SNP molecular marker related to chilli pepper numbness and application thereof

By developing an SNP molecular marker at 254490888bp on chromosome 3 of the chili reference genome CM334, and combining it with KASP primers and quantitative real-time PCR, the problem of early identification of the mottled trait in chili peppers was solved, improving breeding efficiency and accuracy, and supporting early selection and high-quality breeding of chili pepper varieties.

CN121653287BActive Publication Date: 2026-05-19CHINA AGRI UNIV SANYA RES INST +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV SANYA RES INST
Filing Date
2026-02-06
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

The existing technology has not yet developed control sites or related molecular markers for the mottled trait in chili peppers, which makes it impossible to carry out early genotypic selection in the breeding of mottled chili peppers, thus limiting breeding efficiency and the development of a high-quality chili pepper industry.

Method used

A SNP molecular marker located at 254490888bp on chromosome 3 of the chili reference genome CM334 was developed, with a nucleotide polymorphism of G/C. KASP primers were designed for PCR amplification, and quantitative real-time PCR was used to identify the mottled surface trait of chili peppers, thus enabling early fruit trait identification.

Benefits of technology

This method enables stable and accurate differentiation of the mottled texture of chili peppers, improves breeding accuracy to over 90%, shortens the breeding cycle, increases breeding efficiency, and supports the selection of high-quality varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653287B_ABST
    Figure CN121653287B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to a SNP molecular marker related to pepper rough surface and application. The SNP molecular marker can stably and accurately distinguish pepper fruit rough surface (G / G), smooth surface (C / C) and hybrid (G / C) genotypes, the marker genotyping has high consistency with phenotypes, the accuracy rate is more than 90%, and is significantly better than the existing method relying on phenotype observation. Moreover, the SNP molecular marker can be used to identify the fruit rough surface trait at an early stage of the plant, avoid relying on fruit maturation to determine the trait, effectively shorten the breeding cycle, and improve the breeding efficiency. The SNP molecular marker can be directly applied to the molecular breeding of pepper rough surface trait, can provide reliable technical support for the breeding of high-quality varieties, and has high practical value and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to SNP molecular markers related to chili pepper anemones and their applications. Background Technology

[0002] chili( Capsicum annuum As an important crop of the Solanaceae family, chili peppers are widely used globally as vegetables and condiments. The fruit is the main edible organ of the chili pepper, therefore, traits related to fruit economics and yield have always been of paramount importance in long-term cultivation and breeding. With the continuous improvement of people's living standards, people have placed higher demands on the nutritional quality, sensory quality, and commercial quality of chili peppers, and the improvement of chili pepper quality is receiving increasing attention. Sensory quality of chili peppers is a crucial breeding objective that must be evaluated first in breeding work. Due to the directness of sensory quality evaluation, it has become an important factor for consumers when choosing chili pepper varieties. Fresh chili peppers require a crisp and tender texture, and freckled chili peppers are more popular with consumers in the market because of their crisper and more tender texture. Many agronomic traits of chili peppers have been studied and reported by scholars at home and abroad, but the freckled texture of chili pepper fruits has yet to be explored. This trait directly affects the commerciality of the fruit, and freckled chili pepper varieties have a crisper and more tender texture. Therefore, studying the freckled texture of chili pepper fruits is helpful in improving the sensory quality of chili peppers.

[0003] To date, no reports have been found regarding the control sites or genes for the mottled trait in chili peppers, and related molecular markers have not yet been developed. These issues prevent early genotypic selection in the breeding of mottled chili peppers, limiting breeding efficiency and the development of a high-quality chili pepper industry. Summary of the Invention

[0004] To address the aforementioned technical challenges, this invention provides an SNP molecular marker associated with the numbing sensation of chili peppers. The SNP molecular marker is located at 254490888 bp on chromosome 3 of the chili pepper reference genome CM334, and its nucleotide polymorphism is G / C.

[0005] When the genotype of the SNP molecular marker is G / G, the chili pepper has a mottled trait; when the genotype of the SNP molecular marker is C / C, the chili pepper has a smooth trait.

[0006] When the genotype of the SNP molecular marker is G / C, the chili pepper is a heterozygous genotype, and its phenotype is usually an intermediate type between mottled and smooth.

[0007] In some embodiments, the SNP molecular marker and its flanking sequence are shown in SEQ ID NO.1; the SNP molecular marker is located at position 101 of the sequence shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009] ATTTTTTATTCAACTAATCCCTTTTTCTATATACCCTTCTCATACATTTCACTATGCCCAAAATAATAAAAAACACATTCATTTCTACCTAATAAAGC[G / C]TCCATTTTGATTCCTCTTTCTCTCCGTCTTTCCAACTACTATATATTTGCAACACAAATTAAAGAAAGAAAATTATTATGGCACTAGCTAAAGAAATTAT

[0010] Meanwhile, the present invention provides a gene mutant, which is shown in SEQ ID NO.1; the gene mutant contains the SNP molecular marker described above.

[0011] That is, the 101st position of the sequence shown in SEQ ID NO.1 of the gene mutant is G / C.

[0012] Furthermore, the present invention provides primers for amplifying the SNP molecular marker or the gene mutant.

[0013] Preferably, the primers are KASP primers, with sequences shown in SEQ ID NO.2 to SEQ ID NO.4 (5' to 3').

[0014] Forward primer 1 (SEQ ID NO.2):

[0015] ACATTCATTTCTACCTAATAAAGCG

[0016] Forward primer 2 (SEQ ID NO.3):

[0017] ACATTCATTTCTACCTAATAAAGCC

[0018] Reverse primer (SEQ ID NO.4):

[0019] AGTTGGAAAGACGGAGAGAAAGAGGAATC

[0020] The last position of the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 matches the SNP molecular marker.

[0021] In some embodiments, the forward primers 1 and 2 of the KASP primers contain fluorescent adapter sequences at their 5' ends.

[0022] Preferably, the forward primer 1 containing the fluorescent adapter sequence of the KASP primer is shown in SEQ ID NO.5, and the forward primer 2 containing the fluorescent adapter sequence of the KASP primer is shown in SEQ ID NO.6.

[0023] SEQ ID NO.5:

[0024] GAAGGTGACCAAGTTCATGCTACATTCATTTCTACCTAATAAAGCG

[0025] SEQ ID NO.6:

[0026] GAAGGTCGGAGTCAACGGATTACATTCATTTCTACCTAATAAAGCC

[0027] Furthermore, the present invention provides a reagent or kit for identifying the numbing properties of chili peppers, wherein the primers are contained herein.

[0028] Preferably, the kit is a real-time PCR kit.

[0029] Preferably, the real-time PCR kit includes: dNTPs, Taq DNA polymerase, and Mg. 2+ , buffer substances and the primers mentioned above.

[0030] Furthermore, this invention provides the application of the aforementioned SNP molecular markers, gene mutants, primers, or reagents or kits in identifying the numbing trait in chili peppers. Furthermore, this invention provides the application of the aforementioned SNP molecular markers, gene mutants, primers, or reagents or kits in molecular breeding related to the numbing trait in chili peppers.

[0031] Furthermore, the present invention provides a method for identifying the freckled or mottled trait of chili peppers, comprising: using the genomic DNA of the chili pepper to be tested as a template, performing PCR amplification using the primers provided, and analyzing the genotype of the SNP molecular marker in the amplification product;

[0032] When the genotype of the SNP molecular marker is G / G, the chili pepper has a mottled trait; when the genotype of the SNP molecular marker is C / C, the chili pepper has a smooth trait.

[0033] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min, 1 cycle; 95℃ denaturation for 5 s, 58℃ annealing extension for 20 s, 40 cycles.

[0034] Preferably, the PCR amplification reaction system is a 10 μL system, which consists of: 5 μL KASP 2×PCRmix, 1 μL primer premix, 1 μL DNA template, and the remainder ddH2O.

[0035] In specific implementation plans, the genomic DNA of chili peppers is extracted from, but is not limited to, the following parts: leaves, stems, ovaries, fruits, and roots.

[0036] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0037] This invention constructs a localization population to locate the gene for freckled pepper morphology and develops a SNP molecular marker closely linked to it. This SNP molecular marker can stably and accurately distinguish between freckled (G / G), smooth (C / C), and heterozygous (G / C) genotypes in pepper fruits. The marker-genotyping consistency with the phenotype is high, with an accuracy rate exceeding 90%, significantly superior to existing methods that rely on phenotypic observation. Moreover, this SNP molecular marker allows for the identification of freckled fruit traits at an early stage of plant growth, avoiding reliance on fruit maturity for trait determination, effectively shortening the breeding cycle and improving breeding efficiency. The SNP molecular marker of this invention can be directly applied to molecular breeding for freckled pepper traits, providing reliable technical support for the selection of high-quality varieties, and has high practical value and promising prospects for widespread application. Attached Figure Description

[0038] Figure 1 These are images showing the characteristics of chili peppers with a numbing or smooth surface.

[0039] Figure 2 This consists of box plots and allelic genotyping diagrams showing the distribution of mottled skin in the F2 population; where G / G represents the mottled genotype; C / C represents the smooth genotype; G / C represents the heterozygous banding; the lines within the boxes represent the median; and the top and bottom lines represent the maximum and minimum values, respectively; the Dunnett multiple comparison method was used to test for significant differences. This indicates that P < 0.01. This indicates that P < 0.001.

[0040] Figure 3 This is an allelic genotyping diagram of SNP molecular markers in 45 materials. According to color classification, the genotype C of the samples clustered near the X-axis (showing green circles) is the allelic genotype linked to the VIC fluorescent tag sequence; the genotype of the samples clustered near the Y-axis (showing red triangles) is the allelic genotype linked to the FAM fluorescent tag sequence; the genotype of the samples showing blue diamonds in the middle is the heterozygous genotype of both alleles; NTC indicates no-template control. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0042] In the following examples, the inbred lines “22Y5495” (mottled pepper) and “22Y5496” (smooth pepper) were used as parents to construct an F2 genetic population. The F2 population consisted of 277 plants. All pepper materials used in this invention are available to the public by the applicant, but are only for verifying the invention and cannot be used for other purposes. Those skilled in the art can also use other materials for verification experiments; the following examples are merely illustrations. In the following examples, the fruit phenotype was investigated using a developed quantitative evaluation system 30 days after flowering (green ripening stage). Pepper genomic DNA was extracted using a modified CTAB method. DNA integrity, quality, and concentration were assessed by agarose gel electrophoresis and NanoDrop. All samples were diluted to 100 ng / μL and stored at -20°C for later use.

[0043] The definition of chili flakes in this invention is as follows: Figure 1 As shown, the texture of chili peppers is uneven, which refers to the bumpy appearance of the chili pepper fruit skin. Chili peppers with uneven texture have a crisper and more tender taste and are an important breeding target that affects the sensory quality of chili pepper fruits.

[0044] Definition of chili numbing sensation:

[0045] The ratio of the difference between the length of the outer skin of a chili pepper fruit and the length of a slice to the length of the slice is defined as the "peskyness" (%), which indicates the degree of pockmarking on the chili pepper's surface. The formula is as follows: Peskyness (%) = (Outer skin length - Slice length) / Slice length × 100%; where the slice length is the straight-line distance between the two endpoints of the corresponding measurement line measured on the longitudinal section after the chili pepper fruit is longitudinally cut along its long axis. A higher pockmark level indicates more unevenness on the surface of the chili pepper fruit.

[0046] Example 1: Development of SNP Molecular Markers

[0047] Linkage analysis of gene loci in the two parents and extreme mixed pools was performed using cluster separation analysis sequencing (BSA-seq). Based on the analysis results, a KASP marker was developed on chromosome 3 of pepper to obtain a SNP site closely linked to the freckles of pepper. This SNP site is located at 254,490,888 bp on chromosome 3 of the pepper reference genome CM334, and its nucleotide polymorphism is G / C. The 100 bp sequences before and after this SNP site were extracted, and KASP primers were designed. The KASP primers consist of three primers: two specific forward primers (SEQ ID NO.2 and SEQ ID NO.3) with FAM and VIC fluorescent adapter sequences linked to their 5' ends, respectively; and one universal reverse primer (SEQ ID NO.4). The primers were synthesized by Shanghai Sangon Biotech. The primer sequences containing the fluorescent adapter sequences are as follows:

[0048] Forward primer (SEQ ID NO.5):

[0049] GAAGGTGACCAAGTTCATGCTACATTCATTTCTACCTAATAAAGCG

[0050] Forward primer (SEQ ID NO.6):

[0051] GAAGGTCGGAGTCAACGGATTACATTCATTTCTACCTAATAAAGCC

[0052] Reverse primer (SEQ ID NO.4):

[0053] AGTTGGAAAGACGGAGAGAAAGAGGAATC

[0054] Based on the KASP reaction principle and the polymorphism of the SNP molecular markers, a high-throughput genotyping method can be used to detect the genotype of samples and then identify the chili pepper's numbing trait based on the genotype of the SNP molecular markers.

[0055] The genotyping method and the identification method for the mottled trait of chili peppers are as follows: Using chili pepper genomic DNA as a template, PCR amplification is performed using the above-mentioned KASP primers. If only the fluorescent signal corresponding to the forward primer (SEQ ID NO.5) is detected in the PCR amplification product, the SNP molecular marker base is G, and the test material is mottled; if only the fluorescent signal corresponding to the forward primer (SEQ ID NO.6) is detected, the SNP molecular marker base is C, and the test material is smooth; if the fluorescent signals corresponding to both SEQ ID NO.5 and SEQ ID NO.6 are detected simultaneously, the SNP molecular marker base is G / C, and the test material is a heterozygous genotype.

[0056] PCR amplification reaction system: 5 μL KASP 2×PCR mix (Videgene, FLU-ARMS 2×mix V5F), 0.1 μL forward primer (10 μM), 0.3 μL reverse primer (10 μM), 1 μL template DNA, and ddH2O added to a final volume of 10 μL. The PCR amplification program was: 95℃ pre-denaturation for 5 min, 1 cycle; 95℃ denaturation for 5 s, 58℃ annealing and extension for 20 s, for 40 cycles. After the PCR reaction, the plates were read at 30℃ for 30 s using a real-time PCR instrument, and the genotyping results were analyzed using QuantStudio™ Design Analysis Software v1.5.2.

[0057] Genotyping of the F2 population was performed using the methods described above, and the results are as follows: Figure 2 As shown, the degree of freckles in plants with the SNP molecular marker genotype "C / C" was significantly lower than that in plants with the genotype "G / G" (P = 1.99 × 10⁻⁶). -9 This indicates that the SNP molecular marker is closely linked to the mottled trait of pepper fruits; plants with the genotype "G / G" have a higher degree of mottledness, while plants with the genotype "C / C" have a lower degree of mottledness.

[0058] Example 2: Application of SNP molecular markers

[0059] In this embodiment, the SNP molecular marker developed in Example 1 is used to identify the freckled or gritty texture of chili peppers. The steps are as follows:

[0060] Forty-five chili pepper samples with known genotypes (provided by the College of Horticulture, China Agricultural University) were selected and sensory rated based on touch and sight, divided into four levels. Higher levels indicate a greater degree of roughness or blemishes on the chili pepper fruit. The rating criteria for the four levels are as follows:

[0061] Grade 1: The peel is smooth and has no obvious bumps or depressions;

[0062] Grade 2: The peel has few bumps and the degree of bumps is low;

[0063] Grade 3: The peel has many bumps, but the degree of bumps is low;

[0064] Grade 4: The peel has many bumps and unevenness, and the degree of bumps and unevenness is high.

[0065] Meanwhile, genomic DNA was extracted from 45 chili pepper samples using a modified CTAB method. The extracted and dried DNA was dissolved in 200 μL of ddH2O, and the DNA concentration was measured using NanoDrop. All samples were diluted to 100 ng / μL. Genotyping was performed on the 45 chili pepper samples according to the genotyping method and the identification method for the chili pepper pockmark trait described in Example 1.

[0066] The test results are shown in Table 1. The allelic typing of SNP molecular markers in the 45 materials is shown in the figure below. Figure 3 As shown.

[0067] Table 1

[0068]

[0069] The results showed that the SNP molecular markers were successfully genotyped using KASP primers. The SNP molecular markers could accurately identify the rough and smooth phenotypes of pepper fruits with an accuracy rate of over 90%. This indicates that the SNP molecular markers of the present invention have high practicality and accuracy in screening rough peppers and can be used for molecular marker-assisted selection breeding of rough pepper fruit traits.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker associated with chili pepper numbing sensation, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The SNP site of the SNP molecular marker is located at position 101 of the sequence shown in SEQ ID NO.

1. Its nucleotide polymorphism is G or C. When the genotype of the SNP molecular marker is GG, the pepper has a mottled trait; when the genotype of the SNP molecular marker is CC, the pepper has a smooth trait.

2. Primers for identifying the SNP molecular markers related to chili pepper numbing sensation as described in claim 1, characterized in that, The primers are KASP primers, and the sequences of the KASP primers are shown in SEQ ID NO.2 to SEQ ID NO.

4.

3. A reagent or kit for identifying the fibrous texture of chili peppers, characterized in that, It contains the primers described in claim 2.

4. The reagent or kit according to claim 3, characterized in that, The kit is a real-time PCR kit.

5. The application of the primers of claim 2, the reagents or kits of claim 3 or 4 in identifying the anemone-like characteristics of chili peppers, characterized in that, The genotype of the SNP molecular marker according to claim 1 is detected. When the genotype of the SNP molecular marker is GG, the pepper has a mottled trait; when the genotype of the SNP molecular marker is CC, the pepper has a smooth trait.

6. The application of the primers of claim 2, the reagents or kits of claim 3 or 4 in molecular breeding of the numbing trait in chili peppers, characterized in that, The genotype of the SNP molecular marker according to claim 1 is detected. When the genotype of the SNP molecular marker is GG, the pepper has a mottled trait; when the genotype of the SNP molecular marker is CC, the pepper has a smooth trait.

7. A method for identifying the numbing and fibrous properties of chili peppers, characterized in that, include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primers described in claim 2, and the genotype of the SNP molecular markers in the amplification products was analyzed. The SNP site of the SNP molecular marker is located at position 101 of the sequence shown in SEQ ID NO.1, and its nucleotide polymorphism is G or C; When the genotype of the SNP molecular marker is GG, the chili pepper has a mottled surface; when the genotype of the SNP molecular marker is CC, the chili pepper has a smooth surface.