Application of molecular marker for weight trait selection of grassland short-tailed sheep
By developing molecular markers on chromosome 24 of the grassland short-tailed sheep, the limitations of traditional phenotypic selection methods have been overcome, enabling early and accurate genetic selection and improving the efficiency and accuracy of grassland short-tailed sheep breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INNER MONGOLIA AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-02-09
- Publication Date
- 2026-04-24
AI Technical Summary
The breeding of grassland short-tailed sheep mainly relies on traditional phenotypic selection methods, which have problems such as the inability to assess weight traits in the early stages, high susceptibility to environmental influences, slow genetic progress, and limited accuracy in selection.
Develop a molecular marker that uses a SNP marker with a nucleotide value of G or A at the 101 bp site on chromosome 24 of the steppe short-tailed sheep to identify weight traits and select for these traits during the juvenile or embryonic stage through genotyping.
It enables early and accurate genetic selection, shortens the breeding cycle, improves the accuracy of selection, overcomes environmental interference, enhances the controllability and predictability of breeding, and supports the efficient and precise breeding and crossbreeding improvement of grassland short-tailed sheep.
Smart Images

Figure CN121653269B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of livestock molecular genetics breeding technology, specifically to the application of a molecular marker for the selection of weight traits in grassland short-tailed sheep. Background Technology
[0002] The Steppe Short-tailed Sheep is a new breed of meat sheep adapted to the extremely cold grassland environment. It possesses unique genetic characteristics such as a short tail, cold resistance, and tolerance to roughage. Its reproductive survival rate and feed conversion efficiency are significantly superior to the local Mongolian sheep breed. The Steppe Short-tailed Sheep has become a high-quality sire line for crossbreeding and improving Mongolian sheep, demonstrating great potential in enhancing offspring productivity, improving tail shape, reducing grassland load, and increasing herders' income. Therefore, identifying its unique molecular markers directly related to body weight is crucial for the sustainable breeding and precise construction of a crossbreeding improvement system for this specific and superior breed.
[0003] Currently, the breeding of steppe short-tailed sheep mainly relies on traditional phenotypic selection methods, which involve selecting individuals based on phenotypic data such as body weight. This method has significant limitations: 1) it requires waiting until the sheep reach adulthood to accurately assess body weight traits, making early selection impossible; 2) it is highly susceptible to environmental influences, resulting in significant fluctuations in phenotypic data and slow genetic progress; 3) it is difficult to distinguish between genetic and environmental effects, limiting the accuracy of selection. Therefore, developing an application technology for detecting body weight traits in steppe short-tailed sheep has become a pressing technical problem to be solved in this field. Summary of the Invention
[0004] This invention provides an application of molecular markers for the breeding of grassland short-tailed sheep with a body weight trait. The molecular markers can be used to identify the body weight trait of grassland short-tailed sheep and to breed large-weight grassland short-tailed sheep.
[0005] This invention is achieved through the following technical solution:
[0006] This invention provides an application of a molecular marker for the selection of body weight traits in grassland short-tailed sheep, wherein the molecular marker is the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide at the 101 bp site is G or A;
[0007] The application refers to any one of the following (1) and (2):
[0008] (1) Determine the weight of the grassland short-tailed sheep;
[0009] (2) Increase the weight of offspring of grassland short-tailed sheep.
[0010] Preferably, the method for determining the weight of grassland short-tailed sheep is as follows:
[0011] Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced.
[0012] Determine the genotype of the grassland short-tailed sheep at position 101bp of SEQ ID NO.1;
[0013] If the genotype is AA, then the grassland short-tailed sheep is of large weight, which means a weight value greater than 68.200 kg.
[0014] Preferably, the method for increasing the weight of offspring of grassland short-tailed sheep is as follows:
[0015] Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced.
[0016] Determine the genotype of the grassland short-tailed sheep at position 101bp of SEQ ID NO.1;
[0017] By selecting individuals carrying the AA genotype of grassland short-tailed sheep as parents for breeding, it is possible to increase the weight of the offspring of grassland short-tailed sheep.
[0018] Preferably, the genomic DNA is derived from the blood of a steppe short-tailed sheep.
[0019] Preferably, the genomic DNA is extracted using the phenol-chloroform method.
[0020] Preferably, the weight refers to the live weight of a grassland short-tailed sheep on an empty stomach in the morning.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] This invention provides an application of a molecular marker for the selection of weight traits in grassland short-tailed sheep. The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, with the nucleotide at the 101 bp site being G or A. The application refers to either (1) or (2) of the following: (1) identifying the weight of grassland short-tailed sheep; (2) improving the weight of offspring of grassland short-tailed sheep. This invention is the first to identify a SNP molecular marker on chromosome 24 of grassland short-tailed sheep that is significantly associated with the weight trait. The molecular marker provided by this invention can be used for genotyping in sheep during their juvenile or embryonic stage, without waiting for them to grow to adulthood and achieve phenotypic stability, thereby shortening the breeding cycle and significantly accelerating genetic progress. This molecular marker is derived from the genomic data of grassland short-tailed sheep and has been verified by three association analysis models. It is stably and reliably associated with the weight trait, effectively distinguishing between genetic effects and environmental interference, and improving the accuracy of selection. At the same time, it overcomes the problem that phenotypic measurement in traditional methods is greatly affected by environmental and feeding conditions, achieving true "genomic selection" and improving the controllability and predictability of breeding. Furthermore, the molecular markers described in this invention can not only be used for breeding this breed, but also serve as key indicators for evaluating paternal lines, assisting in the optimization of hybridization improvement systems and promoting the development of grassland short-tailed sheep breeding towards molecular design breeding.
[0023] In summary, this invention fills a technological gap in the field of molecular breeding of the weight trait of grassland short-tailed sheep, and provides reliable molecular tools and technical support for the efficient, precise and sustainable breeding of this breed. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0026] Figure 2 This is a visualization of the genomic kinship matrix of the grassland short-tailed sheep population of this invention.
[0027] Figure 3This is a Manhattan plot of the genome-wide association analysis (GWAS) of body weight traits in grassland short-tailed sheep according to this invention. A: Analysis results of the GCTA-fastGWA model, where red dots represent SNPs that have reached genomic significance. B: Analysis results of the rMVP-FarmCPU model, where red dots represent SNPs that have reached genomic significance. C: Analysis results of the Fast3VmrMLM model, where purple dots represent SNPs that have reached genomic significance. Detailed Implementation
[0028] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0029] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0030] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0031] The following is a list of abbreviations related to this invention:
[0032] LD: Linkage Disequilibrium;
[0033] SNP: Single nucleotide polymorphism;
[0034] GWAS: Genome-wide association analysis.
[0035] Example 1
[0036] The application of a molecular marker for the selection of body weight traits in grassland short-tailed sheep is as follows:
[0037] 1. Experimental animals and phenotypic sources.
[0038] The subjects of this study were 300 adult grassland short-tailed sheep. The live weight of each sheep was measured in the morning on an empty stomach using a standard weighing scale. Detailed phenotypic records are shown in Table 1.
[0039] Blood samples were collected from 300 individual grassland short-tailed sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.
[0040] Table 1. Description of body weight traits in grassland short-tailed sheep
[0041]
[0042] 2. Genomic DNA extraction and quality control.
[0043] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm / 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm / 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.
[0044] 3. Library construction and sequencing.
[0045] Genomic DNA that passed quality control was randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality control, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0046] 4. Identification, screening, and annotation of variant sites.
[0047] The raw sequencing data was quality controlled using FASP software to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted into BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. The MarkDuplicates program in Genome Analysis Toolkit software version 3.8 was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. An index was built on the final BAM files, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF file, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region in which the variant site occurs in the genome, such as intergenic regions, intronic regions, or CDS regions, can be determined, as well as the impact of the variation, such as synonymous mutations or non-synonymous mutations.
[0048] 5. Group stratification correction.
[0049] Whole-genome resequencing was performed on 300 individuals of Steppe Short-tailed Sheep, generating a total of 15768.1 Gb of raw reads and identifying 56,632,165 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium p-value of less than 10. -6 A total of 23,751,522 high-quality SNPs were identified in the grassland short-tailed sheep population. These loci are evenly distributed across the 26 pairs of autosomes in grassland short-tailed sheep, such as... Figure 1 As shown.
[0050] The first three principal components were calculated using the "--pc3" parameter in Plink software version 1.90. These three principal components were then used as covariates to correct for population stratification in the steppe short-tailed sheep. Genomic phylogenetic analysis based on the G-matrix was performed on this population using Plink v1.90, and the results are as follows: Figure 2 As shown, Figure 2Each square in the diagram represents the kinship value between two samples. The smaller the value, the closer it is to light green, indicating a more distant kinship between the two individuals, and vice versa. The results show that the average kinship between individuals of the grassland short-tailed sheep is relatively distant.
[0051] 6. Genome-wide association analysis.
[0052] The association analysis between SNPs and body weight traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta. The formula is as follows:
[0053] .
[0054] in, y It is a phenotypic vector; X snp It is a genotype vector, and its effect is β snp ; X c It is an association matrix with gender, age, and the first three principal components as fixed covariates, and its corresponding coefficients are... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~ N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector, e ~ N(0, ).
[0055] To avoid false negatives caused by the overly strict Bonferroni correction method of 0.05 / SNP, this invention adjusts the threshold for genome-wide significant association to P=1×10⁻⁶. -6 The genome expansion factor λ of the test statistic was calculated using R software version V3.6.0. λ is the slope of the linear regression between the observed quantile and the theoretical quantile. The λ value for the weight trait was 1.033, indicating that there is no significant genome expansion.
[0056] Based on resequencing data from 300 grassland short-tailed sheep, 42 significant SNP loci associated with body weight were detected. These loci are located on chromosomes 1, 2, 3, 4, 5, 6, 8, 12, 13, 15, 18, 22, and 24, as shown in Table 2. Figure 3 As shown in A.
[0057] Table 2. Significant SNPs associated with body weight traits obtained based on the GCTA-fastGWA model.
[0058]
[0059] Association analysis between SNPs and body weight traits was performed using the FarmCPU model integrated in the rMVP package of R software. Based on resequencing data from 300 grassland short-tailed sheep, a total of 38 SNP loci significantly associated with body weight traits were detected. These significant loci were distributed on chromosomes 1, 2, 3, 4, 5, 8, 12, 13, 15, 18, 22, and 24. (See Table 3 and...) Figure 3 As shown in B, this model effectively controls the false positive rate by iteratively optimizing the fixed and random effects, further validating the complexity of the genetic structure of the weight trait.
[0060] Table 3. Significant SNPs associated with weight traits obtained based on the rMVP-FarmCPU model.
[0061]
[0062] Association analysis between SNPs and body weight was performed using the Fast3VmrMLM model. Based on resequencing data from 300 grassland short-tailed sheep, 19 SNP loci significantly associated with body weight were detected. These significant loci were located on chromosomes 1, 2, 3, 5, 6, 8, 10, 12, 15, 23, and 24. (See Table 4). Figure 3 As shown in C. This multi-locus association analysis model can simultaneously detect multiple QTNs, improving the detection efficiency for complex trait genetic loci and revealing a wider range of chromosomal regions associated with the formation of body weight traits in grassland short-tailed sheep.
[0063] Table 4. Significant SNPs associated with body weight trait obtained based on the Fast3VmrMLM model.
[0064]
[0065] In summary, by employing three different association analysis models, this invention systematically identified SNP loci significantly associated with body weight traits in a grassland short-tailed sheep population. The loci revealed by the different models overlap in both number and distribution, yet each model has its own emphasis, collectively outlining a complex genetic network controlling body weight traits in grassland short-tailed sheep. This provides a solid data foundation and diverse candidate targets for subsequent molecular marker development and breeding applications.
[0066] A comprehensive analysis of the results of the three models revealed that a SNP site chr24_10226369 located on chromosome 24 was significant in all three models and was stably associated with the weight trait.
[0067] 7. Validation and effect analysis of key SNP sites.
[0068] Genotyping and phenotypic association analysis was performed on the key locus chr24_10226369, and the results are shown in Table 5.
[0069] Table 5. Association analysis between different genotypes at the chr24_10226369 locus and body weight.
[0070]
[0071] Note: In Table 5, different lowercase letters in the weight column indicate significant differences. P <0.05.
[0072] As shown in Table 5, individuals with the AA genotype have the highest body weight, which can serve as a genetic marker for high body weight; while individuals with the GG genotype have the lowest body weight. The allele frequencies and genotype frequencies at this locus are shown in Table 6.
[0073] Table 6. Allele frequencies and genotype frequencies at the chr24_10226369 locus
[0074]
[0075] The nucleotide sequences containing the chr24_10226369 site are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0076] SEQ ID NO.1:
[0077] AGAGAAACTTTACCCAAGGAATAAATTTAATCAGAGAAGTGAGAAAATGCAGACACAAAGAAAGAGTCGAGCAAGACAAAATAGCAATAGTGAAGCCATTGAACAAGTCAAGGGCCTTTAGTTTCTCGAGGGCTATCGGTAATATTCTGAGCCATACCCTTTGAGCTGTTTTGCAGACCCTAAAACCCCCACCGGGTGAAA.
[0078] SEQ ID NO.2:
[0079] AGAGAAACTTTACCCAAGGAATAAATTTAATCAGAGAAGTGAGAAAATGCAGACACAAAGAAAGAGTCGAGCAAGACAAAATAGCAATAGTGAAGCCATTAAACAAGTCAAGGGCCTTTAGTTTCTCGAGGGCTATCGGTAATATTCTGAGCCATACCCTTTGAGCTGTTTTGCAGACCCTAAAACCCCCACCGGGTGAAA.
[0080] The above results indicate that an A at the 101st base of this molecular marker is significantly associated with the large body weight trait in grassland short-tailed sheep. Therefore, in breeding practice, detecting this locus and selecting individuals with the AA genotype as parents can effectively improve the average body weight of the offspring population.
[0081] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0082] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0083] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.
Claims
1. The application of a molecular marker for the selection of body weight traits in grassland short-tailed sheep, characterized in that, The application is to determine the weight of grassland short-tailed sheep or to increase the weight of offspring of grassland short-tailed sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.2; The steppe short-tailed sheep have the maximum weight when the genotype at the 101 bp of the molecular marker is AA.
2. The application as described in claim 1, characterized in that, The method for determining the weight of grassland short-tailed sheep is as follows: Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced. Determine the genotype of the grassland short-tailed sheep at SEQ ID NO.2 at position 101bp; If the genotype is AA, then the short-tailed sheep in this grassland are large in weight.
3. The application as described in claim 1, characterized in that, The methods to increase the weight of offspring of grassland short-tailed sheep are as follows: Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced. Determine the genotype of the grassland short-tailed sheep at SEQ ID NO.2 at position 101bp; By selecting individuals carrying the AA genotype of grassland short-tailed sheep as parents for breeding, it is possible to increase the weight of the offspring of grassland short-tailed sheep.
4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from the blood of the steppe short-tailed sheep.
5. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was extracted using the phenol-chloroform method.
6. The application as described in claim 1, characterized in that, The weight refers to: The weight of a short-tailed sheep on an empty stomach in the morning.
Citation Information
Patent Citations
Methods of using genetic markers and related epistatic interactions
CN101970688A
Molecular marker influencing sheep weight traits and application thereof
CN120464759A