The rAAV9-ICAM2_S-mVegfc constructed in Example 5 or the control empty vector (the control empty vector is the unmodified vector psubICAM2_S containing no target gene coding sequence, its map is as follows) Figure 1 Vector delivery (5x10) was performed in newborn mice (as shown in C). 10 (vp / mouse), after 7 days, it was clearly observed that VEGF-C effectively promoted the differentiation and proliferation of the endocardium into the coronary vessels of the inner lining of the heart in mice. Results as follows... Figure 5 In newborn mice, endothelial cells labeled with VEGF-C (red) generated significantly more coronary vessels in the inner lining of the heart than in the control empty vector group.

[0131] Example 7: VEGF-C promotes endocardial differentiation and proliferation into coronary vessels in the myocardium, especially in adult mice after myocardial infarction.

[0132] The rAAV9-ICAM2_S-mVegfc vector constructed in Example 5 or the control empty vector was delivered to adult mice (10). 11 (vp / mouse), after 7 days, it was clearly observed that VEGF-C could promote the differentiation and proliferation of the endocardium into the coronary vessels of the inner lining of the heart in mice, promote the normalization of coronary vessels after myocardial infarction, and reduce the inflammatory response. Results as follows... Figure 6 Endocardial markers (red) indicate the formation of coronary vessels in the inner lining of the adult heart in the VEGF-C group. The VEGF-C group significantly promoted the normalization of coronary vessels after myocardial infarction and reduced the infiltration of inflammatory cells.

[0133] Example 8: Verification of the effect of VEGF-C in promoting cardiac function recovery in mice with myocardial infarction

[0134] The rAAV9-ICAM2_S-mVegfc vector constructed in Example 5 or the control empty vector was delivered to a mouse model of myocardial infarction 3 days after modeling. Echocardiography was performed on the mice on days 14 and 28 post-delivery. Results are as follows... Figure 7The FS% (left ventricular fraction of shortening) in the ICAM2-mVegfc group was significantly higher than that in the control group (p<0.0001), and the EF% (ejection fraction) was also significantly higher than that in the control empty vector group (p=0.005), indicating that the VEGF-C gene delivery vector can significantly improve cardiac systolic function after myocardial infarction. FS% (left ventricular fraction of shortening) is an important indicator of cardiac systolic function, representing the percentage reduction in the short axis length of the left ventricle during cardiac contraction. EF% (ejection fraction) is another indicator of cardiac pumping efficiency, representing the percentage of blood ejected from the left ventricle during each cardiac contraction relative to the left ventricular end-fill volume.

[0135] Example 9: The effect of VEGF-C in alleviating myocardial fibrosis in mice with myocardial infarction.

[0136] The rAAV9-ICAM2_S-mVegfc vector constructed in Example 5 or the control empty vector were delivered. Heart tissue from mice was collected on days 14 and 28 post-myocardial infarction surgery and subjected to TTC staining. Results are as follows... Figure 8 In the experimental group (ICAM2-mVegfc), the white area representing the infarct region was significantly lower than that in the control group (p=0.0158). Heart tissue was harvested from mice in the control group on day 28 after myocardial infarction surgery, and sections were stained with Masson's solution. The area of ​​the blue fibrotic region in the experimental group was significantly lower than that in the control group (p=0.0062).

[0137] Example 10: The effect of VEGF-C on promoting cardiac function recovery in heart failure mice.

[0138] The rAAV9-ICAM2_S-mVegfc vector constructed in Example 5 or the control empty vector was delivered. A heart failure model was established by aortic coarctation surgery. On day 28 post-surgery, after mice exhibited significant decreased cardiac function, rAAV9-ICAM2_S-mVegfc or the empty vector was delivered. Three weeks after vector expression, ultrasound experiments were performed on the mice. Results are as follows... Figure 9 The FS% of the ICAM2-mVegfc group was significantly higher than that of the control group (p=0.0038), and the EF% was also significantly higher than that of the control group (p=0.0048), indicating that the VEGF-C gene delivery vector can significantly improve cardiac contractile function in mice after heart failure.

[0139] sequence list

[0140] Vegfc (house mouse (Mus musculus)) (NCBI reference sequence: NM_009506.2)

[0141]

[0142] Vegfc (Homo sapiens) (NCBI reference sequence: NM_005429.5)

[0143]

[0144] Vegfc (Homo sapiens) optimized sequence

[0145]

[0146] Vegfc (Mus musculus) optimized sequence

[0147]

[0148] Human ICAM2 promoter (Homo sapiens) sequence

[0149] CCATGGGATTTGGGGTTCCCCAGATCTGGGGCTTGTAGGCCTGACTCTCCCCTGTGCACACGTCTCATACACGCATGCGTGCACCCATTGCCTGCCCCGCCCCTTGCACAGGGAGTCAGCAGGGAGGACTGGGTTATGCCCTGCTTATCAGCAGCTTCCCAGCTTCCTCTGCCTGGATTCTTAGAGGCCTGGGGTCCTAGAACGAGCTGGTGCACGTGGCTTCCCAAAGATCTCTCAGATAATGAGAGGAAATGCAGTCATCAGTTTGCAGAAGGCTAGGGATTCTGGGCCATAGCTCAGACCTGCGCCCACCATCT (SEQ ID NO: 5)

[0150] Short sequence of human ICAM2 promoter (Homo sapiens)

[0151] CCAAGGGCTGCCTGGAGGGAGATGGTGGGCGCAGGTCTGAGCTATGGCCCAGAATCCCTAGCCTTCTGCAAACTGATGACTGCATTTCCTCTCATTATCTGAGAGATCTTTGGGAAGCCACGTGCACCAGCTCGTTCTAG (SEQID NO: 6)

[0152] 5' end ITR sequence:

[0153] GTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGAATTCGAGCTTGCATGCCTGCAGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG(SEQ ID NO: 7)

[0154] WPRE sequence:

[0155] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC(SEQ ID NO:8)

[0156] Polyadenylation sequence:

[0157] GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAAGCTGCTGCAATAAACAAGTT(SEQ IDNO: 9)

[0158] 3' - end ITR sequence:

[0159] CCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGACCTGCAGGCATGCAAGCTCGAATTCTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTAC(SEQ ID NO: 10)。

Claims

1. A recombinant adeno-associated virus vector for targeted delivery of VEGF-C, characterized in that, The vector contains a transgene encoding a VEGF-C protein and a tissue-specific promoter operatively linked to the transgene, wherein the tissue-specific promoter is capable of driving the transgene to be specifically expressed in cardiac endothelial cells.

2. The recombinant adeno-associated virus vector according to claim 1, characterized in that, The vector, from 5' to 3', sequentially comprises: a first adeno-associated virus inverted terminal repeat sequence, the tissue-specific promoter, the transgene, a Woodchuck hepatitis virus post-transcriptional regulatory element, a polyadenylation signal, and a second adeno-associated virus inverted terminal repeat sequence.

3. The recombinant adeno-associated virus vector according to claim 1, characterized in that, The tissue-specific promoter is the ICAM2 promoter or the Tie2 promoter; the nucleotide sequence of the ICAM2 promoter is shown in SEQ ID NO:5 or SEQ ID NO:

6.

4. The recombinant adeno-associated virus vector according to claim 1, characterized in that, The nucleotide sequence of the transgene encoding the VEGF-C protein is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:

4.

5. The recombinant adeno-associated virus vector according to claim 2, characterized in that, The nucleotide sequence of the first adeno-associated virus inverted terminal repeat sequence is shown in SEQ ID NO:7; the nucleotide sequence of the Woodchuck hepatitis virus posttranscriptional regulatory element is shown in SEQ ID NO:8; the nucleotide sequence of the polyadenylation signal is shown in SEQ ID NO:9; and the nucleotide sequence of the second adeno-associated virus inverted terminal repeat sequence is shown in SEQ ID NO:

10.

6. The method for constructing the recombinant adeno-associated virus vector according to any one of claims 1-5, characterized in that, The method is as follows: a transgene encoding the VEGF-C protein is inserted into the linearized viral vector backbone psubCMV through seamless cloning, and recombinant plasmids psubCMV-hVEGFC or psubCMV-mVegfc containing the transgene are screened to obtain the recombinant adeno-associated virus vector that targets and delivers VEGF-C. The universal strong promoter in the recombinant plasmid psubCMV-hVEGFC or psubCMV-mVegfc is replaced with a tissue-specific promoter to obtain a recombinant adeno-associated virus vector that targets and delivers VEGF-C.

7. A recombinant adeno-associated virus particle, characterized in that, The viral particle comprises the recombinant adeno-associated virus vector as described in any one of claims 1 to 5, and the AAV capsid protein that packages the vector.

8. The recombinant adeno-associated virus particle according to claim 7, characterized in that, The AAV capsid protein is the AAV9 serum type capsid protein.

9. A pharmaceutical composition for treating heart disease, characterized in that, The pharmaceutical composition comprises the recombinant adeno-associated virus particles of claim 7, and a pharmaceutically acceptable carrier or excipient.

10. Use of the recombinant adeno-associated virus vector according to any one of claims 1 to 5 in the preparation of a medicament for treating heart disease.

11. Use of the recombinant adeno-associated virus particles of claim 7 in the preparation of a medicament for treating heart disease.

12. Use of the pharmaceutical composition of claim 9 in the preparation of a medicament for treating heart disease.

Citation Information

Patent Citations

  • Adenovirus vector and application thereof in preparation of medicine for preventing and treating heart failure

    CN111197059A

  • Medicament for treating atherosclerosis and application of Sirt6

    CN113230393A

  • Techniques and compositions for treating heart failure and ventricular remodeling by in vivo delivery of angiogenic transgenes

    CN1267331A

  • Cardiac vascular endothelial cell-derived nucleic acid regulatory elements and methods and use thereof

    EP4368209A1

Cited By

  • Application of circVEGFC in treatment of rhabdomyosarcoma

    CN121987656A