Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for goat corynebacterium pseudotuberculosis

Abstract

The invention discloses a real-time fluorescent quantitative qPCR (quantitative polymerase chain reaction) detection method for goat corynebacterium pseudotuberculosis. A specific primer is designed with a CP40 gene as a target, fluorescent quantitative PCR conditions are optimized, the specificity, sensitivity and repeatability of the method are verified, experimental results show that the CP40 gene is conservative and can serve as a sheep type C.P specificity identification target, the fluorescent quantitative PCR specificity is high, the sensitivity is high (52 copies / mu L), and the repeatability is good (the coefficient of variation lt; the method can effectively improve the C.P detection efficiency, provides reliable technical support for early discovery and timely treatment of CLA, and has important scientific significance and economic benefits in effective reduction of economic loss and guarantee of healthy development of the sheep raising industry.

Description

Technical Field

[0001] This invention relates to the field of pathogen detection technology, specifically to a real-time fluorescence quantitative PCR detection method for *Corynebacterium pseudotuberculosis* in caprines. Background Technology

[0002] Corynebacterium pseudotuberculosis (CP) is a Gram-positive bacterium belonging to the class Actinobacetia, order Mycobacteriales, family Corynebacteriaceae, and genus Corynebacterium. It is prevalent in goats and sheep and is a pathogen that has a significant economic impact on the global goat and sheep farming industry. It can also cause disease in camels, horses, cattle, and mice, and is a zoonotic chronic infectious disease. In sheep, this bacterium can cause caseous lymphadenitis (CLA), which is mainly characterized by chronic and subclinical infection. It can lead to a decrease in meat, milk, and wool production in affected sheep. Based on the location of the abscess, it can be divided into three types: phenotypic, visceral, and mixed. Once introduced into a farm, this bacterium is difficult to eradicate. Infected sheep will continuously release live CP bacteria into the environment. Moreover, due to the special cell wall structure of CP, it can remain in the environment for a very long time, causing repeated infections in the flock. Although CLA has a low mortality rate, clinical prevention and control practices show that it is extremely difficult to control. If not careful, it can easily infect the entire flock, causing economic losses.

[0003] Corynebacterium pseudotuberculosis (CLA) is widespread in goat and sheep farms worldwide, with high prevalence in many regions. Reports exist in Europe, the Americas, Australia, Africa, and Asia. The average incidence rate in Portugal is 34%, in adult sheep in Canada it reaches approximately 36%, and in sheep flocks in Western Australia it exceeds 20%. A survey in Ethiopia found a CLA prevalence rate of 10.68% (82 / 768), with a Corynebacterium pseudotuberculosis isolation rate reaching 72%. Epidemiological surveys conducted in dairy goat farms in parts of Shaanxi Province, China, revealed a 16%–34% positive rate for Corynebacterium pseudotuberculosis antibodies. Currently, there is no effective treatment for CLA. Sheep that do not respond to treatment and whose lesions progress from superficial to visceral forms should be culled promptly. Therefore, there is an urgent need to establish effective detection methods for early identification and isolation of infected sheep. However, conventional biochemical tests have poor reliability; some Corynebacterium species exhibit heterogeneity; furthermore, differences in laboratories, operational techniques, and the biochemical tests themselves can significantly alter the biochemical results for the same strain. The established research methods include serological methods and molecular biological methods, but there are currently no reports on the SybrGreenI real-time quantitative PCR method for detecting Corynebacterium pseudotuberculosis. Summary of the Invention

[0004] The purpose of this invention is to provide a method for the detection of Corynebacterium pseudotuberculosis in caprines using real-time PCR.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A real-time quantitative PCR primer for detecting *Corynebacterium pseudotuberculosis* in caprines, the nucleotide sequence of which is: CP-CP40F: 5'-TCCTCACCGCAGTAGGAGAA-3; CP-CP40R: 5'-TGGTGAAATCGTCTCCAT-3'.

[0006] A real-time quantitative PCR kit for detecting *Corynebacterium pseudotuberculosis* in capillaries, the kit comprising the aforementioned real-time quantitative PCR primers.

[0007] Application of the above-mentioned real-time quantitative PCR primers or the above-mentioned kit in the detection of *Corynebacterium pseudotuberculosis* in caprines.

[0008] Application of the above-mentioned real-time quantitative PCR primers or the above-mentioned kit in the detection of goat caseous lymphadenitis.

[0009] A real-time quantitative PCR detection method for *Corynebacterium pseudotuberculosis* of caprines includes the following steps: (1) DNA from subcutaneous abscess pus in goats was extracted using a bacterial and viral nucleic acid extraction kit; (2) Using the DNA obtained in step (1) as a template, perform PCR amplification using the real-time fluorescence quantitative PCR primers described in claim 1 to obtain the amplification product; (3) Compare the Ct value of the amplified product with the standard curve to obtain the copy number of *Corynebacterium pseudotuberculosis* in caprines; The standard curve is: y = -3.335x + 37.93, R 2 =1.00.

[0010] Furthermore, the PCR amplification reaction system in step (2) is as follows: 10 μL of SYBR Green I Master Mix, 0.8 μL each of upstream and downstream primers with a final concentration of 1.6 μM, 2 μL of template DNA, and deionized water to a final volume of 20 μL.

[0011] Furthermore, the PCR amplification reaction program in step (2) is as follows: pre-denaturation at 95℃ for 2 min; maintenance at 95℃ for 10 s, annealing and extension at 56℃ for 15 s, for 40 cycles.

[0012] The beneficial effects of this invention are as follows: This invention designs specific primers targeting the CP40 gene, optimizes the conditions for quantitative real-time PCR, and verifies the specificity, sensitivity, and repeatability of the method. Experimental results show that the CP40 gene is relatively conserved and can be used as a specific target for identifying sheep-type CP. The quantitative real-time PCR exhibits high specificity, high sensitivity (52 copies / μL), and good repeatability (coefficient of variation <1.5%), which can effectively improve the detection efficiency of CP and provide reliable technical support for the early detection and timely treatment of CLA. It has significant scientific and economic benefits in effectively reducing economic losses and ensuring the healthy development of the sheep farming industry. Attached Figure Description

[0013] Figure 1 This is an agarose gel electrophoresis image.

[0014] Figure 2 This is the result of genetic evolution analysis.

[0015] Figure 3 This is the standard curve.

[0016] Figure 4 For specific results, 1 represents sheep CP, 2 represents equine CP and sheep pathogens Pm, Mh, SA and MO.

[0017] Figure 5 For sensitivity testing, concentrations 1 through 6 were 5.2 × 10⁻⁶. 6 5.2×10 55.2×10 4 5.2×10 3 5.2×10 2 5.2×10 1 7 represents ddH2O. Specific implementation methods

[0018] The specific implementation methods of the present invention will be described in detail below. The specific implementation methods described herein are for illustration and explanation only and are not intended to limit the present invention.

[0019] The materials involved in this embodiment are as follows: The *Corynebacterium pseudotuberculosis* strain FJ-PN, *Pasteurella multitocida* (Pm), *Mannella hemolytica* (Mh), *Staphylococcus aureus* (SA), and *Mesomycoplasma ovipneumoniae* (MO) were all preserved and provided by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0020] The real-time quantitative PCR kit qPCR SuperMix Universal (catalog number 11762100) was purchased from Thermo Fisher Scientific; the viral nucleic acid extraction kit EasyPure Viral DNA / RNA Kit (catalog number ER201), deoxyribonuclease I (DNase I) (catalog number GD201), PCR amplification kit 2×TransTaq-T PCR SuperMix (catalog number AS122), T cloning vector kit pMD19-T Vector Cloning Kit (catalog number 6013), gel extraction kit Quick Gel Extraction Kit (catalog number EG101), and plasmid miniprep kit (catalog number EM101) were all purchased from Beijing TransGen Biotech Co., Ltd.; the real-time quantitative PCR eight-segment tubes (PCR-0208-C) were purchased from Axygen; and other routine chemical reagents and consumables were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0021] Example 1

[0022] In this embodiment, referencing the CP40 gene sequences of CP strains 2J-L (OL347712) and MEX29 (CP016826) registered in GenBank, a pair of specific primers were designed using Primer Premier 5.0 software. The primers were named CP-FJF1 and CP-FJR1, with sequences of 5'-CTTCGGCTATTACCGCACCT-3' and 5'-AGTCTGTAGACGATTCGCCG-3', respectively. The primers were synthesized by Platinum Biotech Co., Ltd., with an expected fragment length of 926 bp.

[0023] Add sterile PBS (pH 7.2-7.4) at a volume ratio of 1:3 to the pus from subcutaneous abscesses in sheep, mix well, freeze and thaw three times, centrifuge at 4000 rpm for 20 min, discard the supernatant, and extract DNA from the pus using the EasyPure ViralDNA / RNA Kit. Amplify the target gene using specific primers (CP-FJF1 and CP-FJR1). The reaction system (50 μL) consisted of: 25 μL of 2×TransTaq-T PCR SuperMix, 1 μL each of 10 μmol / L specific forward / reverse primers, 1 μL of DNA sample, and Nuclease-free Water to a final volume of 50 μL. The PCR amplification program was: 94℃ pre-denaturation for 5 min; 94℃ melting for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles; followed by a 72℃ extension for 10 min after the cycles. PCR products were identified by 1.0% agarose gel electrophoresis. The target fragment amplified by PCR was extracted using a gel extraction kit and cloned into the pMD19-T Simple Cloning Kit vector. Positive recombinant plasmids (named pMD19T-CP40) were screened using standard methods and sent to Boshan Biotechnology Co., Ltd. for sequencing. The CP40 gene was amplified by PCR, and the target band appeared after agarose gel electrophoresis, with a band size of 927 bp. Figure 1 The target fragment was recovered by gel extraction, cloned, and sequenced. The sequence was then compared with the published CP40 gene sequence by BLAST.

[0024] The sequencing results were validated using BLAST (Basic Local Alignment Search Tool) analysis on NCBI. The nucleotide homology of the expected CP40 gene sequencing results and the CP40 gene sequences of other CP strains in the database was compared using Megalign 7.10. The genetic evolutionary relationship between the related strains was plotted using phylogenetic tree drawing software (MEGA 7.0). The phylogenetic tree was plotted using the Neighbor-Joining Methods (NJ method) with 1000 replicates (Bootstrap=1000). Nucleotide homology comparison results showed that the FJ-PN strain had 99.65-100% nucleotide homology and 98.94-100% amino acid homology with the CP40 protein of other sheep-type CPs in GenBank, and 90.18-91.84% nucleotide homology and 88.63-90.77% amino acid homology with horse-type CPs, respectively. The nucleic acid homology with other members of the Corynebacterium genus was less than 82.71%, and the amino acid homology was less than 78.63%.

[0025] Figure 2 Based on the results of genetic evolution analysis, strain FJ-PN is in the same genetic evolutionary branch as other CPs in GenBank, belonging to the sheep type of Corynebacterium pseudotuberculosis.

[0026] Example 2

[0027] 1. Establishment of a real-time quantitative PCR detection method 1.1 Primer Design Based on the characteristics of the CP40 gene, specific primers for real-time quantitative qPCR were designed using Oligo (v7.37). The primer sequences are 5'-TCCTCACCGCAGTAGGAGAA-3' and 5'-TGGTGAAATCGTCTCCAT-3', named CP-CP40F and CP-CP40R, respectively, with an expected fragment size of 139 bp. The amplified fragment is: TCCTCACCGCAGTAGGAGAAGTGAATAAATCTGGCGCAATGCAGGTCGC AGAGTGGAAGCCAGAAGGCGGAGAAAAGGGCGGGACCTTCGCCTACGCCCTGGATAGGGACGGGCGCACCTACGATGGAGACGATTTCACCA. Primers were synthesized by Platinum Biotech Co., Ltd.

[0028] 1.2 Optimization of Reaction Conditions Using pMD19T-CP40 plasmid as a positive standard, its concentration was determined using a micro-nucleic acid analyzer and then converted to copy number (5.2 × 10⁻⁶).10 (Copies / μL), and then perform 10 consecutive serial dilutions for later use.

[0029] Prepare a 20 μL real-time quantitative PCR reaction system according to the instructions of the fluorescence quantitative PCR kit. Optimize reaction conditions using a Roche LightCycler 96 real-time quantitative PCR instrument with different final primer concentrations (200, 400, 600, 800, and 1000 nM) and annealing / extension temperatures (53, 55, 57, 59, and 61 °C) for 15 s. After cycling, determine the optimal reaction conditions by generating amplification and melting curves based on the parameters recommended by the software.

[0030] The optimized reaction system consisted of: 10 μL SYBR Green I Master Mix, 0.8 μL each of forward and reverse primers (final concentration 1.6 μM), 2 μL template DNA, and deionized water to a final volume of 20 μL. The reaction program was set as follows: 95℃ pre-denaturation for 2 min; followed by 40 cycles of amplification (95℃ for 10 s, 56℃ for annealing and extension for 15 s), with fluorescence signals acquired during the extension phase of each cycle (default instrument parameters).

[0031] 1.3 Establishment of the Standard Curve A concentration of 5.2 × 10⁻⁶ was selected. 6 ~5.2×10 1 Six dilutions of standard plasmids (copy / μL) were used as templates for real-time quantitative PCR reactions. Amplification was performed under optimized reaction conditions to obtain amplification curves. A standard curve for the real-time quantitative PCR reaction was plotted with the logarithm of the initial copy number of the standard on the x-axis and the cycle threshold (Ct value) on the y-axis. Figure 3 The correlation coefficient (R²) was obtained through linear regression analysis. 2 =1.00), with a slope of -3.335 and a Y-intercept of 37.93. According to the formula E=10 (-1 / 斜率) The amplification efficiency E = 99.4% was calculated based on -1, indicating that the reaction system has good amplification efficiency.

[0032] 1.4 Specificity Test Optimized qPCR reaction conditions were used to detect sheep-type CP, equine-type CP, and common sheep pathogens Pm, Mh, SA, and MO, respectively, to evaluate the specificity of the established method. Specificity detection was performed for CP and common sheep pathogens (Pm, Mh, SA, and MO). Results are as follows: Figure 4 As shown, only the CP sample exhibited a typical amplification curve, while other pathogens did not show fluorescence signals. Figure 4A). Melting curve analysis showed that the sheep-type CP formed a single melting peak (Tm value) at 85.86±0.22℃. The combined results of the amplification and melting curves indicate that the reaction has strong specificity. Figure 4 B).

[0033] 1.5 Sensitivity Test Plasmids were serially diluted (content range: 5.2~5.2×10⁻⁶). 3 A standard plasmid (copy / μL) was used as a template for real-time quantitative PCR (qPCR) under optimized reaction conditions to determine the limit of detection. Results are as follows: Figure 5 As shown, its limit of detection is 52 copies / μL (5.2 × 10⁻⁶). 1 (copy / μL), indicating that the established real-time quantitative PCR method has high sensitivity.

[0034] 1.6 Repeatability Test The established real-time quantitative PCR method was used to analyze the standard quality plasmid (content 5.2 × 10⁻⁶). 2 Copies / μL, 5.2 × 10 4 Copies / μL, 5.2 × 10 6 The samples were tested at concentrations of 1 copy / μL, with each standard sample analyzed in triplicate. Intra-group coefficient of variation (COP) was calculated. The standards were aliquoted and stored at -20 °C. Every 7 days, the samples were analyzed using the established real-time quantitative PCR method, for a total of 3 analyses. Inter-group COP was calculated. The results (Table 1) show that both intra- and inter-group COPs were less than 1.0%, indicating good reproducibility of the established real-time quantitative PCR method.

[0035] Table 1

[0036] Example 3

[0037] Forty-two samples of pus from suspected CLA subcutaneous abscesses in goats were randomly collected and mixed with 50 nasal swabs. The mixture was then incubated with sterile PBS (volume ratio 1:3), subjected to three freeze-thaw cycles, centrifuged at 4000 rpm for 20 min, and the supernatant was collected. RNA was extracted using a viral genomic DNA / RNA extraction kit. After removing genomic nucleic acids, cDNA was reverse-engineered and used for testing. The results showed that 27 samples from the pus were positive (64.3%), and 4 samples from the nasal swabs were positive (8%). Conversely, conventional PCR detected 24 samples from the pus (57.1%) and 3 samples from the nasal swabs (6%). Samples positive by conventional PCR also showed positive results by quantitative real-time PCR. Furthermore, the positive rate of quantitative real-time PCR was higher than that of conventional PCR. Four positive samples were identified as CP by cloning and sequencing, indicating that the detection method established in this invention can be used for epidemiological investigations of this pathogen.

[0038] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A real-time quantitative PCR primer for detecting *Corynebacterium pseudotuberculosis* in caprine caprines, characterized in that: The nucleotide sequence of the primer is as follows: CP-CP40F: 5'-TCCTCACCGCAGTAGGAGAA-3; CP-CP40R: 5'-TGGTGAAATCGTCTCCAT-3'.

2. A real-time quantitative PCR kit for detecting *Corynebacterium pseudotuberculosis* in caprine caprines, characterized in that: The kit includes the real-time quantitative PCR primers as described in claim 1.

3. The application of the real-time fluorescence quantitative PCR primers as described in claim 1 or the kit as described in claim 2 in the detection of *Corynebacterium pseudotuberculosis* in caprines.

4. The application of the real-time quantitative PCR primers as described in claim 1 or the kit as described in claim 2 in the detection of goat caseous lymphadenitis.

5. A real-time fluorescence quantitative PCR detection method for *Corynebacterium pseudotuberculosis* in caprine ... Includes the following steps: (1) DNA from subcutaneous abscess pus in goats was extracted using a bacterial and viral nucleic acid extraction kit; (2) Using the DNA obtained in step (1) as a template, perform PCR amplification using the real-time fluorescence quantitative PCR primers described in claim 1 to obtain the amplification product; (3) Compare the Ct value of the amplified product with the standard curve to obtain the copy number of *Corynebacterium pseudotuberculosis* in caprines; The standard curve is: y = -3.335x + 37.93, R 2 =1.

00.

6. The real-time fluorescence quantitative PCR detection method for *Corynebacterium pseudotuberculosis* according to claim 5, characterized in that: The reaction system for PCR amplification in step (2) is as follows: 10 μL of SYBR Green I Master Mix, 0.8 μL each of upstream and downstream primers with a final concentration of 1.6 μM, 2 μL of template DNA, and deionized water to a final volume of 20 μL.

7. The real-time fluorescence quantitative PCR detection method for *Corynebacterium pseudotuberculosis* according to claim 5, characterized in that: The PCR amplification reaction program in step (2) is as follows: pre-denaturation at 95℃ for 2 min; maintenance at 95℃ for 10 s, annealing and extension at 56℃ for 15 s, for 40 cycles.

Images