KASP molecular marker for heat resistance of green vegetables and application of KASP molecular marker

Abstract

The invention belongs to the technical field of vegetable agronomic trait molecular marker development and molecular marker-assisted breeding, and particularly relates to a molecular marker suitable for rapid identification of heat resistance traits of green vegetables and molecular marker-assisted breeding and application of the molecular marker. The invention provides a KSAP molecular marker related to heat resistance of green vegetables. The KSAP molecular marker is used for identifying the heat resistance of the green vegetables. The molecular marker obtained by the invention is a heat-resistant KASP molecular marker for green vegetables, and can be used for rapidly identifying heat-resistant and heat-sensitive green vegetables, so that the breeding efficiency of the heat-resistant green vegetables is improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker development for vegetable agronomic traits and molecular marker-assisted breeding technology, specifically involving a molecular marker and its application for rapid identification of heat resistance traits in Chinese cabbage and molecular marker-assisted breeding. Background Technology

[0002] Plants are subject to various abiotic stresses during their growth, among which temperature is a crucial environmental factor that regulates plant growth and development as well as crop agronomic traits. Due to global warming and various extreme weather events, plants, as stationary organisms, cannot actively avoid adverse environments when exposed to high temperatures, often resulting in irreversible physiological damage. This severely impacts plant growth and development, reduces crop yield and quality, and threatens global food security. Heat stress refers to the phenomenon where plants encounter high temperatures exceeding their normal growth range, leading to inhibited or damaged growth and development (Khan et al., 2019).

[0003] Green vegetables( Brassica rapa ssp. chinensis It is also commonly known as non-heading Chinese cabbage, baby bok choy, etc., and belongs to the genus Brassica of the family Brassicaceae. Brassica Chinese cabbage seeds ( Brassica rapa A significant variant of leafy greens (Nagaharu., 1935). Originating in China, leafy greens have a long history of cultivation and are grown throughout the country (Chen et al., 2024). They are popular with consumers due to their unique flavor and rich nutrition. Leafy greens also play a vital role in ensuring year-round vegetable production and supply, serving as an important vegetable variety for people's "vegetable basket" (Ding Haifeng et al., 2020). Leafy greens prefer cool temperatures, with an optimal growth temperature of 15-25 ℃. In recent years, with the increasingly severe global warming, leafy greens have exhibited symptoms such as stunted plant growth, reduced marketability, and increased pests and diseases, seriously affecting market supply and hindering the development of the leafy greens industry (Liu et al., 2018).

[0004] To explore the molecular regulatory mechanism of heat tolerance in Chinese cabbage, researchers sampled leaves from heat-tolerant and heat-sensitive Chinese cabbage plants after 4 h of heat stress at 40 °C. Using transcriptome analysis and healthy plants cultured at 23 °C as controls, Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis identified many differentially expressed genes. These differentially expressed genes were mainly classified into photosynthetic regulation, sugar metabolism pathways, secondary metabolite synthesis, plant hormone signal transduction, and heat shock transcription factor regulation, providing new insights into the heat tolerance mechanism of Chinese cabbage (Gao et al., 2025).

[0005] Parental line P1 is 'OY-42', a high-generation hybrid of the Guangliang variety 'Black Rose', and parental line P2 is 'GP-54', a high-generation inbred line of the Japanese Musashino variety 'Kaei'. Previous studies in our laboratory have shown that the two varieties exhibit significant differences in high-temperature tolerance in the field. After 6 days of heat stress treatment at 37 ℃, parental line P1 showed some leaf margin curling without obvious chlorosis; parental line P2, on the other hand, showed obvious chlorosis, yellowing, shrinkage, and scorching of all leaves. Analysis of the heat damage index after heat stress treatment showed that parental line P1 had significantly higher heat tolerance than parental line P2. Based on phenotypic analysis of the segregating population, the F1 phenotype was found to be heat-sensitive, indicating that heat tolerance in Chinese cabbage is a recessive trait. The heat tolerance grading in the F2 population showed a normal distribution, consistent with the characteristics of a quantitative trait controlled by multiple genes.

[0006] In the current sustainable development system of the vegetable industry, breeding heat-resistant leafy greens is the most economical, effective, safe, and reliable technical solution. However, heat-resistant leafy green breeding currently faces multiple challenges: first, there is no unified, efficient, and accurate phenotypic evaluation technology for measuring heat resistance in leafy greens; second, there is a severe lack of molecular markers available for breeding; and third, the reserve of heat-resistant germplasm in germplasm resource banks is relatively insufficient.

[0007] The references mentioned above are as follows: Khan S, Anwar S, Ashraf MY, et al,. 2019. Mechanisms and AdaptationStrategies to Improve Heat Tolerance in Rice. A Review[J]. Plants, 8(11): 508; Nagaharu, U. 1935. Genome Analysis in Brassica with Special Reference to the Experimental Formation of B. Napus and Peculiar Mode of Fertilization[J]. JapaneseJournal of Botany, 7, 389-452; Chen L, Jiang C, Ye L, et al,. 2024. Genome-wide identification ofC2H2-ZFPs and functional Analysis of BcZAT12 and BcZAT10 under cold stress in non-headingChinese cabbage[J]. Environmental and Experimental Botany, 217: 105574; Ding Haifeng, Fan Jianguang, Jia Changcai, et al. 2020. Current Status and Trends of Vegetable Seed Industry Development in my country [J]. China Vegetables (9): 1-8; Liu G, Xia Y, Liu T, et al,. 2018. The DNA Methylome and Association of Differentially, Methylated Regions with Differential Gene Expressionduring Heat Stress in Brassica rapa[J]. International Journal of MolecularSciences, 19(5): 1414; Gao Z, Wang H, Chen Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a KASP molecular marker for the heat resistance trait of leafy greens and its application.

[0009] To address the aforementioned technical problems, this invention provides a KSAP molecular marker related to the heat resistance trait of Chinese cabbage: used for the identification of heat resistance traits in Chinese cabbage, wherein the molecular marker primers are selected from the following primer pairs, wherein: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTTTATAGCTCATGGAGATCGTCGA-3' Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTTATAGCTCATGGAGATCGTCGT-3' Reverse primer Common: 5'-AAGAGATCACTATCACCACTGACT-3'.

[0010] As an improvement to the KSAP molecular marker of this invention: located at position 1909606 on chromosome 3 of the Chinese cabbage genome (referencing the Chinese cabbage non-heading genome database: https: / / www.tbirs.cn / NHCCDB / Genome.jsp), the 50 bp sequence before and after the molecular marker site is as follows: AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG A CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA; AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG T CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA.

[0011] That is, the present invention uses mixed grouping analysis sequencing method and KASP genotyping technology to obtain an SNP site that is significantly associated with heat resistance of Chinese cabbage. The site is located at 1909606 on chromosome 3 of the Chinese cabbage genome, and the sequence before and after 50 bp is as described above.

[0012] As a further improvement to the KASP molecular marker of the present invention: The KASP molecular marker genotype is A or T; the sequence of the A genotype is shown in the first segment above, and the corresponding phenotype is heat-resistant; the sequence of the T genotype is shown in the second segment above, and the corresponding phenotype is heat-sensitive.

[0013] The present invention also provides the use of the above-mentioned KASP molecular marker in identifying the heat resistance of four-leaf-one-heart stage Chinese cabbage under high temperature (37°C) conditions.

[0014] An improvement to the use of this invention: molecular-assisted selection breeding for rapid identification of heat resistance of Chinese cabbage germplasm and its hybrid offspring.

[0015] As a further improvement to the use of the present invention: when screening for heat-resistant vegetable germplasm, germplasm with the same genotype as the heat-resistant trait is selected for breeding; When screening the offspring of crosses between heat-resistant and heat-sensitive traits, select individual plants whose genotypes match those of the heat-resistant trait for breeding.

[0016] In this invention: The application of KASP molecular markers in identifying the heat resistance of four-leaf-one-heart stage Chinese cabbage under high-temperature conditions includes the following steps: (1) The heat-resistant parent P1 ('OY-42') and the heat-sensitive parent P2 ('GP-54') were crossed, and then self-crossed to obtain the F2 generation population; (2) Extract genomic DNA from the parent plants and hybrid offspring of Chinese cabbage using a rapid plant genomic DNA extraction method; (3) The KASP molecular marker was used to amplify the genomic DNA of Chinese cabbage by PCR (Note: the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the amplification was performed on an ABI Setp One PCR instrument). (4) Based on the differences in fluorescence signals in the PCR amplification results, identify the genotype of each vegetable to be tested: if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F-FAM, then the vegetable to be tested is homozygous genotype AA; if it is consistent with the fluorescence adapter color of the forward primer F-HEX, then the vegetable to be tested is homozygous genotype TT; if the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter colors of both the forward primer F-FAM and the forward primer F-HEX, then the vegetable to be tested is heterozygous genotype AT.

[0017] The PCR reaction system used for PCR amplification was as follows: 5.0 μL of 20-50 ng / μL Chinese cabbage genomic DNA, 5.0 μL of KASPMaster mix, and 0.14 μL of KASP Assay Mix (10 ng / μL F-FAM primer, 10 ng / μL F-HEX primer, and 10 ng / μL Common reverse primer, in a volume ratio of 2:2:5), for a total volume of 10.14 μL. The PCR program was as follows: 30 ℃ for 1 minute (reading fluorescence signal); 94 ℃ for 15 minutes (pre-denaturation); 94 ℃ for 20 seconds (denaturation); 61-55 ℃ for 1 minute (annealing & extension; amplification using a touch-down program for 10 cycles, decreasing the temperature by 0.6 ℃ per cycle); 94 ℃ for 20 seconds (denaturation); 55 ℃ for 60 seconds, amplification for 35 cycles; 30 ng / μL... Set the temperature to ℃ for 1 minute (read the fluorescence signal); after amplification, detect the fluorescence signal and check the genotyping results.

[0018] The purpose of this invention is to address the shortcomings of existing technologies by providing a KSAP molecular marker related to heat tolerance traits in leafy green vegetables and its applications. The molecular marker obtained by this invention is a KASP molecular marker for heat tolerance in leafy green vegetables, which can be used for the rapid identification of heat-tolerant and heat-sensitive leafy green vegetables, thereby improving the breeding efficiency of heat-tolerant leafy green vegetables. In other words, this invention provides the application of the aforementioned KASP molecular marker in molecular-assisted breeding for heat tolerance in leafy green vegetables.

[0019] This invention has the following technical advantages: 1. Preliminary screening: Genotype markers can be detected in advance by testing plants at the four-leaf-one-heart stage to predict the heat tolerance phenotype of plants in the later stage.

[0020] 2. Alternative to phenotypic screening: Using marker screening to replace phenotypic screening for large-scale heat stress treatment, reducing field workload and plant mortality caused by heat stress treatment.

[0021] 3. Improve screening efficiency and accuracy: The heat tolerance phenotype of a plant is the result of the interaction between genotype and environment. Heat tolerance screening based on phenotype may lead to selection errors due to environmental differences. Combining molecular markers to screen genotypes can greatly improve the accuracy and efficiency of screening. Attached Figure Description

[0022] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0023] Figure 1 These are the symptoms of heat-resistant parent P1 (A), heat-sensitive parent P2 (B), and hybrid offspring F1 (C) after being subjected to heat stress at 37 ℃; Figure 2 The trend of heat damage index changes of heat-resistant parent P1 and heat-sensitive parent P2 after heat stress treatment at 37 ℃; Figure 3 This is a marker genotyping diagram of KASP molecular markers in parents P1, P2, and F1. Red dots represent the homozygous AA genotype of parent P1; blue dots represent the homozygous TT genotype of parent P2; green dots represent the heterozygous AT genotype; and × indicates the blank control of ddH2O. Figure 4 This is a genotyping diagram of KASP molecular markers in F2 offspring, where red dots represent the same genotype as the parent P1 homozygous AA type; blue dots represent the same genotype as the parent P2 homozygous TT type; green dots represent the heterozygous AT genotype; and × indicates the blank control of ddH2O. Figure 5 This is a genotyping diagram of KASP molecular markers in 12 Chinese cabbage germplasm resources. Blue dots represent the same genotype as the homozygous AA type of parent P1; red dots represent the same genotype as the homozygous TT type of parent P2; green dots represent the heterozygous AT genotype; and × indicates the blank control of ddH2O. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: Example 1: Identification of heat resistance of leafy greens The following were selected as the parental materials: parent P1 was the high-generation hybrid line 'OY-42' of the Guangliang variety 'Black Rose', and parent P2 was the high-generation inbred line 'GP-54' of the Japanese Musashino variety 'Hara'. The F1 offspring of these two hybrids were subjected to heat stress treatment at 37 ℃. The heat tolerance of the vegetables was comprehensively evaluated by observing plant phenotypic characteristics and calculating the heat damage index. Figure 1 , 2 .

[0025] The following method is used to obtain it: I. Treatment of heat stress: The cabbage plants that have grown to the four-leaf stage are transferred to an artificial climate incubator, where a daytime temperature of 37 ℃ and a nighttime temperature of 27 ℃ are set. The plants are given 12 hours of light and 12 hours of darkness each day, with a light intensity of 20,000 lx and a relative humidity of 50%. After 6 days of continuous treatment, the heat resistance of the plants can be assessed.

[0026] II. Observation of heat damage symptoms in plants: Six days after heat stress, leaf curling and chlorosis were selected as indicators to establish a grading standard for heat damage symptoms in Chinese cabbage. Based on this standard, the heat tolerance level of the Chinese cabbage plants was investigated and statistically analyzed. The heat tolerance grading results are as follows: 0 = No symptoms of heat damage, plant leaves are completely normal; 1 = The number of leaves damaged by heat is less than 1 / 3 of the total number of leaves on the plant, and the leaf edges are slightly curled; 3 = 1 / 3 of the total number of leaves of the plant ≤ number of leaves damaged by heat < 1 / 2 of the total number of leaves of the plant; the edges of the leaves damaged by heat are obviously curled and there are no scorched edges. 5 = 1 / 2 of the total number of leaves of the whole plant ≤ number of leaves damaged by heat < 2 / 3 of the total number of leaves of the whole plant. The edges of the leaves damaged by heat are obviously curled, some leaves turn pale green, and occasionally there are shrinkage and scorching edges. 7 = The number of heat-damaged leaves is greater than 2 / 3 of the total number of leaves on the plant. The edges of the heat-damaged leaves are severely curled, some leaves turn yellow and turn pale green, and the shrinkage and scorching of the edges are obvious. 9 = All leaves wilt, and the plant dies.

[0027] Plants rated 0 or 1 were considered heat-tolerant, while those rated 7 or 9 were considered heat-sensitive. A heat damage index was also calculated (Note: Heat damage index (%) = ∑(Ri×Rd) / (Wi×Wd)×100, where Ri is the total number of plants at each heat damage level, Rd is the grade value for each heat damage level, Wi is the total number of plants surveyed, and Wd is the highest heat damage grade). The plant's heat tolerance was determined by combining these two data points.

[0028] according to Figure 1 After 6 days of heat stress treatment at 37 ℃, some leaves of parent P1 showed leaf margin curling but no obvious chlorosis; all leaves of parent P2 showed obvious chlorosis, yellowing, shrinkage, and scorching. Further calculation of the heat damage index can be found in [link to calculation]. Figure 2 It can be seen that the heat tolerance of parent P1 is significantly higher than that of parent P2. At the same time, in the F1 generation of the cross, the F1 plants showed severe leaf curling, chlorosis and yellowing, and obvious shrinkage and scorching of the leaves, which showed that they were highly sensitive to heat stress. This indicates that the heat tolerance of Chinese cabbage is a quantitative trait recessive inheritance characteristic controlled by multiple genes.

[0029] Example 2: Genetic analysis and gene mapping of heat resistance in Chinese cabbage We selected leafy greens as our parental materials—parent P1 being the high-generation hybrid line 'OY-42' of the Guangliang variety 'Black Rose', parent P2 being the high-generation inbred line 'GP-54' of the Japanese Musashino variety 'Hara', the F1 offspring of the two hybrids, and the F2 population obtained by self-pollination of the F1. We treated them with 37 ℃ heat stress for 6 days, and determined heat tolerance by plant phenotypic symptoms, and conducted heat tolerance genetic analysis. We also selected leafy greens as our materials, extracted DNA using the plant genomic DNA rapid extraction method, and sequenced it. Then, based on BSA analysis and KASP genotyping technology, we located a heat tolerance-related QTL located in the interval 1908505-1910453 on chromosome 3.

[0030] The following method is used to obtain it: I. Genetic Analysis of Heat Tolerance The heat stress treatment method described in Example 1 was used to inoculate 339 individual plants of the F2 population. Based on the phenotypic assessment of heat tolerance, 34 plants had a heat injury symptom level of 1; 159 plants had a heat injury symptom level of 3; 111 plants had a heat injury symptom level of 5; and 35 plants had a heat injury symptom level of 7. The results conformed to the characteristics of a normal distribution, indicating that the heat tolerance trait of this Chinese cabbage is controlled by recessive polygenic genes.

[0031] II. Location of heat-resistant genes 1) Extracting DNA Take young leaves (about 1 cm) from each plant. 2 After flash freezing with liquid nitrogen, the leaves were ground using a tissue homogenizer, and total DNA was extracted following the procedures provided by the Plant DNAzol kit manufactured by Hangzhou Laifeng Biotechnology Co., Ltd. DNA concentration and purity were determined using a NanoDrop micro-spectrophotometer.

[0032] 2) Location of heat-resistant genes Extreme pools were constructed using heat-tolerant / heat-sensitive samples from two heat-tolerant / heat-sensitive parents, P1 / P2, F1, and F2, and genome resequencing was performed. Analysis using the SNP-index method and QTLseqr software algorithm identified one QTL region highly associated with heat tolerance in Chinese cabbage, with a total length of 81.78 kb. The candidate region contained 21 candidate genes, 18 of which contained non-synonymous mutant SNPs. Further fine mapping using KASP genotyping technology revealed a SNP locus significantly associated with heat tolerance in Chinese cabbage, located at position 1909606 on chromosome 3 of the Chinese cabbage genome.

[0033] Example 3: Development of KASP molecular markers The following materials were selected: parent P1 was the high-generation hybrid line 'OY-42' of the Guangliang variety 'Black Rose', and parent P2 was the high-generation inbred line 'GP-54' of the Japanese Musashino variety 'Haryou'. The F1 offspring of these two parent lines and the F2 population obtained from F1 self-pollination were used. First, SNPs were converted into KASP molecular markers. After extracting the corresponding DNA, PCR was used to screen for heat-resistant gene markers in bok choy. A KASP molecular marker was developed, and it was found to be significantly correlated with heat resistance in bok choy. This marker can be used to identify the heat resistance of bok choy under high-temperature conditions. The molecular marker is located at locus 1909606 on chromosome 3 of the bok choy genome (referencing the non-heading Chinese cabbage reference genome database: https: / / www.tbirs.cn / NHCCDB / Genome.jsp). The 50 bp sequence before and after the molecular marker locus is as follows: AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG A CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA; or AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG T CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA.

[0034] The following method is used to obtain it: I. SNP Information Extraction: Based on the gene localization results in Example 2, SNP information closely linked to the heat resistance gene was extracted.

[0035] II. DNA Extraction Genomic DNA was extracted from the heat-resistant parent P1, the heat-sensitive parent P2, the F1 offspring of their cross, and the F2 extreme mixed population obtained by self-pollination of F1. Young leaves (approximately 1 cm) were taken from each plant. 2 After flash freezing with liquid nitrogen, the leaves were ground using a tissue homogenizer, and total DNA was extracted following the procedures provided by the Plant DNAzol kit manufactured by Hangzhou Laifeng Biotechnology Co., Ltd. DNA concentration and purity were determined using a NanoDrop micro-spectrophotometer.

[0036] III. PCR Amplification 1) Reaction system The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTTTATAGCTCATGGAGATCGTCGA-3' Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTTATAGCTCATGGAGATCGTCGT-3' Reverse primer Common: 5'-AAGAGATCACTATCACCACTGACT-3' The PCR reaction system consisted of: 5.0 μL of 20-50 ng / μL Chinese cabbage genomic DNA, 5.0 μL of KASP Master mix, and 0.14 μL of KASP Assay Mix (10 ng / μL F-FAM forward primer, 10 ng / μL F-HEX forward primer, and 10 ng / μL Common reverse primer, with a volume ratio of 2:2:5), for a total volume of 10.14 μL.

[0037] 2) Reaction Procedure 30 ℃, 1 minute (read fluorescence signal); 94 ℃, 15 minutes (pre-denaturation); 94 ℃, 20 seconds (denaturation); 61-55 ℃, 1 minute (annealing & extension; amplify 10 cycles using a touch-down program, decreasing the temperature by 0.6 ℃ per cycle); 94 ℃, 20 seconds (denaturation); 55 ℃, 60 seconds, amplify 35 cycles; 30 ℃, 1 minute (read fluorescence signal); after amplification, detect fluorescence signal and check genotyping results.

[0038] In this example, the PCR reaction was performed directly on the ABI Step One Real-Time PCR instrument. The PCR instrument is connected to the corresponding software to directly obtain the analysis results. The software automatically classifies the test samples into homozygous thermostable type (AA), homozygous thermosensitive type (TT), and heterozygous thermosensitive type (AT) according to different genotypes.

[0039] Two forward primers are each fitted with their own fluorescent adapters (of different colors), corresponding to F-FAM and F-HEX respectively. If the material being tested is homozygous, only one of the corresponding primers will be selected for amplification (for example, the thermostable parent P1 can only react with the forward primer F-FAM). Based on the difference in fluorescence, it can be distinguished whether the material being tested is homozygous thermostable or homozygous thermosensitive. If the material being tested is heterozygous, both primers will be used during amplification, and the fluorescence produced will be different from that of the homozygous material, thus achieving the distinction between heterozygous materials.

[0040] according to Figure 3 , 4 It can be seen that, using molecular markers, the genotypes AA and TT were detected in the genomes of the heat-resistant parent P1 and the heat-sensitive parent P2, respectively. The genotype AT was detected in the F1 offspring of their cross. The color differentiation of the genotypes was obvious in the extreme mixed pool of F2. This indicates that KASP molecular marker genotyping is reliable and can be used for genotype identification of both parents and their offspring.

[0041] Example 4: Validation of KASP molecular markers in natural populations of different Chinese cabbage genotypes Twelve core germplasm accessions of Chinese cabbage were selected from the laboratory, and corresponding DNA was extracted. Based on the molecular markers designed and developed above, the genotypes of the 12 core germplasm accessions under heat stress were detected. PCR amplification was performed on an ABI Step One real-time PCR instrument, and fluorescence signals were detected and genotyping was analyzed.

[0042] The following method is used to obtain it: I. DNA Extraction Genomic DNA was extracted from 12 core germplasm samples of Chinese cabbage in the laboratory. Young leaves (approximately 1 cm in diameter) were taken from each plant. 2 After flash freezing with liquid nitrogen, the leaves were ground using a tissue homogenizer, and total DNA was extracted following the procedures provided by the Plant DNAzol kit manufactured by Hangzhou Laifeng Biotechnology Co., Ltd. DNA concentration and purity were determined using a NanoDrop micro-spectrophotometer.

[0043] II. PCR Amplification 1) Reaction system The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTTTATAGCTCATGGAGATCGTCGA-3' Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTTATAGCTCATGGAGATCGTCGT-3' Reverse primer Common: 5'-AAGAGATCACTATCACCACTGACT-3'.

[0044] The PCR reaction system consisted of: 5.0 μL of 20-50 ng / μL Chinese cabbage genomic DNA, 5.0 μL of KASP Master mix, and 0.14 μL of KASP Assay Mix (10 ng / μL F-FAM forward primer, 10 ng / μL F-HEX forward primer, and 10 ng / μL Common reverse primer, with a volume ratio of 2:2:5), for a total volume of 10.14 μL.

[0045] 2) Reaction Procedure 30 ℃, 1 minute (read fluorescence signal); 94 ℃, 15 minutes (pre-denaturation); 94 ℃, 20 seconds (denaturation); 61-55 ℃, 1 minute (annealing & extension; amplify 10 cycles using a touch-down program, decreasing the temperature by 0.6 ℃ per cycle); 94 ℃, 20 seconds (denaturation); 55 ℃, 60 seconds, amplify 35 cycles; 30 ℃, 1 minute (read fluorescence signal); after amplification, detect fluorescence signal and check genotyping results.

[0046] according to Figure 5 It was found that: using the molecular markers to detect 12 core germplasm samples of Chinese cabbage preserved in our laboratory, two genotypes, AA and TT, were detected, with 7 samples showing the AA genotype and 5 samples showing the TT genotype. The 7 samples with the same genotype as the heat-resistant parent P1 were subjected to heat stress treatment at 37 ℃, and the 5 samples with the same genotype as the heat-sensitive parent P2 were subjected to heat stress treatment at 37 ℃, as described in Example 1.

[0047] Experimental results showed that 6 out of 7 germplasm materials with genotype AA exhibited heat tolerance, and 1 material exhibited heat sensitivity. All 5 germplasm materials with genotype TT were heat sensitive. The genotype-phenotype concordance rate was as high as 91.67% (see Table 1). This verifies the close linkage between the KASP molecular marker and heat tolerance in Chinese cabbage. Therefore, the correctness of this molecular marker can be proven.

[0048] Table 1: Phenotypic and Genotypic Statistics of 12 Backbone Germplasm Resources for Chinese Vegetable Breeding

[0049] Example 5: Using KASP molecular markers to conduct heat-assisted selection breeding of Chinese cabbage The heat-resistant parent P1 and the heat-sensitive parent P2 were crossed, and then the F1 generation was self-crossed to obtain the segregating population of the F2 offspring. KASP molecular markers were used for assisted selection. Individual plants with genotypes consistent with or simultaneously exhibiting the genotypes of both the heat-resistant parent P1 and the heat-sensitive parent P2 were selected from the F2 offspring for further breeding improvement.

[0050] Specifically as follows: I. DNA Extraction Same as Example 2.

[0051] II. PCR Amplification Same as Example 3.

[0052] III. Genotyping Same as Example 3.

[0053] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All modifications that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.

Claims

1. A KSAP molecular marker associated with heat tolerance trait in Brassica rapa, characterized in that: For identifying heat tolerance trait of Brassica chinensis, the molecular marker primer is selected from the following primer pairs, wherein: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTTTATAGCTCATGGAGATCGTCGA-3' Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTTATAGCTCATGGAGATCGTCGT-3' Reverse primer Common: 5'-AAGAGATCACTATCACCACTGACT-3'.

2. The KASP molecular marker of claim 1, wherein: the molecular marker site is located at the 1909606 locus of chromosome 3 of Brassica chinensis, and the 50 bp sequences before and after the molecular marker site are as follows: AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG A CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA; AAGGCCAAGAGATCACTATCACCACTGACTATGAAACTTTAGGAGACGAG T CGACGATCTCCATGAGCTATAAGAAGCTTCCCTTAGATGTTAAGCCCGGA.

3. The KASP molecular marker of claim 2, wherein: the KASP molecular marker genotype is A or T; the A genotype corresponds to the heat-tolerant phenotype; and the T genotype corresponds to the heat-sensitive phenotype.

4. Use of the KASP molecular marker of any one of claims 1-3 for identifying heat tolerance of Brassica chinensis at the four-leaf one-heart stage under high temperature conditions.

5. The use of claim 4, wherein: the KASP molecular marker is used for rapid identification of heat tolerance of Brassica chinensis germplasm and molecular-assisted selection breeding of hybrid offspring.

6. The use of claim 4, wherein: when screening Brassica chinensis germplasm with heat tolerance traits, germplasm with the same genotype as the heat tolerance trait is selected for breeding; when screening hybrid offspring of germplasm with heat tolerance traits and heat-sensitive traits, single plants with the same genotype as the heat tolerance trait are selected for breeding.

Images