LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe

Abstract

The invention discloses an LAMP isothermal nucleic acid rapid detection method based on a dI modified primer and a fluorescent probe, and relates to the technical field of rapid quantitative detection of nucleic acid. The isothermal nucleic acid rapid detection method based on the LAMP, the dI modified primers and the fluorescent probe comprises the following operation steps that 1, three pairs of LAMP amplification primers are prepared, one primer loop-F-dI is provided with a dI basic group, and the other primer is provided with an AP site modified Taqman probe with a non-basic-group site modification in the middle; 2, synthesizing a large amount of double-stranded DNA by using three pairs of LAMP primers and Bst DNA polymerase; 3, in the LAMP reaction process in the step 2, the dI modified primer and endonuclease V can realize continuous synthesis of single-stranded DNA together to generate a large amount of single-stranded DNA; 4, the single-stranded DNA generated in the step 3 is paired with an AP site modified Taqman probe, the AP site can be cut off by endonuclease IV after pairing, and a fluorescence signal is permanently released and accumulated.

Description

Technical Field

[0001] This invention relates to the technical field of rapid quantitative detection of nucleic acids, specifically to a rapid nucleic acid detection method based on dI-modified primers and fluorescent probes using LAMP isothermal assay. Background Technology

[0002] Polymerase chain reaction (PCR) technology is the oldest and most mature technology in molecular diagnostics. Among them, quantitative real-time PCR (qPCR) technology is considered the gold standard for molecular diagnostics. It is widely used for screening and detection of infectious diseases, genetic diseases, and single nucleotide polymorphisms, and occupies most of the molecular diagnostics market. However, the qPCR testing process is cumbersome and time-consuming, and it is impossible to produce a report within 2 hours.

[0003] Point-of-care testing (POCT) technology offers short testing times, meeting the future development needs of in vitro diagnostics. Currently, biochemical and immunodiagnostic methods in in vitro diagnostics have largely achieved POCT. While molecular diagnostics is accurate and sensitive, neither qPCR nor gene sequencing can achieve POCT testing. Therefore, convenient and rapid POCT technology is the future development trend of the molecular diagnostics industry.

[0004] LAMP, also known as loop-mediated isothermal amplification, uses six specific primers designed for six regions of a target gene. Under the action of strand displacement DNA polymerase (Bst DNA polymerase), the gene template, primers, and dNTPs are amplified at an isothermal temperature of 60-65℃, achieving 10^10 amplifications in approximately 15-60 minutes. 9 ~10 10 LAMP (Liquid Amplification) is a novel nucleic acid amplification method characterized by its simplicity and high specificity, making it a primary technology platform for rapid nucleic acid detection. By adding fluorescent probe molecules and enzymes that cleave paired probe molecules to the reaction system, the amount of LAMP amplification products can be monitored in real time, allowing for quantitative analysis of the target gene amplification products similar to qPCR. However, the Bst DNA polymerase used in LAMP amplification lacks exonuclease activity and cannot be used for conventional TaqMan probe-based quantitative PCR detection.

[0005] Endonuclease IV is a specific endonuclease that hydrolyzes DNA strands at base-free sites (AP sites) in the DNA double helix. This enzyme has extremely low activity in cleaving single-stranded DNA containing AP sites. Therefore, probe molecules with AP sites, thermostable endonuclease IV, and LAMP technology are coupled for quantitative fluorescence detection of DNA amplification at isothermal temperatures.

[0006] However, probe molecules cannot effectively pair with the double-stranded DNA amplification product at the 65°C reaction temperature of LAMP, thus hindering efficient cleavage of the AP site probe and release of fluorescent signals. If single-stranded DNA can be continuously synthesized during the LAMP reaction, probe molecules can pair with single-stranded DNA very efficiently, greatly improving detection sensitivity and shortening detection time. Therefore, we propose an isothermal rapid nucleic acid detection method based on LAMP, dI-modified primers, and fluorescent probes. Summary of the Invention

[0007] The purpose of this invention is to provide a rapid nucleic acid detection method based on dI modified primers and fluorescent probes using LAMP isothermal detection, in order to overcome the above-mentioned defects caused by the prior art.

[0008] A rapid nucleic acid detection method based on dI-modified primers and fluorescent probes using LAMP isothermal assays is described below: Step 1: Prepare 3 pairs of LAMP amplification primers, one of which, loop-F-dI, carries a dI base. This dI-modified primer is used to synthesize single-stranded DNA during the LAMP reaction. Step 2: Prepare an AP-modified Taqman probe with a base-free site in the middle and fluorescent emitting and fluorescent quenching groups at both ends, for real-time quantitative detection. Step 3: Establish a LAMP isothermal nucleic acid amplification reaction system using 3 pairs of primers; Step 4: During the LAMP amplification reaction, the dI-modified primers continuously synthesize single-stranded DNA. The single-stranded DNA guides the Taqman probe to be efficiently cleaved by endonuclease IV, rapidly releasing a fluorescent signal. Step 5: Determine the concentration of the target nucleic acid molecules based on the fluorescence signal intensity and the standard curve.

[0009] Preferably, the dI-modified primer contains one hypoxanthine base dI, and the distance of the dI base from the 5' end is ≥15 bases; there is no requirement for the distance of the dI base from the 3' end.

[0010] Preferably, the base-free site in the AP site-modified Taqman probe is an AP site, which is any one of a tetrahydrofuran ring, an alkane chain, or an ethylene glycol polymer.

[0011] Preferably, the establishment of the LAMP isothermal nucleic acid amplification reaction system includes the following workflow: adding the primers for LAMP amplification target DNA, dI modified primers, AP site modified Taqman probes, dNTPs, Bst DNA polymerase large fragment, thermostable endonuclease IV, thermostable endonuclease V, and detection sample DNA to the LAMP isothermal nucleic acid amplification reaction system to prepare the reaction mixture.

[0012] Preferably, the LAMP amplification reaction, single-stranded DNA synthesis reaction, and fluorescence signal amplification reaction include the following steps: the reaction mixture of the LAMP isothermal nucleic acid amplification reaction system is incubated at 60-65 degrees Celsius for a certain time in a portable fluorescence detector or fluorescence quantitative PCR instrument, wherein the incubation time is preferably 15-120 minutes, to amplify the target gene, synthesize single-stranded DNA, and perform fluorescence quantitative detection.

[0013] Preferably, the thermostable endonuclease IV has an enzyme activity half-life ≥90 minutes at 65°C, and the thermostable endonuclease V has an enzyme activity half-life ≥90 minutes at 65°C.

[0014] Preferably, the target nucleic acid is any one of DNA viral nucleic acid, bacterial genomic DNA, fungal genomic DNA, human genomic DNA, or DNA from any other source.

[0015] Compared with the prior art, the present invention has the following advantages: This LAMP isothermal rapid nucleic acid detection method based on dI-modified primers and fluorescent probes utilizes dI-modified loop-F primers and restriction endonuclease V to achieve continuous synthesis of single-stranded DNA, generating a large amount of single-stranded DNA for pairing with AP-site modified Taqman probes. The AP-site modified Taqman probes have a base-free modification site in the middle, which can be cleaved by restriction endonuclease IV, permanently releasing and accumulating fluorescent signals. Since restriction endonuclease V and restriction endonuclease IV are derived from thermostable microorganisms, the entire single-strand synthesis reaction and the release of fluorescent signals (Taqman probe cleavage reaction) can be coupled with LAMP isothermal amplification technology at 65 degrees Celsius, achieving isothermal quantitative detection of DNA and RNA nucleic acids. The coupled detection of the fluorescent signal release reaction and the single-stranded DNA synthesis reaction in LAMP achieves isothermal nucleic acid amplification and signal detection, overcoming the absolute dependence on quantitative real-time PCR and improving the detection sensitivity of target nucleic acids. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the technical principle of the present invention; Figure 2 This is a diagram showing the results of the present invention for detecting the Escherichia coli 3-phosphate glyceraldehyde dehydrogenase gene. Detailed Implementation

[0017] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.

[0018] like Figures 1 to 2As shown, a rapid quantitative detection method for LAMP nucleic acid based on dI-modified loop-F primers and AP-site modified Taqman probes is described. First, five conventional LAMP isothermal amplification primers, a Loop-F primer with a dI-modified base in the middle, and an AP-site modified Taqman probe with a tetrahydrofuran ring are synthesized. The conventional LAMP amplification primers, dI-modified loop-F primers, AP-site modified Taqman probes, dNTPs, a large fragment of Bst DNA polymerase, thermostable endonuclease IV and endonuclease V, and sample DNA are added to the LAMP reaction system. The mixture is incubated in a temperature-controlled portable fluorescence detector to determine the presence of the glyceraldehyde-3-phosphate dehydrogenase gene in the sample. The specific steps include: Step 1: Prepare 5 LAMP isothermal conventional amplification primers and Loop-F primers with a dI modified base at the 3' end or in the middle (in this example, Loop-F primers with a dI modified base at the 3' end); the primer length is 20 nt, and the last base at the 3' end is a dI base.

[0019] Step 2: Prepare a Taqman probe with a base-free site in the middle; the Taqman probe is 25 nucleotides long, and the base-free site is any one of tetrahydrofuran ring, alkane chain, or ethylene glycol polymer; the entire probe sequence is paired with nucleotides 459-483 of the *E. coli* 3-phosphate glyceraldehyde dehydrogenase gene, and both ends are labeled with a fluorescent emitting group and a fluorescent quenching group, respectively, and no fluorescence is released; wherein the fluorescent emitting group is any one of FAM, ROX, VIC, and Cy5, and the fluorescent quenching group is any one of BHQ1 and BHQ2. A preferred Taqman probe is as follows: Ecgapdh-Taqman: 5' FAM-CT GCCTGGCTC(AP)GCTGGCTAAA GTT-BHQ1.

[0020] Step 3: Establishment of the LAMP isothermal nucleic acid amplification reaction system; The establishment of the LAMP isothermal nucleic acid amplification reaction system includes the following workflow: Add the LAMP conventional primers and dI-modified primers Loop-F for amplifying the target DNA, dNTPs, a large fragment of Bst DNA polymerase, the detection sample DNA, thermostable endonuclease IV, endonuclease V, and AP-site modified Taqman probe to the LAMP isothermal nucleic acid amplification reaction system to prepare the reaction mixture; Specifically, design and synthesize three pairs of LAMP primer sequences (0.2 µM Ecgapdh-F3, 1.0 µM Ecgapdh-F2F1, 0.4 µM Ecgapdh-loop-F, 0.2 µM Ecgapdh-B3, 1.0 µM Ecgapdh-B2B1, 0.4 µM Ecgapdh-loop-B) for amplifying the 384-556 base sequence of the *E. coli* 3-phosphate glyceraldehyde dehydrogenase gene, and add 0.8 mM... The following reagents were added to the LAMP reaction system (20 mM Tris-HCl (pH 8.8), 1 M betaine, 10 mM KCl, 10 mM (NH4)2SO4, 4 mM MgSO4, 0.1% Triton X-100) to prepare the reaction mixture: dNTPs (final concentration), Bst DNA polymerase fragment (8 U), Tth endonuclease IV (100 ng), endonuclease V (20 ng), AP site modified Taqman probe (0.05 µM), and DNA samples of different concentrations. The LAMP isothermal amplification primer sequences are as follows: Ecgapdh-F3: 5'ggtccgtcta aagacaacac tc Ecgapdh-F2F1: 5'ggtggtgcaggaagcgttggaaac TTTT gatgttc gttaaaggcgctaacttc Ecgapdh-loop-F: 5'tgtcctggccagcatatttdI Ecgapdh-B3: 5'tctttgtgagacgggccatc Ecgapdh-R2B1: 5'atcaacg ataacttcgg catcatcgaa TTTTcggttttctgagtagcggtagtag Ecgapdh-loop-B: 5'gtctgatga ccaccgttca c.

[0021] Step 4: LAMP amplification reaction and fluorescence signal amplification reaction; The LAMP amplification reaction and fluorescence signal amplification reaction specifically include the following steps: The reaction mixture of the LAMP isothermal nucleic acid amplification reaction system is incubated at 60-65 degrees Celsius for a certain time in a portable fluorescence detector or fluorescence quantitative PCR instrument to amplify and quantitatively detect the 3-phosphoglyceraldehyde dehydrogenase gene of Escherichia coli. The incubation time is preferably 30-90 minutes.

[0022] Step 5: Determine the concentration of the target nucleic acid molecule. Based on the fluorescence growth curve, determine whether the sample contains the target nucleic acid and its concentration; in detail, based on the final fluorescence signal of the reaction ( Figure 2 The study determined the correlation between the concentration of the *E. coli* gapdh gene and the fluorescence signal in the test samples. The fluorescence signal intensity was positively correlated with the concentration of the glyceraldehyde-3-phosphate dehydrogenase gene. The negative control with added water showed a very low fluorescence signal, producing only background fluorescence.

[0023] A rapid quantitative detection method for nucleic acid using LAMP based on dI-modified loop-F primers and AP-site-modified Taqman probes is applied to the isothermal quantitative detection of the glyceraldehyde-3-phosphate dehydrogenase gene.

[0024] like Figure 2 As shown, LAMP isothermally amplifies the 3-phosphoglyceraldehyde dehydrogenase gene, forming a large amount of amplified product DNA. The more sample DNA in the reaction system, the more LAMP amplification products are formed, and the more single-stranded DNA is formed. The Taqman probe is a short nucleic acid strand that pairs with the single-stranded DNA of the E. coli 3-phosphoglyceraldehyde dehydrogenase gene. The fluorescent group at one end is quenched by the quenching group at the other end, and there is a tetrahydrofuran ring without a base site in the middle. The intact probe does not produce a fluorescent signal. When the Taqman probe pairs with one of the DNA strands of the LAMP amplification product, the Tth endonuclease IV cuts it at the base-free site (tetrahydrofuran ring) of the Taqman probe, thereby separating the fluorescent group from the quenching group and releasing a fluorescent signal. The vertical axis represents the relative intensity of the fluorescence signal, and the horizontal axis represents the amount of E. coli DNA sample detected (nanograms). H2O is the negative blank control. This result indicates that as the amount of sample DNA increases, more single-stranded DNA of LAMP amplification products are formed, which in turn leads to a higher fluorescence signal generated by the Taqman probe being cleaved by endonuclease IV. In contrast, the fluorescence signal generated by water molecules, which serve as the negative control, is extremely low and belongs to the background value.

[0025] Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not exhaustive. All modifications within the scope of this invention or its equivalents are included in this invention.

Claims

1. A rapid LAMP isothermal nucleic acid detection method based on dI-modified primers and fluorescent probes for isothermal real-time quantitative detection of target nucleic acids, characterized in that: The operation steps are as follows: Step one: preparing three pairs of LAMP amplification primers, one of which is loop-F-dI with a dI base, which is used to synthesize single-stranded DNA during the LAMP reaction; Step two: preparing an AP site modified Taqman probe with a non-base site in the middle and labeled with a fluorescence emission group and a fluorescence quenching group at both ends for real-time quantitative detection of the probe; Step three: establishing a LAMP isothermal nucleic acid amplification reaction system using three pairs of primers; Step four: during the LAMP amplification reaction, the dI modified primer continuously synthesizes single-stranded DNA, which guides the efficient cleavage of the Taqman probe by endonuclease IV, rapidly releasing the fluorescence signal; Step five: according to the fluorescence signal intensity and the standard curve, the concentration of the target nucleic acid molecule is determined.

2. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 1, characterized in that: The dI modified primer contains a hypoxanthine base dI, and the dI base is located ≥15 bases from the 5' end; there is no requirement for the distance of the dI base from the 3' end.

3. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 2, characterized in that: The non-base site in the AP site modified Taqman probe is an AP site, which is any one of a tetrahydrofuran ring, an alkane chain, and an ethylene glycol polymer.

4. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 3, characterized in that: The establishment of the LAMP isothermal nucleic acid amplification reaction system includes the following workflow: adding the LAMP amplification target DNA primers, dI modified primers, AP site modified Taqman probes, dNTPs, Bst DNA polymerase large fragments, heat-stable endonuclease IV, heat-stable endonuclease V, and sample DNA to the LAMP isothermal nucleic acid amplification reaction system to prepare the reaction mixture.

5. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 4, characterized in that: The LAMP amplification reaction, single-stranded DNA synthesis reaction, and fluorescence signal amplification reaction include the following working steps: incubating the reaction mixture of the LAMP isothermal nucleic acid amplification reaction system at 60-65 degrees for 15-120 minutes in a portable fluorescence detector or a fluorescence quantitative PCR instrument to amplify the target gene, synthesize single-stranded DNA, and perform fluorescence quantitative detection.

6. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 5, characterized in that: The heat-stable endonuclease IV has an enzyme activity half-life of ≥90 minutes at 65℃, and the heat-stable endonuclease V has an enzyme activity half-life of ≥90 minutes at 65℃.

7. The LAMP isothermal nucleic acid rapid detection method based on dI modified primer and fluorescent probe according to claim 6, characterized in that: The target nucleic acid is any one of a DNA virus nucleic acid, a bacterial genomic DNA, a fungal genomic DNA, a human genomic DNA, or any other source of DNA.

Images