Primer group for judging cocooning time of bombyx mori after pyriproxyfen pollution and application
By detecting changes in the expression of the CDA1 gene in silkworms and establishing a relative transcriptional expression model using Real-time PCR technology, the problem of difficulty in determining the cocooning time after pyriproxyfen contamination in silkworms was solved. This enabled rapid and accurate determination of cocooning time, reducing resource waste and economic losses.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies make it difficult to quickly and accurately determine the time when silkworms spin cocoons after pyriproxyfen contamination, leading to resource waste and economic losses.
By designing specific primer sets to detect changes in the expression of the CDA1 gene in silkworms, and using Real-time PCR technology to establish a relative transcriptional expression model, the cocooning time of silkworms can be determined.
It enables rapid and accurate determination of silkworm cocooning time, reduces resource waste, improves detection sensitivity and operability, and is suitable for operation by non-professionals.
Smart Images
Figure CN121653261A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for determining the cocooning time of silkworms, specifically a method for detecting the cocooning time of silkworm larvae based on the relative transcriptional expression levels of genes. Background Technology
[0002] silkworm Silkworms are an important economic insect, and their cocoons are a major raw material for the silk industry. Pyriproxyfen, a widely used pesticide, has a serious impact on the cocooning process of silkworms. Normally, fifth-instar silkworm larvae last 6-8 days, after which they mature and spin cocoons. However, after consuming mulberry leaves contaminated with pyriproxyfen, fifth-instar larvae may remain in the instar for more than 8 days, even up to ten days, without spinning cocoons. This results in a significant waste of labor and mulberry leaf resources, causing severe economic losses. Furthermore, the larvae lack obvious phenotypic characteristics throughout their larval stage, making it difficult to visually determine the cocooning time, hindering silkworm farmers from making timely decisions about continuing to raise or abandoning the silkworms. Currently, the method for determining the cocooning time of silkworms contaminated with pyriproxyfen remains unexplored.
[0003] In silkworm rearing, the fifth instar larval stage is the most resource-intensive period, consuming approximately 85% of the mulberry leaves used during this stage. If silkworms ingest mulberry leaves contaminated with pyriproxyfen during this critical period, it not only leads to a significant waste of mulberry leaves and labor but also prevents them from spinning cocoons properly, severely impacting both the yield and quality of silk. Therefore, developing a rapid and accurate method to detect the cocooning time of silkworms after pyriproxyfen contamination is particularly urgent, and is of great significance for ensuring the sustainable and healthy development of the silkworm farming industry. Summary of the Invention
[0004] The purpose of this invention is to provide a method for rapidly and accurately determining the cocooning time of silkworms using specific molecular biology techniques, thus providing a decision-making reference for sericulture production. This method is primarily based on the expression changes of the silkworm CDA1 gene (chitin deacetylase 1 gene). This gene is expressed at low levels and is relatively stable in the posterior silk glands of normal silkworms, but shows a significant upregulation after ingesting mulberry leaves contaminated with pyriproxyfen.
[0005] Specifically, this is achieved through the following technical solutions:
[0006] A primer set for determining the cocooning time of silkworms after pyriproxyfen contamination, comprising the sequences of the following primers:
[0007] 5'—TCAGTTGTGCGACGGTAGAC—3';
[0008] 5'—GGTGACGCTGTTTCCTAGGC—3';
[0009] 5'—CTGCGTCTGGACTTGGC—3';
[0010] 5'—CGAGGGAGCTGCTGGAT—3'.
[0011] This invention also provides a method for determining the cocooning time of silkworms using the primer set described above, the specific steps of which are as follows:
[0012] (1) Establish a correlation model between the relative transcriptional expression level of the CDA1 gene in normal silkworms and the development time of fifth instar silkworm larvae;
[0013] (2) The theoretical relative transcriptional expression level (T) of the CDA1 gene in normal silkworms was calculated based on the relevant model obtained in step (1) according to the developmental stage of the silkworm to be tested. 正常 The actual relative transcriptional expression level (T) of the silkworm CDA1 gene to be tested was determined. 待测 The actual relative transcriptional expression level (T) of the silkworm CDA1 gene to be tested 待测 ) and the relative transcriptional expression level of silkworms during that period (T) 正常 Compared to T, the calculated ratio R = T 待测 / T 正常 The silkworm cocooning time CT is determined by whether the ratio is greater than 1. If R≤1, the silkworm cocooning time CT=7±1 days, and the silkworms are continued to be raised. If R>1, the silkworm cocooning time CT>8 days, and the silkworms can be abandoned as needed.
[0014] To further clarify, the silkworm varieties used in steps (1) and (2) are the same, and the fifth-instar larvae are at the same developmental stage during the testing.
[0015] To further explain, in step (1), the development time of the fifth instar silkworm larva is from day 1 to day 7 of the fifth instar; in step (2), the development period of the silkworm to be tested is from day 1 to day 7 of the fifth instar silkworm larva.
[0016] Further explanation: Step (1) specifically includes the following steps: Take normal fifth-instar silkworm larvae of the same variety as the silkworm to be tested. The first sample is taken from the posterior silk gland 1-3 hours after the first feeding on the first day of the fifth instar. Then, take samples from the posterior silk gland every 24 hours until the seventh day of the fifth instar. Then, extract total RNA, treat it with DNase, and reverse transcribe it to synthesize cDNA. Using the cDNA from the posterior silk gland of normal silkworm as a template, amplify it by Real-time PCR in the presence of the primers described in claim 1. The relative transcriptional expression level of the CDA1 gene is the CDA1 gene expression level / actin3 gene expression level. Then, with the development time of the fifth instar larva as the x-axis and the relative transcriptional expression level of the CDA1 gene of normal silkworm as the y-axis, establish a correlation model between the relative transcriptional expression level of the CDA1 gene of normal silkworm and the development time of silkworm larvae.
[0017] To further explain, in step (1), when taking the silk glands at the back of the silkworm, more than 5 silkworms are selected each time to avoid errors caused by individual differences.
[0018] To further explain, in step (2), the actual relative transcriptional expression level (T) of the silkworm CDA1 gene to be tested was measured. 待测 The specific steps are as follows: First, using the cDNA from the posterior silk gland of the silkworm to be tested as a template, amplification is performed by Real-time PCR in the presence of the primers described in claim 1; the actual relative transcriptional expression level of the CDA1 gene is calculated.
[0019] To further clarify, the method for determining the time it takes for silkworms to spin cocoons after consuming pyriproxyfen-contaminated mulberry leaves is applicable to all silkworm varieties.
[0020] Compared with the prior art, the present invention has the following advantages:
[0021] This invention develops a molecular biology-based detection method using specifically designed primers, aiming to improve the accuracy, efficiency, and operability of detecting cocooning time in silkworms after they have consumed pyriproxyfen-contaminated mulberry leaves. This method has the following potential advantages:
[0022] (1) Improve detection speed: Real-time quantitative PCR technology can be used to quickly measure the expression changes of specific genes in silkworm silk gland tissue, thus achieving rapid detection.
[0023] (2) Reduced costs: Compared with chromatography or mass spectrometry, molecular biology detection methods require lower equipment and reagent costs, are easier to popularize, and are suitable for widespread application.
[0024] (3) Simplified operation process: This method simplifies the detection process, is easy to operate, and enables non-professionals to perform the detection, thus improving the feasibility of the detection.
[0025] (4) Improved sensitivity and accuracy: The specially designed primers can accurately identify and quantify biomarkers related to the action of pyriproxyfen in silkworms, thus improving the sensitivity and accuracy of detection.
[0026] (5) Early judgment: This method can predict the cocooning time of silkworms before they reach maturity and begin to spin cocoons, which helps to make timely decisions on whether to continue raising or abandon them, thus avoiding the waste of human resources, mulberry leaf resources and economy.
[0027] In summary, the detection method proposed in this patent application provides a fast, accurate, and cost-effective solution to address the shortcomings of existing technologies, thereby promoting the healthy development of the silkworm breeding industry. Attached Figure Description
[0028] Figure 1 This is a flowchart illustrating the operation of the method of the present invention.
[0029] Figure 2 The relationship between the development time of the fifth instar larvae of normal silkworms and the relative expression level of the CDA1 gene. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0031] Example 1:
[0032] The primers for detecting the cocooning time of silkworms after consuming pyriproxyfen-contaminated mulberry leaves are as follows:
[0033] 5'—TCAGTTGTGCGACGGTAGAC—3';
[0034] 5'—GGTGACGCTGTTTCCTAGGC—3';
[0035] 5'—CTGCGTCTGGACTTGGC—3';
[0036] 5'—CGAGGGAGCTGCTGGAT—3';
[0037] The detection method for inferring the cocooning time of silkworms after consuming pyriproxyfen-contaminated mulberry leaves using primers from Example 1 is as follows:
[0038] (1) Materials and equipment
[0039] The silkworm variety used was “Liangguang No. 2” (932•Furong×7532•Xianghui), a native variety of Guangxi; the quantitative PCR instrument used was a Roch LightCycler® 96.
[0040] Sample: Five or more fifth-instar silkworm larvae were collected every 24 hours for the construction of the association model.
[0041] (2) Silkworm rearing and sample collection
[0042] Silkworms were reared to the fifth instar using conventional methods. One hour after the first feeding of mulberry leaves, the posterior silk glands of 5 silkworms were collected, with 3 replicates. The larval development time of this sample was recorded as day 1 (D1). Silkworms were then reared at 25℃ and 75% humidity until they reached the upper tuft. The posterior silk glands of 5 silkworms were collected every 24 hours, and the larval development times were recorded as D2, D3, D4, D5, D6, and D7, respectively.
[0043] (3) RNA extraction and cDNA synthesis:
[0044] According to the methods described in Molecular Cloning Guide (3rd Edition), total RNA was extracted from the posterior filament gland using molecular biology techniques and reverse transcribed to synthesize cDNA, in preparation for subsequent PCR reactions.
[0045] (4) Real-time quantitative PCR (qRT-PCR) detection:
[0046] The inventors synthesized the following primers:
[0047] 5'—TCAGTTGTGCGACGGTAGAC—3';
[0048] 5'—GGTGACGCTGTTTCCTAGGC—3';
[0049] 5'—CTGCGTCTGGACTTGGC—3';
[0050] 5'—CGAGGGAGCTGCTGGAT—3';
[0051] Real-time quantitative PCR detection: The assay was performed using the fluorescent dye ChamQ Universal SYBR qPCR Master Mix on a LightCycler® 96 instrument.
[0052] Reaction system:
[0053] 2×SYBR qPCR Master Mix 10 μl, upstream primer (10 μmol / L) 0.4 μl, downstream primer (10 μmol / L) 0.4 μl, cDNA 2 μl, ddH2O 7.2 μl; total volume 20 μl.
[0054] The reaction conditions are as follows:
[0055] 95 ℃ for 30 s; 95 ℃ for 5 s, 60 ℃ for 30 s, 72 ℃ for 10 s, 40 cycles.
[0056] All samples were tested in three independent replicates.
[0057] The upstream primer is:
[0058] 5'—TCAGTTGTGCGACGGTAGAC—3', 5'—CTGCGTCTGGACTTGGC—3';
[0059] The downstream primer is:
[0060] 5'—GGTGACGCTGTTCTCTAGGC—3', 5'—CGAGGGAGCTGCTGGAT—3'.
[0061] (5) Data analysis:
[0062] Use 2 （-ΔΔCt） The relative expression level of the CDA1 gene in the posterior serine gland tissue was calculated using the following method, and the results are shown in the table below:
[0063] Table 1. Relationship between the development time of fifth instar larvae in normal silkworms and the relative transcriptional expression level of the CDA1 gene.
[0064]
[0065] Statistical analysis and graphing were performed on the data in Table 1, and attached... Figure 1 This graph shows the relative transcriptional expression level (y) of the CDA1 gene in the fifth instar larvae of the above-mentioned 932•Furong×7532•Xianghui silkworm variety, as well as the larval development time (x). It can be seen that the relative transcriptional expression level of the CDA1 gene conforms to a linear model, with the equation: y = 2 × 10⁻⁶. -7 x+1.022.
[0066] Example 2: This example is a practical application experiment of the research results of Example 1.
[0067] The silkworm larvae were selected from the Guangxi native variety "Liangguang No. 2" (932•Furong×7532•Xianghui), and fifth-instar silkworm larvae were randomly selected for testing during the routine rearing process.
[0068] Application Example: A fifth-instar silkworm larva was selected to determine its cocooning time. Knowing it was on day 4 of the fifth instar, the same method as in Example 1 was used. The mean Ct value for the CDA1 gene was 26.69, and the mean Ct value for the Actin3 gene was 19.1833. Based on 2... -△△CT The average relative expression level of the corresponding CDA1 gene was calculated to be 6.959. Based on the relevant model obtained in Example 1, y = 2 × 10⁻⁶. -7 Substituting x=4 into x+1.022, we calculate y=1.022. R=6.959 / 1.022≈6.810>1. Based on this, we determine that the silkworm's cocooning time CT>8 days. If R>1, the silkworm's cocooning time CT>8 days, then we should abandon the silkworm rearing. This is because the normal fifth instar larvae of silkworms have an instar period of 6-8 days, after which they mature and spin cocoons. However, after the fifth instar larvae of silkworms eat mulberry leaves contaminated with pyriproxyfen, their instar period exceeds 8 days, or even extends to more than ten days, and they still cannot spin cocoons, wasting a lot of labor and mulberry leaf resources and causing serious economic losses.
[0069] Verification of test results:
[0070] If the silkworm larvae in the same batch in the application example are still not spinning cocoons after being fed for 14 days, it is confirmed that the cocooning time of this batch of silkworms is CT>8 days, which proves that the detection method of the present invention is accurate.
[0071] Repeated application:
[0072] Following the method described in the above application example, 50 fifth-instar silkworm larvae at different developmental stages were examined. Figure 2 function y = 2 × 10 -7 The results obtained by x+1.022 are consistent with the actual situation.
[0073] Therefore, it is evident that the primers specifically designed by the applicant, and the accuracy and feasibility of using this primer set to determine the silkworm cocooning time and further decide whether to continue feeding, are reliable.
[0074] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, any improvements and changes made without departing from the inventive concept of the present invention are within the protection scope of the present invention.
Claims
1. A primer set for determining the cocooning time of silkworms after pyriproxyfen contamination, characterized in that: Includes the following primer sequences: 5'—TCAGTTGTGCGACGGTAGAC—3'; 5'—GGTGACGCTGTTTCCTAGGC—3'; 5'—CTGCGTCTGGACTTGGC—3'; 5'—CGAGGGAGCTGCTGGAT—3'.
2. The method for determining the cocooning time of silkworms using the primer set described in claim 1, characterized in that: The specific steps are as follows: (1) Establish a correlation model between the relative transcriptional expression level of the CDA1 gene in normal silkworms and the development time of fifth instar silkworm larvae; (2) The theoretical relative transcriptional expression level (T) of the CDA1 gene in normal silkworms was calculated based on the relevant model obtained in step (1) according to the developmental stage of the silkworm to be tested. 正常 The actual relative transcriptional expression level (T) of the silkworm CDA1 gene to be tested was determined. 待测 The actual relative transcriptional expression level (T) of the silkworm CDA1 gene to be tested 待测 ) and the relative transcriptional expression level of silkworms during that period (T) 正常 Compared to T, the calculated ratio R = T 待测 / T 正常 The silkworm cocooning time CT is determined by whether the ratio is greater than 1. If R≤1, the silkworm cocooning time CT is 7±1 days, and the silkworms are continued to be raised. If R>1, the silkworm cocooning time CT>8 days, and the silkworms can be abandoned as needed.
3. The method as described in claim 2, characterized in that: The silkworm varieties in steps (1) and (2) are the same, and the fifth instar larvae are at the same developmental stage when they are tested.
4. The method as described in claim 2, characterized in that: In step (1), the development time of the fifth instar silkworm larva is from day 1 to day 7 of the fifth instar; in step (2), the development period of the silkworm to be tested is from day 1 to day 7 of the fifth instar silkworm larva.
5. The method as described in claim 2, characterized in that: Step (1) specifically includes the following steps: Take normal fifth-instar silkworm larvae of the same variety as the silkworm to be tested. The first sample is taken from the posterior silk gland 1-3 hours after the first feeding on the first day of the fifth instar. Then, take samples from the posterior silk gland every 24 hours until the seventh day of the fifth instar. Then, extract total RNA, treat it with DNase, and reverse transcribe it to synthesize cDNA. Using the cDNA from the posterior silk gland of normal silkworm as a template, amplify it by Real-time PCR in the presence of the primers described in claim 1. The relative transcriptional expression level of CDA1 gene is the CDA1 gene expression level / actin3 gene expression level. Then, establish a correlation model between the relative transcriptional expression level of CDA1 gene in normal silkworm and the development time of silkworm larvae, with the development time of the fifth instar larva as the x-axis and the relative transcriptional expression level of CDA1 gene in normal silkworm as the y-axis.
6. The method as described in claim 5, characterized in that: In step (1), when taking silk from the posterior silk gland of the silkworm, select more than 5 silkworms each time to avoid errors caused by individual differences.
7. The method as described in claim 2, characterized in that: In step (2), the actual relative transcriptional expression level (T) of the CDA1 gene in the silkworm to be tested is determined. 待测 The specific steps are as follows: First, using the cDNA from the posterior silk gland of the silkworm to be tested as a template, amplification is performed by Real-time PCR in the presence of the primers described in claim 1; the actual relative transcriptional expression level of the CDA1 gene is calculated.
8. The method as described in claim 2, characterized in that: The method described above for determining the time it takes for silkworms to spin cocoons after consuming pyriproxyfen-contaminated mulberry leaves is applicable to all silkworm varieties.