SNP (Single Nucleotide Polymorphism) molecular marker co-segregated with melon dwarf plant type, KASP molecular marker and application of SNP molecular marker and KASP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker co-segregated with a dwarf melon plant type, a KASP molecular marker and application of the SNP molecular marker and the KASP molecular marker, and belongs to the technical field of molecular genetics. The SNP molecular marker is located at the 1145461 site nucleotide of a No.7 chromosome of a muskmelon genome, namely the 51st site of a nucleotide sequence as shown in SEQ ID No.1, and the nucleotide polymorphism is C or G. When the genotype of the SNP molecular marker is homozygous GG, the muskmelon shows a dwarf plant type; when the genotype of the SNP molecular marker is homozygous CC or heterozygous CG, the plant height of the muskmelon is normal. The KASP molecular marker is designed according to the SNP molecular marker, and comprises three primers, namely K1145461-F, K1145461C-R and K1145461G-R, gene typing of the SNP molecular marker can be quickly realized through a PCR (Polymerase Chain Reaction) reaction, plant type dwarfing variation is assisted to be introduced into a melon with normal plant height, and genetic improvement of the plant type of the melon is promoted.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to an SNP molecular marker and a KASP molecular marker that co-segregate with dwarfing melon plant types and their applications. Background Technology

[0002] melon( Cucumis melo Muskmelon, an annual fruit crop belonging to the Cucurbitaceae family, is highly favored by consumers for its unique taste and flavor. my country has consistently ranked first in the world in terms of planting area and yield, but its economic benefits lag far behind those of countries like Japan, Spain, and the Netherlands. This is primarily due to the lagging research in muskmelon variety improvement and cultivation techniques. In muskmelon cultivation, especially in protected trellis cultivation, dwarf plants reduce manual labor such as vine training and lowering, thus reducing management costs. Furthermore, dwarf plants have a compact plant type, lower density planting effect, and are more likely to achieve high yields through dense planting. Therefore, the screening and efficient identification technology for dwarf plant type variations in muskmelons has significant economic value.

[0003] Currently, research on the regulation of melon plant height is still quite weak. Chinese patent application CN119842971A discloses a KASP molecular marker, primer pairs, kit, and its application for identifying dwarfing traits in melons. However, the KASP marker in that patent application is designed based on a SNP variation at position 1069930 on chromosome 7 of melon, which is different from the SNP molecular marker used in this invention, resulting in different degrees of dwarfing in the melons. Previous researchers, using the Kasaba melon variety M406 as research material, found... CmERECTA It has a positive regulatory function on melon plant height development (Yang et al., 2020, Melon short internode ( Cmsi This gene encodes an ERECTA-like receptor kinase regulating stem elongation through auxin signaling; Ma Jian et al., 2020, Melon Short Vine Gene Cmdm1 (Fine localization and candidate gene analysis) to prove Cmerecta Gene mutations hold significant potential for improving the genetic height of melon plants. Therefore, identifying new melon varieties under different genetic backgrounds is crucial. Cmerecta Genetic variation and the development of efficient and convenient molecular markers for dwarfing melon plant types can help promote the genetic improvement of melon plant types and increase the overall benefits of melon cultivation. Summary of the Invention

[0004] In view of this, the main objective of this invention is to provide an SNP molecular marker and a KASP molecular marker that co-segregate with the dwarfing plant type of melon, and their applications, to promote the genetic improvement of the dwarfing plant type of melon. Furthermore, the SNP molecular marker was identified in a rough-skinned melon variety. Compared to dwarfing variations found in other melon varieties, using the SNP molecular marker to improve the plant type of the rough-skinned melon variety can reduce the occurrence of linkage spurs.

[0005] To achieve the above objectives, the first aspect of the present invention provides an SNP molecular marker co-segregating with the dwarfing plant type of melon, located at nucleotide 1145461 on chromosome 7 of the reference melon genome (Melon DHL92 genome v4). Specifically, the SNP molecular marker is located at position 51 of the nucleotide sequence shown in SEQ ID No. 1, and the nucleotide polymorphism of the SNP molecular marker is C or G, represented by the degenerate nucleotide S of C and G in the nucleotide sequence shown in SEQ ID No. 1.

[0006] The correspondence between the SNP molecular marker and the height of melon plants is as follows: when the genotype of the SNP molecular marker is homozygous GG, the melon plants exhibit a dwarf plant type, and their plant height is significantly smaller than that of melon plants with the genotype of the SNP molecular marker in the genome being heterozygous CG or homozygous CC; there is no significant difference between the height of melon plants with the genotype of the SNP molecular marker in the genome being heterozygous CG and the height of melon plants with the genotype of the SNP molecular marker in the genome being homozygous CC, that is, when the genotype of the SNP molecular marker in the melon genome is homozygous CC or heterozygous CG, the height of the melon plants is normal.

[0007] The second aspect of this invention provides a KASP molecular marker co-isolated with the dwarfing plant type of melon, which is designed based on the above-mentioned SNP molecular marker and includes three primers: primer K1145461-F with nucleotide sequence as shown in SEQ ID No. 2, primer K1145461C-R with nucleotide sequence as shown in SEQ ID No. 3, and primer K1145461G-R with nucleotide sequence as shown in SEQ ID No. 4.

[0008] Using primers K1145461-F, K1145461C-R, and K1145461G-R as PCR primers, when the DNA template comes from a melon plant with a homozygous CC genotype of the SNP molecular marker in its genome, the DNA sequence shown in SEQ ID No. 5 can be amplified. The DNA sequence shown in SEQ ID No. 5 can bind to the fluorescent group FAM. Using primers K1145461-F, K1145461C-R, and K1145461G-R as PCR primers, when the DNA template comes from a melon plant with a homozygous GG genotype of the SNP molecular marker in its genome, the DNA sequence shown in SEQ ID No. 6 can be amplified. The DNA sequence shown in No. 6 can bind to the fluorescent group HEX; when K1145461-F, K1145461C-R and K1145461G-R are used together as PCR primers, the DNA sequences shown in SEQ ID No. 5 and SEQ ID No. 6 can be amplified simultaneously when the DNA template comes from a melon plant with a heterozygous CG genotype of the SNP molecular marker in the genome.

[0009] A third aspect of this invention provides the application of the aforementioned KASP molecular marker in the preparation of products for identifying or assisting in the identification of the aforementioned SNP molecular markers or melon plant height. Preferably, the product comprises a reagent, a kit, or a chip.

[0010] A fourth aspect of this invention provides the application of the aforementioned SNP or KASP molecular markers in melon breeding. Preferably, the application of the aforementioned SNP or KASP molecular markers in the selection of dwarf melon plant types.

[0011] The fifth aspect of this invention provides a method for identifying the above-mentioned SNP molecular markers, which mainly includes the following steps: Genomic DNA was extracted from the melons to be tested and used as a template. Primers K1145461-F, K1145461C-R, and K1145461G-R were used together as PCR primers for PCR reaction.

[0012] Preferably, the PCR reaction uses the following reaction system: 5 μL KASP mix, 0.05 μL each of primers K1145461C-R and K1145461G-R at a concentration of 12 μM, 0.05 μL primer K1145461-F at a concentration of 30 μM, 1 μL DNA template, and 4 μL ddH2O.

[0013] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s; 61℃-55℃ annealing extension for 40 s; annealing extension for a total of 10 cycles, with the temperature decreasing by 0.6℃ in each cycle; 94℃ denaturation for 20 s; 55℃ annealing extension for 60 s, for 30 cycles.

[0014] After PCR amplification, the genotype of the tested melon samples was determined based on the fluorescence detection results, using the following criteria: When the amplification product mainly emits FAM fluorescence, it indicates that the amplified DNA sequence is as shown in SEQ ID No. 5, and the genotype of the SNP molecular marker in the genome of the tested sample is homozygous CC; when the amplification product mainly emits HEX fluorescence, it indicates that the amplified DNA sequence is as shown in SEQ ID No. 6, and the genotype of the SNP molecular marker in the genome of the tested sample is homozygous GG; when the FAM fluorescence and HEX fluorescence intensities of the amplification product are comparable, it indicates that the amplified DNA contains both the sequences shown in SEQ ID No. 5 and SEQ ID No. 6, and the genotype of the SNP molecular marker in the genome of the tested sample is heterozygous CG.

[0015] The sixth aspect of this invention provides a method for breeding dwarf melon plants, which mainly includes the following steps: Using melon materials with homozygous GG or heterozygous CG genotypes for the aforementioned SNP molecular markers in their genome, the genotypes of the SNPs in the genome of normal-height melons are modified from homozygous CC to homozygous GG through hybridization or self-pollination. This directs the introduction of dwarfing traits into the target melon background, achieving genetic improvement of melon plant type and enabling the breeding of dwarf varieties.

[0016] Experiments have shown that the SNP molecular markers co-segregate with the dwarfing plant type trait in melons and can be used for genetic improvement of dwarfing plant types in melons. The plant height of melons with the homozygous GG genotype of the SNP molecular marker is significantly lower than that of heterozygous CG and homozygous CC melons; the plant height of melons with the heterozygous CG genotype is not significantly different from that of homozygous CC melons. This invention further converts the above SNP molecular markers into KASP molecular markers, eliminating the need for complex steps such as enzyme digestion, electrophoresis, and sequencing. Genotyping of the target melon plant can be achieved with only a single PCR amplification, enabling simple and efficient application in the breeding of dwarf melon varieties. Furthermore, compared to dwarfing variations identified in other melon varieties, using the SNP markers provided by this invention to improve the plant type of rough-skinned melon varieties helps reduce the occurrence of linkage carryover. Attached Figure Description

[0017] Figure 1The image shows the phenotypic diagram of the melon parent material in Example 1 of this invention. In each image, the scale bar is 10 cm, and all materials were planted for 45 days.

[0018] Figure 2 For the mixed-pool sequencing of the dwarfing variant in Example 1 of this invention and CmERECTA Sequence analysis diagrams are shown. Figure A shows the ΔSNP-index analysis of F2 population mixed sequencing of HMN-S and JSG. Each point in the diagram represents a SNP, the horizontal axis represents the position of the SNP, and the vertical axis represents the ΔSNP-index of the SNP. The black line is the nucleoid line, the orange line is the threshold line, and the arrow indicates the initial localization interval. Figure B shows the sequence analysis of HMN, JSG, HMN-S, and... Cmerecta Sequencing analysis of -NIL at 1145461 bp and 1144671 bp on chromosome 7; Figure C shows the SNP variants corresponding to 1145461 bp and 1144671 bp on chromosome 7 of the genome. CmERECTA Exon location and variant name.

[0019] Figure 3 Figure 1 shows the genotyping results of the dwarfing melon parent HMN-S, the long-vine parent JSG, and the F2 population in Example 1 of this invention. Figure A shows the KASP genotyping results in a 96-well plate, with NTC as the negative control (using ddH2O instead of DNA template). Figure B shows the KASP genotyping results on the XY axis, where blue clusters represent homozygous G alleles, green clusters represent G / C heterozygous samples, and orange clusters represent homozygous C alleles. The black scatter dots represent the negative control, and no fluorescence signal was detected in the negative control, indicating that there was no nonspecific amplification in the experiment.

[0020] Figure 4 The figures show the plant height phenotype of the melon material in Example 2 of this invention. The scale bar in each figure is 10 cm. All materials were cultivated in flower pots for 40 days after seed germination under the same conditions.

[0021] In the sequence list: SEQ ID No. 1 is a DNA sequence containing an SNP molecular marker; SEQ ID No. 2 is the DNA sequence shown by primer K1145461-F; SEQ ID No. 3 is the DNA sequence shown by primer K1145461C-R; SEQ ID No. 4 is the DNA sequence shown by primer K1145461G-R; SEQ ID No. 5 is the DNA sequence obtained by PCR amplification of homozygous CC genotype; SEQ ID No. 6 is the DNA sequence obtained by PCR amplification of the homozygous GG genotype. Detailed Implementation

[0022] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0023] Unless otherwise specified, all terms used in this invention are commonly used in the relevant field. The experimental methods used in the following embodiments are conventional experimental methods unless otherwise specified. All materials and reagents used in the following embodiments can be purchased commercially unless otherwise specified. The source, trade name, and components of any reagents used are indicated upon their first appearance.

[0024] The rough-skinned long-vine melon materials Harmoni (HMN, No.: ETG890) and Gashi melon (JSG, No.: ETG1086) described in the following examples were provided by the National Watermelon and Melon Germplasm Bank (Zhengzhou). The short-vine melon material HMN-S is a dwarfed natural variant material isolated by the applicant from the long-vine melon material HMN. These biological materials are available to the public from the applicant and are only used to repeat the relevant experiments of this invention and shall not be used for other purposes.

[0025] The long-vine melon material TopMark and the short-vine melon material in the following examples Cmerecta -NIL was provided by Professor Yang Luming's research group at the College of Horticulture, Henan Agricultural University, and is recorded in "Liu Gangyun et al., 2024, Molecular marker-assisted construction of melon dwarfing genes". Cmerecta The article "Near-isogenic lineage".

[0026] Example 1: Identification of SNP sites cosegregating with dwarfing plant type traits in melon and development of KASP molecular markers

[0027] Please see Figure 1In this embodiment, a naturally mutated dwarfing short-vine melon material, HMN-S, was isolated from the rough-skinned, long-vine melon variety, Harmony (HMN). 45 days after spring transplanting, the normal HMN material reached a plant height of 157.67 cm, while HMN-S only reached 49.33 cm, just 31% of HMN's height. Furthermore, this dwarfing trait was stably inherited across multiple generations. In this embodiment, HMN-S was hybridized with HMN and the long-vine material, Gashi melon (JSG), to obtain F1 plants. The F1 plants were then self-crossed and backcrossed with their parents to generate BC1 and F2 segregating populations. Genetic analysis was performed, as shown in Table 1. Table 1 shows that in both F2 segregating populations, the ratio of long-vine plants to dwarfing plants was close to 3:1, and in both backcross populations of F1 and HMN-S, the ratio of long-vine plants to dwarfing plants was close to 1:1. These results indicate that the dwarfing trait of HMN-S is regulated by a single-gene recessive gene.

[0028] Table 1. Phenotypic identification and genetic analysis of six generations of the dwarfing melon material HMN-S. Material Total number of people Number of long vines dwarfing plant number Expected separation ratio χ² value p-value HMN 15 15 0 - HMN-S 15 0 15 - <![CDATA[F1(HMN × HMN-S)]]> 15 15 0 - <![CDATA[F2(HMN × HMN-S)]]> 209 150 59 3:1 1.16 0.28 <![CDATA[BC1(F1× HMN)]]> 50 50 0 1:0 <![CDATA[BC1(F1× HMN-S)]]> 50 24 26 1:1 0.08 0.78 JSG 15 15 0 - <![CDATA[F1(JSG × HMN-S)]]> 15 15 0 - <![CDATA[F2(JSG × HMN-S)]]> 210 161 49 3:1 0.31 0.58 <![CDATA[BC1(F1× JSG)]]> 50 50 0 1:0 <![CDATA[BC1(F1× HMN-S)]]> 50 27 23 1:1 0.32 0.57 Step 2: Pooled sequencing of dwarfing variants and CmERECTA Gene sequence analysis To clone the target gene in the dwarfing material HMN-S, this embodiment utilized the F2 segregating populations of HMN-S and JSG, selecting 30 long-vine type plants and 30 dwarf type plants to construct DNA pools, respectively. Both HMN-S and JSG parents were added, and resequencing analysis was performed using the Illumina sequencing platform by Biomarker. The ΔSNP-index values ​​between pools were calculated using the resequencing data, and candidate intervals containing the target variant were analyzed. The results are as follows: Figure 2 As shown. Among them, Figure 2 A indicates that only chromosome 7 has a significant peak exceeding the threshold across the entire genome. This peak is located in the interval between 130,000 bp and 1,990,000 bp on chromosome 7, with a length of 1.86 Mb. The ΔSNP-index values ​​of the other chromosomes are all below the threshold.

[0029] According to the annotation of the Melon reference genome (Melon DHL92 genome v4), there are a total of 259 functional genes within the above candidate regions, including key genes for melon plant height development previously reported. CmERECTA (MELO3C016916). Therefore, this embodiment first used Sanger sequencing to analyze the sequence differences of this gene among HMN-S, HMN, and JSG. As a control, it was also tested... CmERECTA Mutant materials Cmerecta -NIL CmERECTA sequence. Cmerecta -NIL has a T-to-G mutation at position 1144671 on chromosome 7. This mutation is located at... CmERECTA The 113th nucleotide of exon 25 of the gene. We will use melon material. Cmerecta -NIL CmERECTA Gene mutations are named Cmerecta- 1. Sequencing results as follows Figure 2 As shown in B, similar to the long-vine materials HMN and JSG, HMN-S does not exist. Cmerecta- 1. Mutation. However, HMN-S detected a C-to-G mutation at 1145461 bp on chromosome 7. This mutation is located at... CmERECTA At nucleotide 49 of exon 23 of a gene, the codon TAC encoding tyrosine is changed to the stop codon TAG, prematurely terminating protein translation. For example... Figure 2 As shown in C, this embodiment will use HMN-S CmERECTA Gene variation forms are named Cmerecta- 2. The above results suggest that the dwarfing phenotype of HMN-S may be... Cmerecta- 2. Caused by variation. Furthermore, at position 1145461 bp on chromosome 7 of melon, i.e., position 51 of the nucleotide sequence shown in SEQ ID No. 1, there is a SNP molecular marker with nucleotide polymorphism of C or G, which is very likely to co-segregate with the dwarf melon plant type.

[0030] Step 3: Development of KASP molecular markers and validation in the F2 population This embodiment further utilizes the F2 segregating populations of HMN-S and JSG to examine the linkage relationship between the above-mentioned SNP molecular markers and melon plant type. To improve genotyping efficiency, the KASP molecular marker was developed based on the above-mentioned SNP molecular markers. This molecular marker contains three primers: K1145461-F, K1145461C-R, and K1145461G-R. The DNA sequence of primer K1145461-F is TCCTTGGAAATATTGCTCTCTGTGGAT (SEQ ID No. 2); the DNA sequence of primer K1145461C-R is GAAGGTGACCAAGTTCATGCTGTCGTATGAGCTTCATGACAGGGG (SEQ ID No. 3); and the DNA sequence of primer K1145461G- is GAAGGTCGGAGTCAACGGATTGTCGTATGAGCTTCATGACAGGGCGTCTTGGACACCAAGCACTTCGT (SEQ ID No. 4). Subsequently, this application conducted plant height phenotypic statistics on 601 individual plants in the F2 population, extracted leaf DNA using the CTAB method, and used the aforementioned primers to perform genotyping on each individual plant and the parents HMN-S and JSG.

[0031] The KASP reaction was performed in a reaction plate. The reaction mixture consisted of 5 μL of KASP mix, 0.05 μL each of primers K1145461C-R and K1145461G-R (12 μM), 0.05 μL of primer K1145461-F (30 μM), 1 μL of DNA template, and 4 μL of ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61℃-55℃ for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 30 cycles. After PCR amplification, the genotype of the tested melon samples was determined based on the fluorescence detection results. The determination criteria were as follows: when the amplification product mainly emitted FAM fluorescence, it indicated that the amplified DNA sequence was as shown in SEQ ID No. 5, and the genotype of the above-mentioned SNP molecular marker in the genome of the tested sample was homozygous CC; when the amplification product mainly emitted HEX fluorescence, it indicated that the amplified DNA sequence was as shown in SEQ ID No. 6, and the genotype of the above-mentioned SNP molecular marker in the genome of the tested sample was homozygous GG; when the FAM fluorescence and HEX fluorescence intensities of the amplification product were comparable, it indicated that the amplified DNA contained the bands shown in both SEQ ID No. 5 and SEQ ID No. 6, and the genotype of the above-mentioned SNP molecular marker in the genome of the tested sample was heterozygous CG.

[0032] Through testing, this embodiment classified the genotypes of individual plants in the F2 population into three different categories. First, one genotype was located near the X-axis, similar to the parental JSG genotype, and was classified as the homozygous long-vine genotype CC. Second, another genotype was located near the Y-axis, similar to the parental HMN-S genotype, and was classified as the homozygous dwarf genotype GG. Finally, a third genotype was located near both the X-axis and Y-axis symmetry axes and was classified as the heterozygous long-vine genotype CG. This classification result... Figure 3 The results are clearly demonstrated in Table 2. Genotyping and phenotypic analysis of individual plants in the F2 population using the KASP molecular marker revealed that all GG genotype plants exhibited dwarfism, while all CC or CG genotype plants displayed long vines. The correspondence between genotype and phenotype was 100%, as shown in Table 2. This confirms the co-segregation of the SNP molecular marker and the dwarfing phenotype, and demonstrates that the KASP molecular marker can efficiently genotype the SNP molecular marker, making it a highly efficient and convenient molecular marker for identifying dwarfing traits in melons.

[0033] Table 2. Genotypic and phenotypic statistics of individual plants in the F2 populations of HMN-S and JSG. serial number genotype Phenotype serial number genotype Phenotype serial number genotype Phenotype JSG CC Long vines HMN-S GG dwarfing Sam-1 GG dwarfing Sam-2 GG dwarfing Sam-3 CG Long vines Sam-4 CG Long vines Sam-5 GG dwarfing Sam-6 CG Long vines Sam-7 CC Long vines Sam-8 GG dwarfing Sam-9 CG Long vines Sam-10 CC Long vines Sam-11 GG dwarfing Sam-12 GG dwarfing Sam-13 GG dwarfing Sam-14 GG dwarfing Sam-15 CG Long vines Sam-16 GG dwarfing Sam-17 GG dwarfing Sam-18 CG Long vines Sam-19 CG Long vines Sam-20 CG Long vines Sam-21 CC Long vines Sam-22 CG Long vines Sam-23 GG dwarfing Sam-24 GG dwarfing Sam-25 CC Long vines Sam-26 CG Long vines Sam-27 CC Long vines Sam-28 CG Long vines Sam-29 CC Long vines Sam-30 CC Long vines Sam-31 GG dwarfing Sam-32 GG dwarfing Sam-33 CC Long vines Sam-34 GG dwarfing Sam-35 GG dwarfing Sam-36 CG Long vines Sam-37 CC Long vines Sam-38 CG Long vines Sam-39 GG dwarfing Sam-40 CG Long vines Sam-41 CG Long vines Sam-42 CC Long vines Sam-43 GG dwarfing Sam-44 CG Long vines Sam-45 GG dwarfing Sam-46 CC Long vines Sam-47 CG Long vines Sam-48 CC Long vines Sam-49 GG dwarfing Sam-50 CG Long vines Sam-51 CC Long vines Sam-52 GG dwarfing Sam-53 CG Long vines Sam-54 GG dwarfing Sam-55 GG dwarfing Sam-56 CG Long vines Sam-57 CG Long vines Sam-58 CC Long vines Sam-59 CG Long vines Sam-60 CC Long vines Sam-61 GG dwarfing Sam-62 GG dwarfing Sam-63 GG dwarfing Sam-64 CG Long vines Sam-65 CC Long vines Sam-66 CG Long vines Sam-67 CG Long vines Sam-68 CG Long vines Sam-69 CG Long vines Sam-70 GG dwarfing Sam-71 CG Long vines Sam-72 CC Long vines Sam-73 CG Long vines Sam-74 CG Long vines Sam-75 GG dwarfing Sam-76 CG Long vines Sam-77 CG Long vines Sam-78 CC Long vines Sam-79 CC Long vines Sam-80 CG Long vines Sam-81 GG dwarfing Sam-82 GG dwarfing Sam-83 CC Long vines Sam-84 CG Long vines Sam-85 CC Long vines Sam-86 CC Long vines Sam-87 CG Long vines Sam-88 GG dwarfing Sam-89 CC Long vines Sam-90 CG Long vines Sam-91 GG dwarfing Sam-92 GG dwarfing Sam-93 CC Long vines Sam-94 CG Long vines Sam-95 CC Long vines Sam-96 CC Long vines Sam-97 CG Long vines Sam-98 CC Long vines Sam-99 GG dwarfing Sam-100 CC Long vines Sam-101 CG Long vines Sam-102 CC Long vines Sam-103 CC Long vines Sam-104 CG Long vines Sam-105 GG dwarfing Sam-106 GG dwarfing Sam-107 CC Long vines Sam-108 CG Long vines Sam-109 CC Long vines Sam-110 CG Long vines Sam-111 CC Long vines Sam-112 CC Long vines Sam-113 GG dwarfing Sam-114 GG dwarfing Sam-115 CC Long vines Sam-116 GG dwarfing Sam-117 GG dwarfing Sam-118 CG Long vines Sam-119 CC Long vines Sam-120 CG Long vines Sam-121 GG dwarfing Sam-122 CG Long vines Sam-123 CG Long vines Sam-124 CC Long vines Sam-125 GG dwarfing Sam-126 CG Long vines Sam-127 GG dwarfing Sam-128 CC Long vines Sam-129 CG Long vines Sam-130 CG Long vines Sam-131 CC Long vines Sam-132 CG Long vines Sam-133 CC Long vines Sam-134 GG dwarfing Sam-135 CG Long vines Sam-136 GG dwarfing Sam-137 CG Long vines Sam-138 CG Long vines Sam-139 CG Long vines Sam-140 CC Long vines Sam-141 CG Long vines Sam-142 CC Long vines Sam-143 GG dwarfing Sam-144 GG dwarfing Sam-145 GG dwarfing Sam-146 GG dwarfing Sam-147 CC Long vines Sam-148 CG Long vines Sam-149 CG Long vines Sam-150 CG Long vines Sam-151 CG Long vines Sam-152 CG Long vines Sam-153 CG Long vines Sam-154 CC Long vines Sam-155 CG Long vines Sam-156 CG Long vines Sam-157 GG dwarfing Sam-158 CG Long vines Sam-159 CG Long vines Sam-160 CG Long vines Sam-161 CG Long vines Sam-162 CG Long vines Sam-163 CC Long vines Sam-164 CC Long vines Sam-165 GG dwarfing Sam-166 CC Long vines Sam-167 CC Long vines Sam-168 CG Long vines Sam-169 CG Long vines Sam-170 CC Long vines Sam-171 CG Long vines Sam-172 GG dwarfing Sam-173 CC Long vines Sam-174 CG Long vines Sam-175 CG Long vines Sam-176 CC Long vines Sam-177 GG dwarfing Sam-178 CG Long vines Sam-179 CC Long vines Sam-180 GG dwarfing Sam-181 CC Long vines Sam-182 CG Long vines Sam-183 CC Long vines Sam-184 GG dwarfing Sam-185 CG Long vines Sam-186 GG dwarfing Sam-187 CC Long vines Sam-188 GG dwarfing Sam-189 CG Long vines Sam-190 GG dwarfing Sam-191 GG dwarfing Sam-192 CG Long vines Sam-193 CC Long vines Sam-194 GG dwarfing Sam-195 CG Long vines Sam-196 GG dwarfing Sam-197 CG Long vines Sam-198 GG dwarfing Sam-199 CC Long vines Sam-200 GG dwarfing Sam-201 GG dwarfing Sam-202 GG dwarfing Sam-203 CG Long vines Sam-204 CG Long vines Sam-205 CC Long vines Sam-206 GG dwarfing Sam-207 GG dwarfing Sam-208 CC Long vines Sam-209 GG dwarfing Sam-210 GG dwarfing Sam-211 CC Long vines Sam-212 CG Long vines Sam-213 GG dwarfing Sam-214 GG dwarfing Sam-215 CG Long vines Sam-216 CC Long vines Sam-217 GG dwarfing Sam-218 CG Long vines Sam-219 GG dwarfing Sam-220 CG Long vines Sam-221 GG dwarfing Sam-222 CC Long vines Sam-223 GG dwarfing Sam-224 GG dwarfing Sam-225 GG dwarfing Sam-226 CG Long vines Sam-227 CC Long vines Sam-228 GG dwarfing Sam-229 GG dwarfing Sam-230 GG dwarfing Sam-231 CC Long vines Sam-232 GG dwarfing Sam-233 GG dwarfing Sam-234 CG Long vines Sam-235 CG Long vines Sam-236 CC Long vines Sam-237 GG dwarfing Sam-238 CC Long vines Sam-239 GG dwarfing Sam-240 CG Long vines Sam-241 CC Long vines Sam-242 GG dwarfing Sam-243 GG dwarfing Sam-244 GG dwarfing Sam-245 CG Long vines Sam-246 GG dwarfing Sam-247 CG Long vines Sam-248 GG dwarfing Sam-249 CC Long vines Sam-250 GG dwarfing Sam-251 GG dwarfing Sam-252 GG dwarfing Sam-253 CC Long vines Sam-254 GG dwarfing Sam-255 GG dwarfing Sam-256 CG Long vines Sam-257 GG dwarfing Sam-258 CG Long vines Sam-259 CG Long vines Sam-260 GG dwarfing Sam-261 CC Long vines Sam-262 GG dwarfing Sam-263 GG dwarfing Sam-264 CG Long vines Sam-265 GG dwarfing Sam-266 CG Long vines Sam-267 CC Long vines Sam-268 GG dwarfing Sam-269 CG Long vines Sam-270 CC Long vines Sam-271 GG dwarfing Sam-272 GG dwarfing Sam-273 CC Long vines Sam-274 CG Long vines Sam-275 CG Long vines Sam-276 CC Long vines Sam-277 CG Long vines Sam-278 CC Long vines Sam-279 CG Long vines Sam-280 CC Long vines Sam-281 GG dwarfing Sam-282 CC Long vines Sam-283 CC Long vines Sam-284 CG Long vines Sam-285 GG dwarfing Sam-286 GG dwarfing Sam-287 CC Long vines Sam-288 CG Long vines Sam-289 CC Long vines Sam-290 CG Long vines Sam-291 CC Long vines Sam-292 CC Long vines Sam-293 GG dwarfing Sam-294 GG dwarfing Sam-295 CC Long vines Sam-296 GG dwarfing Sam-297 GG dwarfing Sam-298 CG Long vines Sam-299 CC Long vines Sam-300 CG Long vines Sam-301 GG dwarfing Sam-302 CG Long vines Sam-303 CG Long vines Sam-304 CC Long vines Sam-305 CC Long vines Sam-306 CG Long vines Sam-307 CG Long vines Sam-308 CC Long vines Sam-309 CC Long vines Sam-310 CC Long vines Sam-311 GG dwarfing Sam-312 GG dwarfing Sam-313 GG dwarfing Sam-314 CC Long vines Sam-315 GG dwarfing Sam-316 GG dwarfing Sam-317 GG dwarfing Sam-318 CG Long vines Sam-319 CG Long vines Sam-320 CC Long vines Sam-321 CG Long vines Sam-322 CC Long vines Sam-323 CC Long vines Sam-324 CG Long vines Sam-325 CG Long vines Sam-326 CC Long vines Sam-327 GG dwarfing Sam-328 GG dwarfing Sam-329 CG Long vines Sam-330 CG Long vines Sam-331 CG Long vines Sam-332 CG Long vines Sam-333 CG Long vines Sam-334 CC Long vines Sam-335 GG dwarfing Sam-336 GG dwarfing Sam-337 CG Long vines Sam-338 CG Long vines Sam-339 GG dwarfing Sam-340 CG Long vines Sam-341 CG Long vines Sam-342 CG Long vines Sam-343 CG Long vines Sam-344 CC Long vines Sam-345 GG dwarfing Sam-346 CC Long vines Sam-347 CC Long vines Sam-348 GG dwarfing Sam-349 CG Long vines Sam-350 GG dwarfing Sam-351 CC Long vines Sam-352 GG dwarfing Sam-353 CC Long vines Sam-354 CG Long vines Sam-355 CG Long vines Sam-356 CC Long vines Sam-357 CG Long vines Sam-358 CC Long vines Sam-359 CC Long vines Sam-360 GG dwarfing Sam-361 GG dwarfing Sam-362 CG Long vines Sam-363 CG Long vines Sam-364 GG dwarfing Sam-365 CG Long vines Sam-366 CC Long vines Sam-367 GG dwarfing Sam-368 CG Long vines Sam-369 CC Long vines Sam-370 GG dwarfing Sam-371 CG Long vines Sam-372 GG dwarfing Sam-373 GG dwarfing Sam-374 CG Long vines Sam-375 CG Long vines Sam-376 CC Long vines Sam-377 CG Long vines Sam-378 CC Long vines Sam-379 GG dwarfing Sam-380 GG dwarfing Sam-381 GG dwarfing Sam-382 CG Long vines Sam-383 CC Long vines Sam-384 CG Long vines Sam-385 CC Long vines Sam-386 CC Long vines Sam-387 CG Long vines Sam-388 GG dwarfing Sam-389 CC Long vines Sam-390 CG Long vines Sam-391 GG dwarfing Sam-392 GG dwarfing Sam-393 CC Long vines Sam-394 CG Long vines Sam-395 CC Long vines Sam-396 CC Long vines Sam-397 CG Long vines Sam-398 CC Long vines Sam-399 GG dwarfing Sam-400 CC Long vines Sam-401 CG Long vines Sam-402 CC Long vines Sam-403 CC Long vines Sam-404 CG Long vines Sam-405 GG dwarfing Sam-406 GG dwarfing Sam-407 CC Long vines Sam-408 CG Long vines Sam-409 CC Long vines Sam-410 CG Long vines Sam-411 CC Long vines Sam-412 CC Long vines Sam-413 GG dwarfing Sam-414 GG dwarfing Sam-415 CC Long vines Sam-416 GG dwarfing Sam-417 GG dwarfing Sam-418 CG Long vines Sam-419 CC Long vines Sam-420 CG Long vines Sam-421 GG dwarfing Sam-422 CG Long vines Sam-423 CG Long vines Sam-424 CC Long vines Sam-425 GG dwarfing Sam-426 CG Long vines Sam-427 GG dwarfing Sam-428 CC Long vines Sam-429 CG Long vines Sam-430 CG Long vines Sam-431 CC Long vines Sam-432 CG Long vines Sam-433 CC Long vines Sam-434 GG dwarfing Sam-435 CG Long vines Sam-436 GG dwarfing Sam-437 CG Long vines Sam-438 CG Long vines Sam-439 CG Long vines Sam-440 CC Long vines Sam-441 CG Long vines Sam-442 CC Long vines Sam-443 GG dwarfing Sam-444 GG dwarfing Sam-445 GG dwarfing Sam-446 GG dwarfing Sam-447 CC Long vines Sam-448 CG Long vines Sam-449 CG Long vines Sam-450 CG Long vines Sam-451 CG Long vines Sam-452 CG Long vines Sam-453 CG Long vines Sam-454 CC Long vines Sam-455 CG Long vines Sam-456 CG Long vines Sam-457 GG dwarfing Sam-458 CG Long vines Sam-459 CG Long vines Sam-460 CG Long vines Sam-461 CG Long vines Sam-462 CG Long vines Sam-463 CC Long vines Sam-464 CC Long vines Sam-465 GG dwarfing Sam-466 CC Long vines Sam-467 CC Long vines Sam-468 CG Long vines Sam-469 CG Long vines Sam-470 CC Long vines Sam-471 CG Long vines Sam-472 GG dwarfing Sam-473 CC Long vines Sam-474 CG Long vines Sam-475 CG Long vines Sam-476 CC Long vines Sam-477 GG dwarfing Sam-478 CG Long vines Sam-479 CC Long vines Sam-480 GG dwarfing Sam-481 CC Long vines Sam-482 CG Long vines Sam-483 CC Long vines Sam-484 GG dwarfing Sam-485 CG Long vines Sam-486 GG dwarfing Sam-487 CC Long vines Sam-488 GG dwarfing Sam-489 CG Long vines Sam-490 GG dwarfing Sam-491 GG dwarfing Sam-492 CG Long vines Sam-493 CC Long vines Sam-494 GG dwarfing Sam-495 CG Long vines Sam-496 GG dwarfing Sam-497 CG Long vines Sam-498 GG dwarfing Sam-499 CC Long vines Sam-500 GG dwarfing Sam-501 GG dwarfing Sam-502 GG dwarfing Sam-503 CG Long vines Sam-504 CG Long vines Sam-505 CC Long vines Sam-506 GG dwarfing Sam-507 GG dwarfing Sam-508 CC Long vines Sam-509 GG dwarfing Sam-510 GG dwarfing Sam-511 C:C Long vines Sam-512 CG Long vines Sam-513 GG dwarfing Sam-514 GG dwarfing Sam-515 CG Long vines Sam-516 CC Long vines Sam-517 GG dwarfing Sam-518 CG Long vines Sam-519 GG dwarfing Sam-520 CG Long vines Sam-521 GG dwarfing Sam-522 CC Long vines Sam-523 GG dwarfing Sam-524 GG dwarfing Sam-525 GG dwarfing Sam-526 CG Long vines Sam-527 CC Long vines Sam-528 GG dwarfing Sam-529 GG dwarfing Sam-530 GG dwarfing Sam-531 CC Long vines Sam-532 GG dwarfing Sam-533 GG dwarfing Sam-534 CG Long vines Sam-535 CG Long vines Sam-536 CC Long vines Sam-537 GG dwarfing Sam-538 CC Long vines Sam-539 GG dwarfing Sam-540 CG Long vines Sam-541 CC Long vines Sam-542 GG dwarfing Sam-543 GG dwarfing Sam-544 GG dwarfing Sam-545 CG Long vines Sam-546 GG dwarfing Sam-547 CG Long vines Sam-548 GG dwarfing Sam-549 CC Long vines Sam-550 GG dwarfing Sam-551 GG dwarfing Sam-552 GG dwarfing Sam-553 CC Long vines Sam-554 GG dwarfing Sam-555 GG dwarfing Sam-556 CG Long vines Sam-557 GG dwarfing Sam-558 CG Long vines Sam-559 CG Long vines Sam-560 GG dwarfing Sam-561 CC Long vines Sam-562 GG dwarfing Sam-563 GG dwarfing Sam-564 CG Long vines Sam-565 GG dwarfing Sam-566 CG Long vines Sam-567 CC Long vines Sam-568 GG dwarfing Sam-569 CG Long vines Sam-570 CC Long vines Sam-571 GG dwarfing Sam-572 GG dwarfing Sam-573 CC Long vines Sam-574 CG Long vines Sam-575 CG Long vines Sam-576 CC Long vines Sam-577 CG Long vines Sam-578 CC Long vines Sam-579 CG Long vines Sam-580 CC Long vines Sam-581 GG dwarfing Sam-582 CC Long vines Sam-583 CC Long vines Sam-584 CG Long vines Sam-585 GG dwarfing Sam-586 GG dwarfing Sam-587 CC Long vines Sam-588 CG Long vines Sam-589 CC Long vines Sam-590 CG Long vines Sam-591 CC Long vines Sam-592 CC Long vines Sam-593 GG dwarfing Sam-594 GG dwarfing Sam-595 CC Long vines Sam-596 GG dwarfing Sam-597 GG dwarfing Sam-598 CG Long vines Sam-599 CC Long vines Sam-600 CG Long vines Sam-601 GG dwarfing Example 2: Cmerecta- 2 and Cmerecta- Isometric analysis between 1 Existing research indicates that Cmerecta -NIL's dwarfing phenotype is caused by Cmerecta- 1. Due to mutation, Cmerecta- 1. Mutation CmERECTA The stop codon TAG is formed at nucleotide 113 of exon 25 of the gene (Liu Gangyun et al., 2024, Molecular marker-assisted construction of melon dwarfing gene). Cmerecta (Near-isogenic lines). To further verify... CmERECT A new variant Cmerecta- 2. The function of regulating the dwarfing plant type of melons. In this embodiment, HMN-S is combined with... Cmerecta -NIL was hybridized and analyzed Cmerecta- 2 and Cmerecta- The equivalence relation between 1 and 2. The result is as follows: Figure 4 As shown, the F1 generation of HMN × TopMark hybrids exhibits a distinctly long vine, while HMN-S and... Cmerecta F1 of -NIL hybrids (HMN-S×) Cmerecta -NIL) exhibits a dwarfing phenotype similar to that of the dwarfing parent. This result indicates that HMN-S× Cmerecta In the F1 material of -NIL, two CmERECTA The function of gene copying is disrupted. Cmerecta- 2. The variants have similar characteristics Cmerecta- 1. The function of controlling the dwarfing plant type of melon.

[0034] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications can still be made to the specific implementation of the present invention or equivalent substitutions can be made to some technical features without departing from the spirit of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the technical solutions claimed in the present invention.

Claims

1. A SNP molecular marker co-segregating with the short-internode phenotype of melon, characterized in that, The nucleotide polymorphism at position 51 of the nucleotide sequence shown in SEQ ID No. 1 is C or G.

2. The SNP molecular marker of claim 1, wherein, When the genotype of the SNP molecular marker in the genome of the C. melo is homozygous GG, the C. melo plant exhibits dwarf plant type; when the genotype of the SNP molecular marker is homozygous CC or heterozygous CG, the C. melo plant exhibits normal plant height.

3. A KASP molecular marker co-segregating with the short stature phenotype of C. melo, characterized in that, The SNP molecular marker design according to claim 1 comprises three primers: the primer K1145461-F with the nucleotide sequence shown in SEQ ID No. 2, the primer K1145461C-R with the nucleotide sequence shown in SEQ ID No. 3, and the primer K1145461G-R with the nucleotide sequence shown in SEQ ID No.

4.

4. The KASP molecular marker according to claim 3, wherein When the DNA template is from the C. melo plant with homozygous CC genotype of the SNP molecular marker in the genome, the DNA sequence shown in SEQ ID No. 5 can be amplified using the primers K1145461-F, K1145461C-R and K1145461G-R as PCR primers, and the DNA sequence shown in SEQ ID No. 5 can bind to the fluorescent group FAM; when the DNA template is from the C. melo plant with homozygous GG genotype of the SNP molecular marker in the genome, the DNA sequence shown in SEQ ID No. 6 can be amplified using the primers K1145461-F, K1145461C-R and K1145461G-R as PCR primers, and the DNA sequence shown in SEQ ID No. 6 can bind to the fluorescent group HEX; when the DNA template is from the C. melo plant with heterozygous CG genotype of the SNP molecular marker in the genome, the DNA sequences shown in SEQ ID No. 5 and SEQ ID No. 6 can be simultaneously amplified using the primers K1145461-F, K1145461C-R and K1145461G-R as PCR primers.

5. Use of the KASP molecular marker of claim 3 in the preparation of a product for identifying or assisting in identifying the SNP molecular marker or the plant height of C. melo of claim 1.

6. Use according to claim 5, characterized in that, The product includes a reagent, a kit or a chip.

7. Use of the SNP molecular marker of claim 1 or the KASP molecular marker of claim 3 in C. melo breeding.

8. Use according to claim 7, characterized in that, The SNP molecular marker or the KASP molecular marker is used in breeding C. melo dwarf plants.

9. A method for identifying the SNP molecular marker of claim 1, mainly comprising the following steps: Extracting the genomic DNA of the C. melo to be tested as a template, and using the primers K1145461-F with the nucleotide sequence shown in SEQ ID No. 2, K1145461C-R with the nucleotide sequence shown in SEQ ID No. 3, and K1145461G-R with the nucleotide sequence shown in SEQ ID No. 4 as PCR primers for PCR reaction; After PCR amplification, the genotype of the detected melon sample is determined according to the fluorescence detection result, and the judgment standard is as follows: When the amplification product mainly emits FAM fluorescence, it indicates that the amplified DNA sequence is as shown in SEQ ID No. 5, and the genotype of the SNP molecular marker in the genome of the detected melon sample is homozygous CC; when the amplification product mainly emits HEX fluorescence, it indicates that the amplified DNA sequence is as shown in SEQ ID No. 6, and the genotype of the SNP molecular marker in the genome of the detected melon sample is homozygous GG; when the FAM fluorescence and HEX fluorescence intensity of the amplification product are equivalent, it indicates that the amplified DNA contains the sequences shown in SEQ ID No. 5 and SEQ ID No. 6 at the same time, and the genotype of the SNP molecular marker in the genome of the detected melon sample is heterozygous CG.

10. A breeding method of dwarf melon, mainly comprising the following steps: Using the melon material with homozygous GG or heterozygous CG genotype of the SNP molecular marker in the melon genome according to claim 1, the genotype of the SNP molecular marker in the normal height melon is changed from homozygous CC to homozygous GG by hybridization or selfing, so as to introduce the dwarf plant type into the specific melon material, and promote the cultivation of dwarf melon variety.

Images