SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 4 and related to scrotal hernia and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker located on a pig chromosome 4 and related to scrotal hernia and application of the SNP molecular marker. The site of the SNP molecular marker corresponds to Cgt at the 84720652 bp position on a chromosome 4 of an international pig reference genome version 11.1; t mutation; the genotype of the gene is CC, CT or TT. The SNP molecular marker provided by the invention is remarkably related to the scrotal hernia morbidity of pigs, the scrotal hernia morbidity of pigs with the genotype of CC is the lowest, and by breeding the pigs with the genotype of CC, the scrotal hernia morbidity can be reduced, and the improvement progress of pig genetic defects can be accelerated.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology and relates to a SNP molecular marker located on pig chromosome 4 that is associated with scrotal hernia and its application. Background Technology

[0002] Scrotal hernia, a common congenital developmental abnormality in boars, significantly impacts the economic benefits of pig farming, the genetic improvement of breeding pigs, and the dissemination of superior genetic resources. The main manifestation of this condition is the descent of abdominal contents from one or both inguinal canals into the scrotum, causing localized, hemispherical swellings of varying sizes. Pigs with scrotal hernias experience a series of stress responses due to pain, affecting animal welfare and leading to additional losses, such as increased feeding, medication, and labor costs for farms. Furthermore, pigs affected by scrotal hernias exhibit reduced feed conversion rates, slow growth, poor body conformation uniformity, lower market prices, and a mortality rate as high as 15%, resulting in varying degrees of economic losses for farms. Research indicates that the formation mechanism of scrotal hernias shares a common anatomical basis across different species—namely, physiological weakness or pathological defects in the inguinal region—but significant differences exist in epidemiological characteristics, pathogenic factors, and clinical symptoms.

[0003] In disease research, genome-wide association studies (GWAS) can be used with case-control designs or quantitative trait analysis to identify differences in allele frequencies and systematically identify genetic loci significantly associated with complex disease phenotypes. Compared to traditional candidate gene studies, GWAS employs a genome-wide scanning approach, enabling the discovery of novel genetic risk loci and providing a broader perspective for genetic research on complex diseases. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker located on chromosome 4 of pigs that is significantly associated with the incidence of scrotal hernia and its application.

[0005] According to one aspect of the present invention, a SNP molecular marker associated with scrotal hernia is provided on chromosome 4 of pigs, the site of which corresponds to the C>T mutation at position 84720652 bp on chromosome 4 of the International Pig Reference Genome 11.1 (named 4_84720652_C); the genotype of the SNP molecular marker is CC, CT or TT.

[0006] The SNP molecular markers provided by this invention are significantly correlated with the incidence of scrotal hernia in pigs. Among them, pigs with the SNP molecular marker genotype CC have the lowest incidence of scrotal hernia. By breeding pigs with the SNP molecular marker genotype CC, the incidence of scrotal hernia can be reduced, and the progress of improving pig genetic defects can be accelerated.

[0007] According to a second aspect of the present invention, an application is provided for a product capable of detecting the SNP molecular marker of the present invention, the application comprising at least one of the following items (1) to (4): (1) Identify the characteristics of scrotal hernia in pigs; (2) Preparation of products for identifying the characteristics of scrotal hernia in pigs; (3) Pig genetic improvement, based on the selection of pigs with SNP molecular marker genotype CC to reduce the incidence of scrotal hernia; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0008] In some embodiments, products for detecting the SNP molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices capable of detecting the SNP molecular markers of the present invention.

[0009] In some embodiments, the reagents used to detect the SNP molecular markers of the present invention may include at least one of the following: primers or probes for detecting the SNP molecular markers of the present invention.

[0010] In some implementations, the pig is a Large White pig.

[0011] According to a third aspect of the present invention, a primer pair is provided for detecting the SNP molecular marker of the present invention, specifically amplifying an amplified fragment containing the single nucleotide polymorphism at position 73 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1. This amplification can be used to identify whether the single nucleotide at position 73 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 84720652 bp on chromosome 4 of the International Pig Reference Genome Version 11.1, is C or T. The primer pair includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0012] According to a fourth aspect of the present invention, a kit for detecting the SNP molecular markers of the present invention is provided, the kit comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0013] In some embodiments, the kit for detecting the SNP molecular markers of the present invention may further include: dNTPs, DNA polymerase, and Mg. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.

[0014] According to a fifth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers associated with scrotal hernia located on chromosome 4 in pigs; (2) Select individuals with the SNP molecular marker genotype CC and eliminate individuals with the genotypes CT and TT to reduce the incidence of scrotal hernia.

[0015] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0016] In some implementations, the pig in step (1) is a Large White pig.

[0017] In some implementations, step (1), determining the genotype of the SNP molecular marker associated with scrotal hernia on chromosome 4 in pigs, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the single nucleotide of the SNP molecular marker site in the pig to be tested was determined to be C or T based on the sequencing results, thus determining the genotype of the SNP molecular marker.

[0018] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a SNP molecular marker 4_84720652_C located on chromosome 4 of pigs that is associated with scrotal hernia, and verifies its effect on scrotal hernia. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of scrotal hernia traits, so as to reduce the incidence of scrotal hernia and reduce the economic losses of breeding enterprises.

[0019] (2) This invention provides a primer pair that can be used to identify the SNP molecular marker 4_84720652_C located on chromosome 4 of pigs and associated with scrotal hernia. This primer pair enables the establishment of an efficient and accurate marker-assisted breeding technology, allowing for rapid and accurate selection of traits and accelerating the breeding process. Applying this to a genetic improvement program for the scrotal hernia trait in pigs can significantly improve the usability of boars, prevent a decline in growth efficiency and an increase in mortality, thereby increasing the profits of livestock farming enterprises and enhancing their core competitiveness. (3) This invention provides a method for pig genetic improvement by selecting the dominant allele of the SNP molecular marker 4_84720652_C, which is associated with scrotal hernia, located on chromosome 4 of pigs. This method can accelerate genetic progress and shorten the generation interval. If all individuals with the CT type of the SNP molecular marker that affects scrotal hernia can be bred into CC type individuals, the incidence of scrotal hernia in breeding boars will be significantly reduced, the improvement of pig genetic defects will be accelerated, and the economic benefits of breeding pigs will be effectively improved. Attached Figure Description

[0020] Figure 1 This is a genome-wide association study (GWAS) plot of the scrotal hernia trait on chromosome 4 in Large White pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0022] Example 1: Identification and Validation of SNP Molecular Markers Associated with Scrotal Hernia (1) Experimental pig herd This invention used a total of 702 Large White pigs, including 40 pigs with scrotal hernia and 662 healthy pigs. The experimental pig population used in this invention consisted of 702 Large White pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., all of which were core members of the breeding pig division, with detailed pedigree records. The pigs were raised under uniform standards. The pigs had free access to feed and water, and the feeding methods and rearing conditions were all conventional.

[0023] (2) Phenotypic measurement The identification of scrotal hernias in pigs is strictly based on the clinical diagnostic criteria for hernias: Visual observation reveals a clear asymmetry in the scrotum, with the side containing the intestines being slightly larger. When the pig is held upside down by its hind legs and the enlarged scrotum is kneaded, the intestines return to the abdominal cavity, and the scrotum shrinks. When the pig is held upright by its forelegs, its intestines enter the scrotum as it struggles and contracts its abdomen, causing the scrotum to enlarge.

[0024] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from ear tissue samples of Large White pigs using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0025] (4) Genotyping of pig whole genome variation DNA samples were sent to Beijing Novogene Technology Co., Ltd. for next-generation sequencing, and the sequencing results were in FASTQ format.

[0026] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to generate the Large White pig VCF file. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing those with a detection rate <90%, a minor allele count (MAC) of less than 5, and those that failed the Hardy-Weinberg equilibrium test. P <10 -6 The variant sites were identified, excluding those located at unknown locations and on sex chromosomes. The remaining 15,018,537 SNP variant sites and 702 Large White pigs were used for subsequent data analysis.

[0027] (5) Genome-wide association (GWAS) analysis of dominant inheritance models Since kinship and group stratification effects may cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis, and principal component analysis should be performed using GCTA software. The first three principal components are used as covariates to correct for the group structure.

[0028] GWAS analysis was performed using a mixed linear model with GEMMA software. This invention employs the Bonferrini method to set the significance threshold, setting the genomic significance level threshold to 0.05 divided by the number of valid variant sites, i.e., 3.3E-09 (0.05 / 15018537).

[0029] GWAS analysis results of dominant inheritance model as follows Figure 1 As shown.

[0030] from Figure 1 It is known that in Large White pigs, there is a SNP on chromosome 4 that is significantly associated with the scrotal hernia trait, with the strongest association being 4_84720652_C ( P =9.65×10 -12 The 73rd nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO:1 corresponds to the C>T mutation at position 84720652 bp on chromosome 4 of the International Pig Reference Genome Version 11.1.

[0031] (6) Analyze the association between different genotypes and the incidence of scrotal hernia to verify the effect of the SNP molecular marker 4_84720652_C on scrotal hernia traits. The results are shown in Table 1.

[0032] As shown in Table 1, the incidence of scrotal hernia differed significantly among different genotypes of the SNP molecular marker 4_84720652_C, indicating that this molecular marker affects the incidence of scrotal hernia. The incidence of scrotal hernia can be reduced by assisted selection at this SNP locus in pigs, thereby accelerating the breeding process of genetic defects in boars.

[0033] Furthermore, Table 1 shows that the incidence of scrotal hernia is low in CC-type individuals, indicating that CT type is a susceptible genotype for scrotal hernia. Boars with scrotal hernias experience reduced usability, decreased growth efficiency, and increased mortality, directly impacting the profits of livestock farms. Therefore, in the breeding process, it is necessary to gradually eliminate CT-type breeding pigs and retain CC-type breeding pigs.

[0034] Table 1 Correlation analysis between SNP molecular markers and traits

[0035] (7) Effect analysis This invention provides a SNP molecular marker significantly associated with the scrotal hernia trait. By optimizing the dominant allele of this molecular marker, a method for pig breeding can be provided, which can accelerate the genetic progression of the scrotal hernia trait and reduce its incidence. If all individuals with the CT type of the SNP molecular marker affecting scrotal hernia can be bred into CC type individuals, the incidence of scrotal hernia will be reduced by 20%. Reducing the incidence of scrotal hernia can significantly improve the usability of breeding boars, avoid decreased growth efficiency and increased mortality, thereby increasing the profits of pig farming enterprises and enhancing their core competitiveness.

[0036] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the SNP molecular marker 4_84720652_C associated with scrotal hernia is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0037] SEQ ID NO:1 GTCTGCCTGGGTCTCTTCTTTCAACCAGGGACAGTGCTCCCTGGTGTCTTCAGTCTGCTTCTACCCCATGAC Y TCTTTCTGCATTTTGACCAGGACATGTGTCCTGCTCTCTGTTGAAGATCTTGCATGGGGACTCTAGCCCAGGACTTCATAGTCAGTGGCAGAGGTGTG In this sequence, Y indicates a mutation site, which is either C or T, representing an allele mutation; the bolded beginning and end of the sequence indicate the primer binding positions.

[0038] Upstream primer-F: 5'- GTCTGCCTGGGTCTCTTCTT-3' (SEQ ID NO:2); Downstream primer-R: 5'- CACACCTCTGCCACTGACTA-3' (SEQ ID NO:3).

[0039] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of SNP molecular marker 4_84720652_C (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0040] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.

[0041] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0042] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 73 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 84720652 bp on chromosome 4 of the International Swine Reference Genome Version 11.1, was C or T, thus determining the genotype of the SNP molecular marker 4_84720652_C in the pig to be tested.

[0043] S2. Select pigs with the SNP molecular marker genotype CC as parents for breeding.

[0044] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker located on pig chromosome 4 associated with scrotal hernia, characterized in that, The SNP molecular marker is located at 84720652 bp on chromosome 4 of the international pig reference genome version 11.1, and the nucleotide type of the site is C or T; the genotype of the SNP molecular marker is CC, CT or TT.

2. Use of a product for detecting the SNP molecular marker according to claim 1, characterized in that, The application comprises at least one of the following (1) to (4): (1) identifying the scrotal hernia trait of a pig; (2) preparing a product for identifying the scrotal hernia trait of a pig; (3) genetic improvement of a pig, based on breeding a pig with the genotype CC of the SNP molecular marker to reduce the incidence of scrotal hernia; (4) preparing a product for assisting in genetic improvement of a pig, which is based on identifying the genotype of the SNP molecular marker to assist in genetic improvement of a pig.

3. Use according to claim 2, characterized in that, The product for detecting the SNP molecular marker according to claim 1 comprises at least one of the following: reagents, kits, chips and devices for detecting the SNP molecular marker.

4. Use according to claim 3, characterized in that, The reagents for detecting the SNP molecular marker comprise at least one of the following: primers and probes for detecting the SNP molecular marker.

5. The use according to any one of claims 2 to 4, characterized in that, The pig is a Large White pig.

6. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that, The primer pair specifically amplifies an amplified fragment containing a single nucleotide polymorphism at the 73rd nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO: 1, wherein the 73rd nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO: 1 is C or T; The primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

7. A kit for detecting the SNP molecular marker according to claim 1, characterized in that, The composition comprises the primer pair according to claim 6.

8. A method of genetic improvement of swine, characterized by, The method comprises the following steps: (1) determining the genotype of the SNP molecular marker according to claim 1 in a pig; (2) breeding an individual with the genotype CC of the SNP molecular marker.

9. The method of genetic improvement of swine according to claim 8, wherein, In step (1), the method for determining the genotype of the SNP molecular marker according to claim 1 in a pig comprises the following steps: Extracting the whole genome DNA of the pig, performing PCR amplification using the primer pair with the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3, sequencing the amplification product, and determining the genotype of the SNP molecular marker according to claim 1 in the pig based on the sequencing results.

10. The method of genetic improvement of pigs according to claim 8 or 9, characterized in that, The pig is a Large White pig.

Images