Application of SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 9 and related to scrotal hernia
By detecting the SNP molecular marker rs318420719 on pig chromosome 9, AA and GG type individuals were eliminated, and GA type individuals were bred, thus solving the problem of genetic improvement of boar scrotal hernia and achieving a significant reduction in the incidence of scrotal hernia and accelerated genetic progress.
Patent Information
- Application Number
- CN202511878833.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-12
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies are insufficient to effectively reduce the incidence of scrotal hernias in boars, leading to economic losses and slow growth.
Using the SNP molecular marker rs318420719 located on pig chromosome 9, genetic improvement of pigs was achieved by detecting GA-type individuals and eliminating AA and GG-type individuals to reduce the incidence of scrotal hernia.
It significantly reduces the incidence of scrotal hernia, improves the economic benefits and growth efficiency of breeding pigs, shortens the generation interval of genetic progress, and reduces economic losses.
Smart Images

Figure CN121674552A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic breeding technology and relates to the application of a SNP molecular marker located on chromosome 9 of pigs that is associated with scrotal hernia. Background Technology
[0002] Scrotal hernia, a common congenital developmental abnormality in boars, significantly impacts the economic benefits of pig farming, the genetic improvement of breeding pigs, and the dissemination of superior genetic resources. The main manifestation of this condition is the descent of abdominal contents from one or both inguinal canals into the scrotum, causing localized, hemispherical swellings of varying sizes. Pigs with scrotal hernias experience a series of stress responses due to pain, affecting animal welfare and leading to additional losses, such as increased feeding, medication, and labor costs for farms. Furthermore, pigs affected by scrotal hernias exhibit reduced feed conversion rates, slow growth, poor body conformation uniformity, lower market prices, and a mortality rate as high as 15%, resulting in varying degrees of economic losses for farms. Research indicates that the formation mechanism of scrotal hernias shares a common anatomical basis across different species—namely, physiological weakness or pathological defects in the inguinal region—but significant differences exist in epidemiological characteristics, pathogenic factors, and clinical symptoms.
[0003] In disease research, genome-wide association studies (GWAS) can be used with case-control designs or quantitative trait analysis to identify differences in allele frequencies and systematically identify genetic loci significantly associated with complex disease phenotypes. Compared to traditional candidate gene studies, GWAS employs a genome-wide scanning approach, enabling the discovery of novel genetic risk loci and providing a broader perspective for genetic research on complex diseases. Summary of the Invention
[0004] The purpose of this invention is to provide an application of a SNP molecular marker located on chromosome 9 of pigs that is associated with scrotal hernia.
[0005] According to one aspect of the present invention, a SNP molecular marker associated with scrotal hernia is provided on chromosome 9 of pigs, the site being rs318420719, corresponding to the G>A mutation at 129354398 bp on chromosome 9 of the International Pig Reference Genome 11.1; the genotype of the SNP molecular marker is GG, GA or AA.
[0006] The SNP molecular markers provided in this invention are significantly correlated with the incidence of scrotal hernia in pigs. Specifically, pigs with SNP molecular marker genotypes GA and GG have a significantly lower incidence of scrotal hernia than pigs with genotype AA, while pigs with genotype GA have a lower incidence of scrotal hernia than pigs with genotype GG. By breeding pigs with the SNP molecular marker genotype GA, the incidence of scrotal hernia can be reduced, accelerating the progress of genetic defect improvement in pigs.
[0007] According to a second aspect of the present invention, an application is provided for a product capable of detecting the SNP molecular marker of the present invention, the application comprising at least one of the following items (1) to (4): (1) Identify the characteristics of scrotal hernia in pigs; (2) Preparation of products for identifying the characteristics of scrotal hernia in pigs; (3) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype GA to reduce the incidence of scrotal hernia; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.
[0008] In some embodiments, products for detecting the SNP molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices capable of detecting the SNP molecular markers of the present invention.
[0009] In some embodiments, the reagents used to detect the SNP molecular markers of the present invention may include at least one of the following: primers or probes for detecting the SNP molecular markers of the present invention.
[0010] In some embodiments, the primer pair used to detect the SNP molecular markers of the present invention includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify a fragment containing the single nucleotide polymorphism at position 162 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 162 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 129354398 bp on chromosome 9 of the International Pig Reference Genome Version 11.1, is G or A.
[0011] In some embodiments, the kit for detecting the SNP molecular markers of the present invention may include primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.
[0012] In some implementations, the pig is a Large White pig.
[0013] According to a third aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular marker associated with scrotal hernia located on chromosome 9 of pigs; (2) Select individuals with the SNP molecular marker genotype GA and eliminate individuals with the genotypes AA and GG to reduce the incidence of scrotal hernia.
[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.
[0015] In some implementations, the pig in step (1) is a Large White pig.
[0016] In some implementations, step (1), determining the genotype of the SNP molecular marker associated with scrotal hernia located on chromosome 9 of pigs, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the single nucleotide of the SNP molecular marker site in the pig to be tested was determined to be G or A based on the sequencing results, thus determining the genotype of the SNP molecular marker.
[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of the SNP molecular marker rs318420719, which is associated with scrotal hernia on pig chromosome 9, on scrotal hernia. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of scrotal hernia traits in pigs, so as to reduce the incidence of scrotal hernia and reduce the economic losses of breeding enterprises.
[0018] (2) This invention provides a method for genetic improvement of pigs, which can accelerate genetic progress and shorten generation intervals. If all AA-type individuals of the SNP molecular marker rs318420719 that affects scrotal hernia in pigs can be bred into GA-type individuals, the incidence of scrotal hernia in boars will be greatly reduced, the improvement of genetic defects in pigs will be accelerated, and the economic benefits of breeding pigs will be effectively improved. Attached Figure Description
[0019] Figure 1 This is a genome-wide association study (GWAS) plot of the trait of porcine scrotal hernia on chromosome 9 in Large White pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.
[0021] Example 1: Identification and Validation of SNP Molecular Markers Associated with Scrotal Hernia (1) Experimental pig herd This invention used a total of 702 Large White pigs, including 40 pigs with scrotal hernia and 662 healthy pigs. The experimental pig population used in this invention consisted of 702 Large White pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., all of which were core members of the breeding pig division, with detailed pedigree records. The pigs were raised under uniform standards. The pigs had free access to feed and water, and the feeding methods and rearing conditions were all conventional.
[0022] (2) Phenotypic measurement The identification of scrotal hernias in pigs is strictly based on the clinical diagnostic criteria for hernias: Visual observation reveals a clear asymmetry in the scrotum, with the side containing the intestines being slightly larger. When the pig is held upside down by its hind legs and the enlarged scrotum is kneaded, the intestines return to the abdominal cavity, and the scrotum shrinks. When the pig is held upright by its forelegs, its intestines enter the scrotum as it struggles and contracts its abdomen, causing the scrotum to enlarge.
[0023] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from ear tissue samples of Large White pigs using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0024] (4) Genotyping of pig whole genome variation DNA samples were sent to Beijing Novogene Technology Co., Ltd. for next-generation sequencing, and the sequencing results were in FASTQ format.
[0025] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to generate the Large White pig VCF file. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing those with a detection rate <90%, a minor allele count (MAC) of less than 5, and those that failed the Hardy-Weinberg equilibrium test. P <10 -6 The variant sites were identified, excluding those located at unknown locations and on sex chromosomes. The remaining 15,018,537 SNP variant sites and 702 Large White pigs were used for subsequent data analysis.
[0026] (5) Genome-wide association (GWAS) analysis of dominant inheritance models Since kinship and group stratification effects may cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis, and principal component analysis should be performed using GCTA software. The first three principal components are used as covariates to correct for the group structure.
[0027] Genotypic coding at loci was based on a dominant inheritance model, with the reference allele (R) and the alternative allele (A) being encoded as dominant. In the former case, the genotype coding was RR=1, RA=0, AA=0; in the latter case, the genotype coding was AA=1, RA=0, RR=0. Finally, GWAS analysis was performed using a mixed linear model with GEMMA software. This invention employed the Bonferrini method to set the significance threshold, setting the genomic significance level threshold to 0.05 divided by the number of effective variant loci, i.e., 3.3E-09 (0.05 / 15018537).
[0028] The GWAS analysis results of the dominant inheritance model are as follows: Figure 1 As shown.
[0029] from Figure 1 It is known that in Large White pigs, there is a SNP on chromosome 9 that is significantly associated with the scrotal hernia trait, with the strongest association being 9_129354398_G (rs318420719). P =4.54×10 -39 The nucleotide sequence shown in SEQ ID NO:1 is the 162nd nucleotide from the 5' end, corresponding to the G>A mutation at position 129354398 bp on chromosome 9 of the International Pig Reference Genome Version 11.1.
[0030] (6) Analyze the association between different genotypes and the incidence of scrotal hernia to verify the effect of the SNP molecular marker 9_129354398_G on the scrotal hernia trait in pigs. The results are shown in Table 1.
[0031] As shown in Table 1, the incidence of scrotal hernia differed significantly among different genotypes of the SNP molecular marker 9_129354398_G, indicating that this molecular marker affects the incidence of scrotal hernia in pigs. Assisted selection at this SNP locus in pigs can reduce the incidence of scrotal hernia and accelerate the breeding process for genetic defects in boars.
[0032] Furthermore, the incidence of scrotal hernia was significantly lower in individuals with GA and GG scrotal hernias than in individuals with AA scrotal hernias. P The genotype <0.01 indicates that AA is a susceptible genotype for scrotal hernia. Boars with scrotal hernia exhibit reduced usability, decreased growth efficiency, and increased mortality, directly impacting the profits of livestock farms. Individuals with the GA genotype have the lowest incidence rate. Therefore, during breeding, it is necessary to gradually cull AA and GG genotype boars, retaining only GA genotype boars.
[0033] Table 1 Correlation analysis between SNP molecular markers and traits
[0034] (7) Effect analysis This invention provides a SNP molecular marker significantly associated with the trait of scrotal hernia in pigs. By optimizing the dominant allele of this molecular marker, a method for pig breeding can be provided, which can accelerate the genetic progression of the scrotal hernia trait and reduce its incidence. If all individuals with the AA type of the SNP molecular marker affecting scrotal hernia in pigs can be bred into GA type individuals, the incidence of scrotal hernia will be reduced by 46.5%. Reducing the incidence of scrotal hernia in pigs can significantly improve the usability of breeding boars, avoid decreased growth efficiency and increased mortality, thereby increasing the profits of pig farming enterprises and enhancing their core competitiveness.
[0035] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the SNP molecular marker 9_129354398_G associated with scrotal hernia is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.
[0036] SEQ ID NO:1 AATCTGCGTTTTATCCGGCAAATGTGAAGAATAATACTCATAGGTTGATATTTTGTAAAATTTGTAATTCTTGTTTGCACAATTTACTCAATTATATTTAAATGTATTTTAAATACGATATATAGTATAAATAGGAATATATTTAAATGACATTTAAATAT R ATATCATGCCAAGAACAATTGGCTATTCTGTTGATTTTTCAGGGGAAAATAATGCTTATATCTGAAAGTATATGATCATAGAATGACATGGTGATAAAGATGTTTATAGACTTTGTAGAGAAACCCTTCTCTTTTCATAGGGGAAACAGGGCTG In this sequence, R indicates a mutation site, which can be G or A, representing an allele mutation; the bolded beginning and end of the sequence indicate the primer binding positions.
[0037] Upstream primer-F: 5'-AATCTGCGTTTTATCCGGCA-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-CAGCCCTGTTTCCCCTATGA-3' (SEQ ID NO:3).
[0038] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of the SNP molecular marker rs318420719. (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.
[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.
[0040] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.
[0041] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 162 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 129354398 bp on chromosome 9 of the International Swine Reference Genome Version 11.1, was G or A, thus determining the genotype of the SNP molecular marker rs318420719 of the pig to be tested.
[0042] S2. Select pigs with the SNP molecular marker genotype GA as parents for breeding.
[0043] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. Use of a product for detecting a SNP molecular marker associated with scrotal hernia located on pig chromosome 9, characterized in that, The SNP molecular marker is rs318420719, and the application comprises at least one of the following (1)-(4): (1) identifying the scrotal hernia trait of a pig; (2) preparing a product for identifying the scrotal hernia trait of a pig; (3) pig genetic improvement, based on selecting pigs with the SNP molecular marker genotype GA to reduce the incidence of scrotal hernia; (4) preparing a product for assisting in pig genetic improvement, which is based on identifying the genotype of the SNP molecular marker to assist in pig genetic improvement.
2. Use according to claim 1, characterized in that, The product for detecting the SNP molecular marker related to scrotal hernia on chromosome 9 of a pig comprises at least one of the following: a reagent, a kit, a chip and an apparatus for detecting the SNP molecular marker.
3. Use according to claim 2, characterized in that, The reagent for detecting the SNP molecular marker comprises at least one of the following: a primer and a probe for detecting the SNP molecular marker.
4. Use according to claim 3, characterized in that, The primer for detecting the SNP molecular marker comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:
3.
5. The use according to any one of claims 1 to 4, characterized in that, The pig is a Large White pig.
6. A method for genetic improvement of pigs, characterized by, The method comprises the following steps: (1) determining the genotype of the SNP molecular marker related to scrotal hernia on chromosome 9 of a pig; (2) selecting individuals with the SNP molecular marker genotype GA; The SNP molecular marker is rs318420719.
7. The method of genetic improvement of swine according to claim 6, wherein, In step (1), the method for determining the genotype of the SNP molecular marker related to scrotal hernia on chromosome 9 of a pig comprises the following steps: extracting the whole genome DNA of a pig, performing PCR amplification by using a primer pair with the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3, sequencing the amplification product, and determining the genotype of the SNP molecular marker related to scrotal hernia on chromosome 9 of a pig based on the sequencing result.
8. The method of genetic improvement of pigs according to claim 6 or 7, characterized in that, The pig is a Large White pig.