Absolute quantitative detection kit for archaea amoA gene
By providing new primers and kits for absolute quantitative detection of the archaea amoA gene, the problem of low amplification efficiency in existing technologies has been solved, achieving efficient and accurate quantitative detection of the archaea amoA gene.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-14
- Publication Date
- 2026-03-17
AI Technical Summary
The lack of efficient primers and kits for quantitative detection of the amoA gene in archaea in existing technologies leads to low detection efficiency.
A novel primer and kit for absolute quantitative detection of the archaea amoA gene is provided, including primer sequences GCAGCCGACTACATCTTCTAC and CATAATACGTTGCCGTTCCT, as well as SYBR Green I Mix and standards, for detection via real-time PCR amplification.
It achieved efficient amplification of the archaea amoA gene, with an "S"-shaped amplification curve and a CT value between 24 and 34, making it suitable for quantitative PCR experiments. The amplification product was single, and the amplification efficiency was as high as 95.97%.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of biological detection technology, and in particular relates to an absolute quantitative detection method, primers and kit for the amoA gene in archaea. Background Technology
[0002] Ammonia oxidation is a crucial step in the nitrogen cycle, in which ammonia (NH3) is oxidized to hydroxylamine (NH2OH), which is then converted into nitrite (NO2⁻). This process is primarily carried out by two types of microorganisms: ammonia-oxidizing bacteria and ammonia-oxidizing archaea. Both types of microorganisms contain the amoA (ammonia monooxygenase) gene, but their sequences and characteristics differ.
[0003] The archaea amoA gene encodes the α subunit of ammonia monooxygenase, a key enzyme in ammonia oxidation. Due to its high specificity and conservation in ammonia-oxidizing microorganisms, the amoA gene is frequently used as a molecular marker to detect and quantify ammonia-oxidizing microbial communities in environmental samples. Amplifying the amoA gene fragment by PCR and then sequencing or analyzing a clone library can reveal the diversity, abundance, and distribution patterns of ammonia-oxidizing microorganisms in different ecosystems. Quantitative analysis of the amoA gene content in genomic DNA using qPCR can assess the abundance of ammonia-oxidizing microorganisms under different environmental conditions. In conclusion, the amoA gene is an important tool in ammonia-oxidizing microorganism research, providing strong support for a deeper understanding of the microbial mechanisms of nitrogen cycling, assessing environmental nitrogen conversion efficiency, and developing novel nitrogen fertilizer and wastewater treatment technologies.
[0004] The advantages of quantitative real-time PCR analysis are mainly reflected in its convenient operation, high speed, and high accuracy. Currently, the primers used for quantitative PCR of the amoA gene are F: sTAATGGTCTGGCTTAGACG, R: GCGGCCATCCATCTGTATGT and F: GACTACATMTTCTAYACWGAYTGGGC, R: GGKGTCATRTATGGWGGYAAYGTTGG. Their amplification products are relatively long or contain a large number of degenerate bases. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a primer and kit for the absolute quantitative detection of the archaea amoA gene, and at the same time provide a method for the absolute quantitative detection of the archaea amoA gene, in order to overcome the shortcomings of the prior art.
[0006] The technical solution adopted by this invention to solve its technical problem is: A primer for the absolute quantitative detection of the amoA gene in archaea, wherein the primer sequence is as follows: amoA_F: GCAGGCGACTACATCTTCTAC amoA_R:CATAATACGTTGCCGTTCCT The present invention also provides an absolute quantitative detection kit for the archaea amoA gene, comprising the above-mentioned detection primers, SYBR Green I Mix (Jiangsu Weiqing Biotechnology) and standards.
[0007] This invention also provides an application of a primer for the absolute quantitative detection of the archaea amoA gene, which is highly efficient in amplifying archaea, in the detection of ammonia monooxygenase in soil.
[0008] This invention also provides a method for absolute quantitative detection of the amoA gene in archaea, comprising the following steps: The archaeal genomic DNA was extracted to obtain the sample to be tested; The primers described in claim 2 were used to perform a fluorescence quantitative PCR amplification reaction on the sample to be tested. The amplification products were then detected.
[0009] Preferably, the quantitative PCR amplification reaction system of the absolute quantitative detection method for the archaea amoA gene of the present invention is as follows: qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0010] Preferably, the method for absolute quantitative detection of the amoA gene in archaea of the present invention uses archaea derived from soil.
[0011] Preferably, the absolute quantitative detection method for the archaea amoA gene of the present invention includes the following PCR amplification reaction steps: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95℃ for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle.
[0012] The beneficial effects of this invention are: (1). The primers for absolute quantitative detection of the archaea amoA gene in this application showed an S-shaped amplification curve, which was normal. The melting curve was a single peak, indicating that the amplification product was singular and there was no non-specific amplification.
[0013] (2). The CT value of the primers for absolute quantitative detection of the archaea amoA gene in this application is between 24 and 34, which is a reasonable range and suitable for quantitative PCR experiments.
[0014] (3). Through comparison with NCBI and the construction of the BLAST database, it was found that this primer can amplify more archaea amoA genes. Attached Figure Description
[0015] The technical solution of this application will be further described below with reference to the accompanying drawings and embodiments.
[0016] Figure 1 This is the amplification curve of the primers for absolute quantitative detection of the archaea amoA gene in this application embodiment; Figure 2 This is the melting curve of the primers for absolute quantification of the archaea amoA gene in this application embodiment; Figure 3 This is the standard curve of the primers for absolute quantitative detection of the archaea amoA gene in this application embodiment. Detailed Implementation
[0017] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. Example
[0018] This embodiment provides a primer for the absolute quantitative detection of the archaea amoA gene, the sequence of which is: amoA_F: GCAGGCGACTACATCTTCTAC amoA_R:CATAATACGTTGCCGTTCCT Example
[0019] This embodiment provides an absolute quantitative detection kit for the amoA gene in archaea, including the detection primers as described in Example 1, SYBR Green I Mix (Jiangsu Weiqing Biotechnology), and standards. Example
[0020] This embodiment provides an application of a high-efficiency primer for amplifying the amoA gene of archaea for absolute quantitative detection in the examination of ammonia monooxygenase in soil archaea. Example
[0021] This embodiment provides a method for absolute quantitative detection of the amoA gene in archaea, including the following steps: S1: Genomic DNA was extracted from the archaea to obtain the sample to be tested; DNA was extracted using the Tiangen Soil Genomic DNA Extraction Kit (DP336). The eluted solution from the Tiangen Soil Genomic DNA Extraction Kit (DP336) was used to dilute the sample 30 times to obtain the sample to be tested.
[0022] S2: Perform qPCR amplification reaction on the sample to be tested using the kit described in Example 2; The quantitative PCR amplification reaction system is as follows: qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0023] S3: Detect the PCR amplification products.
[0024] The PCR amplification reaction steps are as follows: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95°C for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle. Example
[0025] 1. Material preparation: Genomic DNA extraction of archaea from soil was performed using the Tiangen Soil Genomic DNA Extraction Kit (DP336). The DNA was collected by elution, approximately 80 μL. 10 μL was then diluted to 300 μL for detection.
[0026] 2. Construction of Standards: Standards were constructed using gene synthesis, with the sequence: GCAGGCGACTACATCTTCTACACTGACTGGGCCTGGACTTCATTTGTTGTGTTTTCAATATCACAAACATTGATGTTGGTAGTTGGCGCATGCTACTATCTCACATTCACTGGAGTACCAGGAACGGCAACGTATTATG, which was used to calculate amplification efficiency.
[0027] 3. Primer design for the soil sulfur metabolism gene amoA: First, the archaea amoA gene sequence was downloaded from NCBI, and a large number of primers were designed using Primer3 software. Second, a local prime blast database was constructed using the downloaded sequence, and all primers were subjected to local prime blast to screen for primers that could amplify more of the amoA gene. Finally, the obtained primers were primed using NCBI to select primers that could amplify more of the amoA gene, and which were mostly archaea. Specific primer information is as follows: Primer Name Primer Sequence (5' -> 3') Product Length amoA_F: GCAGGCGACTACATCTTCTAC 139bp amoA_R:CATAATACGTTGCCGTTCCT 4. Quantitative PCR amplification reaction system (SYBR Green I Jiangsu Weiqing Biotechnology): qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0028] Quantitative PCR reaction steps: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95°C for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle.
[0029] 5. After dissolving the standard prepared in step two, perform a 10-fold serial dilution, fit a standard curve, and calculate the amplification efficiency. The standard curve equation for this primer is: Y = -3.4222X + 37.3207. Figure 3 As shown, R² is 0.9987, and the amplification efficiency is 95.97%.
[0030] 6. Sample testing and verification: Using the DNA extracted in the first step as a template, the amplification of the primers was tested. The CT value of this sample was between 24 and 34, and the calculated copy number of the amoA gene per gram of soil archaea was approximately 10. 4 -10 8Due to differences in soil pH, element content, and suitable bacterial living environments, the copy number may vary significantly between different soils.
[0031] Based on the above-described preferred embodiments according to this application, and through the foregoing description, those skilled in the art can make changes and modifications to the samples without departing from the technical concept of this application. The technical scope of this application is not limited to the contents of the specification, but must be determined according to the scope of the claims.
Claims
1. A highly efficient amplification of archaea amoA gene absolute quantitative detection primer, characterized in that, The sequence of the primer is: amoA_F: GCAGGCGACTACATCTTCTAC amoA_R: CATAATACGTTGCCGTTCCT 2. A kit for absolute quantification of archaeal amoA gene, characterized in that, The detection primer as claimed in claim 1.
3. Application of the amplification archaea amoA gene absolute quantitative detection primer in testing archaea monooxygenase in soil.
4. A method for absolute quantification of archaeal amoA gene, characterized by, The method comprises the following steps: extracting archaea genomic DNA to obtain a sample to be detected; performing a fluorescent quantitative PCR amplification reaction on the sample to be detected by using the primer as claimed in claim 2; detecting the amplification product.
5. The method for absolute quantification of archaeal amoA gene according to claim 4, characterized in that, The quantitative PCR amplification reaction system is: qPCR Mix: 10ul, Primer_F+R: 1ul, DNA template: 0.5ul, and adding water to 20ul.
6. The method for absolute quantification of archaeal amoA gene according to claim 4, characterized in that, The PCR amplification reaction steps are: pre-denaturation: temperature 95℃, time 5min, cycle number 1; denaturation: temperature 95℃, time 10sec; annealing and extension: temperature 60℃, time 40sec, cycle number 40; melting curve collection: temperature 95℃, time 15sec, temperature 60℃, time 60sec, temperature 95℃, time 30sec, temperature 60℃, time 15sec, cycle number 1.