Transferase mutant with improved catalytic activity based on deep learning modification

By modifying the transferase through deep learning, especially by combining mutations at sites such as P24Q, P24Y, E100S, P105K, and P105E, the problem of insufficient catalytic activity of the transferase has been solved, and the efficient industrial production of 3-amino-2-hydroxyacetophenone has been achieved.

CN121699894APending Publication Date: 2026-03-20ZHEJIANG UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511904385.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing transferases have insufficient catalytic activity, resulting in low yields of target products in industrial production, making it difficult to meet the requirements of economically feasible industrial production. Traditional enzyme modification methods are inefficient and costly.

Method used

Deep learning methods were used to modify the transferase. By mutating specific amino acid sites in the transferase derived from Pseudomonas oleovorans, especially the combination of mutations at sites such as P24Q, P24Y, E100S, P105K, and P105E, the catalytic activity was improved and the reaction conditions were optimized.

Benefits of technology

It significantly improved the catalytic activity of the transferase, increased the yield of 3-amino-2-hydroxyacetophenone, and achieved a maximum conversion rate of 90%, thus realizing the feasibility of industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121699894A_ABST
    Figure CN121699894A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of protease, and discloses a transferase mutant with improved catalytic activity based on deep learning modification. According to the present invention, transferase derived from Pseudomonas oleovorans is adopted as a wild enzyme, a deep learning method is adopted, the effect of catalytic synthesis of 3-amino-2-hydroxyacetophenone is verified through experiments, mutants obtained through mutation of five specific amino acid sites such as P24Q, P24Y, E100S, P105K and P105E are obtained, and the catalytic activity of the mutants is significantly improved compared to the catalytic activity of the wild type; according to detection, the enzyme activity of the obtained three-site combined mutation P24Y / E100S / P105K is improved by 21.5 times compared with that of a wild type. Based on the mutant, the problems that a substrate is difficult to dissolve, the substrate inhibits an enzymatic reaction and oxygen inhibits the reaction are solved, and the mutant has a prospect in large-scale application of industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of protease, and particularly relates to a transferase mutant with high catalytic activity and application thereof in production of 3-amino-2-hydroxyacetophenone. BACKGROUND

[0002] Pranlukast is a highly effective leukotriene receptor antagonist. Since it was launched in the 1990s, it has become an important drug for treating asthma and allergic diseases. Its pharmacological advantages are significant, not only low toxicity and few adverse reactions, but also effective for various types of asthma. In recent years, its clinical application potential has been expanded to the prevention and treatment of otitis media, dysmenorrhea and other fields, and has broad market prospects. Therefore, there is a clear industrial demand for developing an efficient and green synthesis process of pranlukast.

[0003] One of the core structures of pranlukast molecule is its chiral amine fragment, and the key intermediate of this fragment is 3-amino-2-hydroxyacetophenone. The traditional chemical synthesis of this chiral intermediate is complicated, and may involve chiral resolution, resulting in poor atom economy and serious environmental pollution. Biological catalysis, especially enzyme catalysis, is considered as a more potential green synthesis route due to its wide substrate spectrum, high stereoselectivity, mild conditions and environmental friendliness. In this synthesis path, transferase plays an irreplaceable key role. For example, transferase EC 2.6 is responsible for catalyzing the conversion of precursor substances (such as hydroxylamine intermediates produced by nitroreductase) to the final 3-amino-2-hydroxyacetophenone. The catalytic ability of transferase as the core biological catalyst determines whether the entire synthesis route is feasible.

[0004] Natural or wild-type transferase usually has problems such as insufficient catalytic activity, easy to be inhibited by substrate under high substrate concentration in industrialization, and poor stability in complex multi-enzyme system. These defects directly lead to low reaction conversion rate, long production cycle, and sharp decline in yield of target product when the reaction system is scaled up, which is difficult to meet the economic and feasible requirements of industrial production.

[0005] Molecular modification of transferases to improve their performance is an inevitable choice. Traditional enzyme modification methods, such as directed evolution, are widely used but have great limitations. This method relies on the construction of a large random mutation library and the tedious high-throughput screening to find mutants with improved performance, which has the disadvantages of blindness, long research and development cycle, high cost of manpower and material resources, etc. The development of computational biology and artificial intelligence provides a new paradigm for rational enzyme design. Among them, deep learning technology, especially the model (such as DLKcat) that can predict enzyme catalytic constant (kcat), shows great potential. This kind of model can intelligently mine key amino acid sites related to enzyme activity and stability by learning a large amount of enzyme sequence and function data, so as to realize accurate prediction of the function of mutants, and significantly improve the pertinence and efficiency of enzyme modification. SUMMARY

[0006] In order to solve the above technical problems of low catalytic activity of transferase and low yield of target product in amplification system, the application provides a transferase mutant with improved catalytic activity based on deep learning modification.

[0007] The specific technical scheme of the application is as follows:

[0008] In the first aspect, the application provides a transferase mutant with high catalytic activity, which is obtained by single-point mutation or multi-point combination mutation of the following sites of the amino acid sequence shown in SEQ ID NO. 1:

[0009] The 24th amino acid proline (P) is mutated to glutamine (Q), i.e. P24Q;

[0010] The 24th amino acid proline (P) is mutated to tyrosine (Y), i.e. P24Y;

[0011] The 100th amino acid glutamic acid (E) is mutated to serine (S), i.e. E100S;

[0012] The 105th amino acid proline (P) is mutated to lysine (K), i.e. P105K;

[0013] The 105th amino acid proline (P) is mutated to glutamic acid (E), i.e. P105E.

[0014] The transferase derived from Pseudomonas oleovorans has an amino acid sequence as shown in SEQ ID NO. 1. The present application takes the transferase with the amino acid sequence as shown in SEQ ID NO. 1 as the wild enzyme, uses the deep learning method to carry out protein molecular modification, obtains multiple single-point or multi-point mutants, and verifies the effect of catalyzing the synthesis of 3-amino-2-hydroxyacetophenone through experiments, and obtains the mutants obtained by mutating the specific amino acid sites P24Q, P24Y, E100S, P105K and P105E. The catalytic activity of these mutants is significantly improved compared with the wild type. Among them, the enzyme activity of the three-site combination mutation P24Y / E100S / P105K obtained through detection is 21.5 times higher than that of the wild type. The above mutants of the present application can effectively improve the yield of catalyzing the synthesis of 3-amino-2-hydroxyacetophenone.

[0015] As preferred, a transferase mutant with high catalytic activity is provided, which is obtained by any one of the following mutations of the amino acid sequence as shown in SEQ ID NO. 1:

[0016] The 24th amino acid proline is mutated to glutamine;

[0017] The 24th amino acid proline is mutated to tyrosine;

[0018] The 100th amino acid glutamic acid is mutated to serine;

[0019] The 105th amino acid proline is mutated to lysine;

[0020] The 105th amino acid proline is mutated to glutamic acid;

[0021] The 24th amino acid proline is mutated to tyrosine, and the 100th amino acid glutamic acid is mutated to serine, and the 105th amino acid proline is mutated to lysine;

[0022] The 24th amino acid proline is mutated to tyrosine, and the 100th amino acid glutamic acid is mutated to serine, and the 105th amino acid proline is mutated to glutamic acid.

[0023] In a second aspect, a coding gene of the above transferase mutant is provided.

[0024] In a third aspect, a recombinant vector comprising the above coding gene is provided. The present application relates to a recombinant expression vector containing the coding gene. The vector can be a plasmid, a bacteriophage or a virus, etc. conventional vectors in the art.

[0025] As preferred, the vector is pET28a.

[0026] In a fourth aspect, a genetically engineered bacterium is provided, which comprises the above-mentioned coding gene or the above-mentioned recombinant vector. The genetically engineered bacterium can be various host microorganisms in the art, mainly meeting that the recombinant expression vector can be stably self-replicated and the mutant gene of the transferase of the application carried thereby can be effectively expressed.

[0027] Preferably, the genetically engineered bacterium is Escherichia coli.

[0028] In a fifth aspect, a use of the mutant of the transferase in the production of 3-amino-2-hydroxyacetophenone is provided.

[0029] Preferably, the mutant of the transferase is used to catalyze the preparation of 3-amino-2-hydroxyacetophenone with 3-nitroacetophenone (3NAP) as a substrate.

[0030] The mutant of the transferase of the application can be used in the form of whole cells, cell-broken crude enzyme solution, partially purified or completely purified enzyme protein. If necessary, the high-selectivity mutant of the transferase of the application can also be made into immobilized enzyme or immobilized cell form by using immobilization technology.

[0031] In a sixth aspect, a method for realizing industrialized production of 3-amino-2-hydroxyacetophenone by using the above-mentioned enzyme and mutant thereof is provided, which comprises the following steps:

[0032] In the reaction system, the mutant of the transferase is added to perform catalytic reaction.

[0033] In the reaction system, the mutant of the transferase is added to perform catalytic reaction.

[0034] The reaction system comprises: substrate 3-nitroacetophenone, nitroreductase, NADK kinase, transferase, glucose dehydrogenase, glycerol, hydrogen peroxide;

[0035] The pH of the reaction system is 8.0-9.0, and the reaction temperature is 20-35℃; the addition amount of glycerol is 2-5% and the addition amount of hydrogen peroxide is 0.5-0.8% in terms of volume percentage.

[0036] The catalytic reaction is performed under anaerobic conditions.

[0037] Preferably, the concentration ratio of the nitroreductase, NADK kinase, transferase and glucose dehydrogenase is 3:4:10:8.

[0038] Preferably, the reaction time is 8-18 hours.

[0039] Compared with the prior art, the application has the following technical effects:

[0040] (1) The application takes the transferase derived from Pseudomonas oleovorans as a wild enzyme, adopts a deep learning method, and obtains the mutant of five specific amino acid sites P24Q, P24Y, E100S, P105K and P105E, and the catalytic activity of the mutant is significantly improved compared with that of the wild type. Among them, through detection, the enzyme activity of the three-site combination mutation P24Y / E100S / P105K is 21.5 times higher than that of the wild type. The mutant of the application can effectively improve the yield of catalytic synthesis of 3-amino-2-hydroxyacetophenone.

[0041] (2) The application also provides a method for realizing industrial production of 3-amino-2-hydroxyacetophenone by using the enzyme. By optimizing the proportion of the four enzymes in the reaction system, the reaction time, and strictly controlling the dissolved oxygen content, temperature and pH in the reaction system, the reaction system is expanded, and the conversion rate in the 500mL system can reach 90%. The application has industrial application value. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 It is SDS-PAGE analysis of high-activity transferase mutant, wherein M is low molecular weight protein Marker; A and B are wild enzyme habA and mutant habA_M3 after purification, respectively;

[0043] Figure 2 It is the best proportion of each enzyme in the four-enzyme system;

[0044] Figure 3 It is the yield comparison of oxygen and anaerobic in the reaction system;

[0045] Figure 4 It is the optimum pH of high-activity transferase mutant and wild type;

[0046] Figure 5 It is the optimum temperature of high-activity transferase mutant and wild type;

[0047] Figure 6 It is the influence of different cosolvents in the reaction system on the yield;

[0048] Figure 7 It is the influence of different glycerol addition amount in the reaction system on the yield;

[0049] Figure 8 It is the influence of different protective agents in the reaction system on the yield;

[0050] Figure 9 It is the influence of different hydrogen peroxide addition amount in the reaction system on the yield;

[0051] Figure 10To amplify the optimum reaction time of the mutant of transferase in the system. DETAILED DESCRIPTION

[0052] The application will be further described below in conjunction with the examples. Those skilled in the art will be able to implement the application based on these descriptions. In addition, the examples of the application involved in the following descriptions are generally only examples of a part of the application, not all examples. Therefore, all other examples obtained by those skilled in the art based on the examples in the application without creative labor should be within the scope of protection of the application.

[0053] In the following examples, the sources of enzymes and other biochemical reagents are as follows: the plasmid extraction kit and DNA purification and recovery kit used are purchased from Hangzhou Qikexi Biological Technology Co., Ltd.; the one-step cloning kit is purchased from Novizen Co., Ltd.; E. coli BL21 (DE3) and plasmid pET-28a (+) are purchased from Shengong Bioengineering (Shanghai) Co., Ltd.; the whole gene synthesis is completed by Shengong Bioengineering (Shanghai) Co., Ltd.; the DNA marker, low molecular weight standard protein and protein pre-prepared glue are purchased from Beijing GenStar Co., Ltd.; the ClonExpress II OneStep Cloning Kit seamless cloning kit is purchased from Nanjing Novizen Biological Technology Co., Ltd.; pfu DNA polymerase and DpnI endonuclease are purchased from Thermo Fisher Scientific (China) Co., Ltd.; primer synthesis and sequence sequencing work are completed by Hangzhou Qikexi Biological Technology Co., Ltd. The use methods of the above reagents are referred to the product instructions. The inter-reagent used in the catalytic process is nitroacetophenone and 3-amino-2-hydroxyacetophenone purchased from Aladdin Reagent (Shanghai, China), and other commonly used reagents are purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.

[0054] In the following examples, the detection method is: the detection of reaction products is carried out by high performance liquid chromatography (HPLC) analysis method, and the products are analyzed. The HPLC analysis method is: chromatographic column / Avantor® phenyl; column temperature / 40℃; flow rate / 1mL / min; detection wavelength / 235nm; mobile phase: deionized water: pure acetonitrile=75:25.

[0055] In the following examples, the composition of the culture medium is as follows:

[0056] 1) The composition of LB liquid medium is: 10g / L of proteose peptone, 5g / L of yeast powder and 10g / L of NaCl, which are dissolved in pure water and then constant volume.

[0057] 2) The composition of LB solid medium is: 10g / L of proteose peptone, 5g / L of yeast powder, 10g / L of NaCl and 20g / L of agar powder, which are dissolved in pure water and then constant volume.

[0058] 3) TB liquid culture medium composition: peptone 11.8g / L, yeast extract 23.6g / L, K2HPO4 9.4g / L, KH2PO4 2.2g / L, glycerol 5g / L, dissolved in pure water and brought to volume.

[0059] In the following examples, enzyme activity is defined as the amount of enzyme required to catalyze the production of 1 μmol of product from a substrate per minute under certain conditions. This is defined as one unit of activity, denoted as U.

[0060] The relevant information regarding the primers used in the following examples is shown in Table 1.

[0061] Primer name Sequence (5' - 3') P24Y-F GGTCTGCTGGTTTATGTTAGTAAAAACCCG P24Q-F GGTCTGCTGGTTCAAGTTAGTAAAAACCCG P24-R AACCAGCAGACCGGTAACCAGACCCAG I96Q-F TGGCTCCTCAAGCCGCAGGAGAAC I96-R GTGTGCTACGATGTTCTCCTGCGGC E100S-F CCGCAGGATCTCATCGTAGCACAC E100S-R TCCTGCGGCAATAGGAGCCAG P105K-F CGTAGCACAAAGCTGAAAGAACGTG P105S-F CGTAGCACATCTCTGAAAGAACGTG P105E-F CGTAGCACAGAACTGAAAGAACGTG P105L-F CGTAGCACACTTCTGAAAGAACGTG P105H-F CGTAGCACACATCTGAAAGAACGTG P105-R TGTGCTACGATGTTCTCCTGCG

[0062] Example 1

[0063] The wild-type (WT) transferase (habA, EC: 2.6) from *Pseudomonas oleovorans*, with its amino acid sequence shown in SEQ ID NO.1 and nucleotide sequence shown in SEQ ID NO.2, was synthesized. The wild-type gene sequence was then inserted into the expression plasmid pET-28a(+) to obtain pET-28a(+)-habA. After sequencing verification, pET-28a(+)-habA was transformed into the expression host *Escherichia coli* BL21(DE3) for subsequent recombinase expression.

[0064] After activation by streak plating, the engineered bacteria with confirmed sequencing results were inoculated into 10 mL of LB broth containing 50 mg / mL kanamycin. The cultures were incubated at 37°C with shaking for 12 h. Then, at a 2% inoculum (v / v) transfer, the cultures were transferred into 100 mL of fresh LB broth containing 50 mg / mL kanamycin and incubated at 37°C with shaking until OD500 reached. 600 When the concentration reaches 0.8, cool down to 28℃, add IPTG to a final concentration of 0.1mM, and induce culture for 16h. After the culture is completed, centrifuge the culture medium at 8000rpm for 10min, discard the supernatant, collect the bacterial cells, and store them in a -20℃ refrigerator for later use.

[0065] After the culture was completed, the bacterial cells were washed twice with 100mM pH 8.0 phosphate buffer, then resuspended in 50mL pH 8.0 phosphate buffer, homogenized and disrupted, and the disrupted liquid was centrifuged to remove the precipitate, thus obtaining a crude enzyme solution containing recombinant habA enzyme.

[0066] Example 2 Construction of transferase mutants

[0067] Based on the wild-type transferase (habA) sequence, amino acids at positions 24, 96, 100, and 105 were mutated. Primer sequences for PCR were designed for the mutants targeting positions 24, 96, 100, and 105 of the mutated transferase sequence. The primer sequences are shown in Table 1 according to the mutation order of the mutation sites.

[0068] Using pET-28a(+)-habA as a template, PCR amplification was performed with primers targeting the mutation site to obtain the mutant sequence. The PCR (25 μL) amplification system was as follows: 25 μL of 2×PCR buffer, 1.5 μL each of forward and reverse primers, 1 μL of template plasmid, 1 μL of dNTP, 1 μL of high-fidelity enzyme, and ddH2O added to make up to 50 μL. The PCR amplification program was as follows: (1) 95℃ pre-denaturation for 5 min, (2) 95℃ denaturation for 30 seconds, (3) 68℃ annealing for 30 seconds, (4) 72℃ extension for 5 min, 30 cycles, (5) 72℃ extension for 10 min, (6) storage at 4℃.

[0069] After PCR, 5 μL of the amplification product was subjected to nucleic acid gel electrophoresis. 2 μL of DpnI restriction enzyme was added to the PCR product with a clear target band, and the sample was digested at 37°C for 1 hour. After the reaction, the product was cleaned up and transformed into E. coli BL21(DE3) competent cells, plated on LB medium containing 50 mg / mL kanamycin, and incubated overnight at 37°C. The cells were collected to obtain transformants containing the mutant.

[0070] Example 3: High-throughput screening of mutant libraries

[0071] The transformants obtained in Example 2 were activated by streak plating. Single colonies were then inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking for 12 h. The culture was then transferred at a 2% inoculum (v / v) to 100 mL of fresh LB liquid medium also containing 50 mg / mL kanamycin and cultured at 37°C with shaking until OD500 was reached. 600 When the concentration reaches 0.8, cool down to 28℃, add IPTG to a final concentration of 0.1mM, and induce culture for 15h. After the culture is completed, centrifuge the culture medium at 8000rpm for 10min, discard the supernatant, collect the bacterial cells, and store them in a -20℃ refrigerator for later use.

[0072] After the culture was completed, the bacterial cells were washed twice with 100mM pH 8.0 phosphate buffer, then resuspended in 50mL pH 8.0 phosphate buffer, homogenized and disrupted, and the lysate was centrifuged to remove the precipitate, thus obtaining the crude enzyme solution of the habA enzyme mutant.

[0073] The above-obtained crude habA enzyme mutant solution was mixed with the crude habA enzyme solution of wild type for a colorimetric reaction, as follows:

[0074] In a 1 ml system, 48 μL of nitroreductase and 0.01 g of m-nitroacetophenone were added and reacted for 12 hours. After centrifugation at 8000 rpm for 20 minutes, 840 μL of the supernatant was aspirated into a 96-well clear plate using a multi-channel pipette. 160 μL of the crude enzyme solution of the obtained habA enzyme mutant was added, and the mixture was allowed to react for 20 minutes to generate a yellow-brown compound. The absorbance at 450 nm was detected using a high-throughput microplate reader. Positive clones were screened using wild-type wthabA enzyme (the crude enzyme solution of wild-type habA enzyme prepared in Example 1) as a control.

[0075] Finally, positive clones P24Q, P24Y, I96Q, E100S, P105K, P105S, P105E, P105L, and P105H were obtained.

[0076] Example 4 Comparison of enzyme activities of transferase mutants

[0077] The positive clones P24Q, P24Y, I96Q, E100S, P105K, P105S, P105E, P105L, and P105H obtained from the initial screening were cultured and used for secondary screening. The steps are as follows:

[0078] After activating the engineered bacteria of the above positive clones by streak plating, a single colony was inoculated into 10 mL of LB broth containing 50 mg / mL kanamycin and cultured at 37°C with shaking for 12 h. Then, at a 2% inoculum volume, the culture was transferred to 100 mL of fresh LB broth containing 50 mg / mL kanamycin and cultured at 37°C with shaking until OD (out of 0.05) was reached. 600 When the concentration reaches 0.8, the temperature is lowered to 28℃, IPTG is added to a final concentration of 0.5mM, and the culture is induced for 16h. After the culture is completed, the culture medium is centrifuged at 8000rpm for 10min, the supernatant is discarded, and the bacterial cells are collected to obtain the re-screened bacterial cells. The re-screened bacterial cells are washed twice with 100mM pH8.0 phosphate buffer, then resuspended in 50mL pH8.0 phosphate buffer, homogenized and disrupted, and the disrupted liquid is centrifuged to remove the precipitate to obtain the re-screened crude enzyme solution.

[0079] The crude enzyme solution from the secondary screening was used for secondary screening. The 10 mL reaction system included: 10 g / L substrate m-nitroacetophenone, 5 mM ATP, 5 mM NAD+, 20 g / L glucose, 4.8 g / L nitroreductase (BH), 12.8 g / L glucose dehydrogenase (GDH), 16 g / L transferase (crude enzyme solution of wild-type habA enzyme obtained in Example 1 or various secondary screening crude enzyme solutions), 6.4 g / L NADK kinase (CG), and 6 mL of 100 Mm K2HPO4-KH2PO4 buffer at pH 8.0.

[0080] After 12 hours of reaction, 100 μL of the reaction solution was added to 900 μL of DMSO for further processing. The concentration of 3-amino-2-hydroxyacetophenone was determined using high-performance liquid chromatography (HPLC), and the enzyme activity (U) was calculated. At 25°C and pH 8.0, the amount of enzyme required to catalyze the production of 1 μmol of product per minute from the substrate is defined as one unit of activity, denoted as U.

[0081] The enzyme activity assay results of wild-type transferases and their mutant enzymes P24Q, P24Y, I96Q, E100S, P105K, P105S, P105E, P105L, and P105H are shown in Table 2.

[0082] Table 2

[0083] Name Enzyme activity (U / mg) WT 0.176 P24Q 0.468 P24Y 0.477 I96Q 0.419 E100S 0.512 P105K 0.446 P105S 0.430 P105E 0.434 P105L 0.411 P105H 0.407

[0084] As shown in Table 2, the enzyme activities of mutants at the five specific sites P24Q, P24Y, E100S, P105K, and P105E were significantly higher than those of wild-type enzymes. The enzyme activities of P105S and P105H mutants were also relatively higher than those of wild-type enzymes.

[0085] To obtain more mutants with high catalytic activity, multi-site combination mutations were performed on the above sites. The results showed that when P24Y and P24Q were combined with other sites such as E100S, the mutants resulting from the P24Y combination were significantly higher than those resulting from the P24Q combination. Therefore, P24Y was selected for further combination mutations with E100S, P105K, P105E, P105S, and P105H sites to screen for more high-activity transferase mutants.

[0086] Example 5 Construction of a highly active transferase mutant

[0087] The sites with significantly increased enzyme activity in Example 4 were combined with mutated. After amplification of the whole plasmid, point mutations were performed using the primer sequences in Table 1 to obtain mutants pET-28a(+)-P24Y / E100S / P105K, pET-28a(+)-P24Y / E100S / P105S, pET-28a(+)-P24Y / E100S / P105E, pET-28a(+)-P24Y / E100S / P105L, and pET-28a(+)-P24Y / E100S / P105H. The mutation sites contained in the plasmid names are the expression plasmids with the corresponding mutation sites. The reaction system was the same as in Example 4. After reacting for 12 hours, 100 μL of the reaction solution sample was added to 900 μL of DMSO for treatment. The concentration of 3-amino-2-hydroxyacetophenone was determined by high performance liquid chromatography and the enzyme activity (U) was calculated.

[0088] The enzyme activity assay results of wild-type transferase and its mutant enzymes pET-28a(+)-P24Y / E100S / P105K, pET-28a(+)-P24Y / E100S / P105S, pET-28a(+)-P24Y / E100S / P105E, pET-28a(+)-P24Y / E100S / P105L and pET-28a(+)-P24Y / E100S / P105H are shown in Table 3.

[0089] Table 3

[0090] Name Enzyme activity (U / mg) WT 0.176 P24Y / E100S / P105K 3.790 P24Y / I96Q / P105S 0.220 P24Y / E100S / P105E 1.491 P24Y / E100S / P105L 0.409 P24Y / E100S / P105H 0.350

[0091] As shown in Table 3, the enzyme activity of the transferase mutant pET-28a(+)-P24Y / E100S / P105K was significantly increased compared to the wild type, from 0.176U to 3.79U. This mutant enzyme is denoted as habA_M3. The enzyme activity of P24Y / E100S / P105E was also significantly increased compared to the wild type, from 0.176U to 1.491U.

[0092] The obtained transferase mutant habA_M3 was analyzed by SDS-PAGE, and the results are shown in the figure. Figure 1 In this context, M represents a low molecular weight protein marker; A and B represent the purified wild-type enzyme habA and the mutant habA_M3, respectively.

[0093] Example 6

[0094] This embodiment describes the enzymatic property analysis of the recombinant highly active transferase mutant and the scale-up of the production system. The production system was as follows: temperature 30°C, pH 9.0, substrate 15 g / L m-nitroacetophenone, nitroreductase (BH) 4.8 g / L, NADK kinase (CG) 6.4 g / L, transferase (habA) 16 g / L, glucose dehydrogenase (GDH) 12.8 g / L, 12.5 mL glycerol, and 2 mL hydrogen peroxide. The reaction time was 18 h. The transferase used was habA_M3, which exhibited the highest activity in Example 5. The following optimizations are based on this reaction system, with adjustments made to each step. Unless otherwise specified, the reaction volume is 10 mL, and the conditions described above are followed.

[0095] The steps are as follows:

[0096] 1. Optimization of the concentration ratio of the four enzymes in the reaction system

[0097] Enzymatic reactions were carried out under constant total concentrations of the four enzymes, reaction temperature, reaction pH, and reaction time in the reaction system, at different ratios of the four enzyme concentrations (1:2:7:8, 1:4:8:10, 1:6:10:12, 3:2:8:10, 3:4:10:8, 3:6:7:12, 5:2:10:12, 5:4:7:8, 5:6:8:10). The results are shown in [Figure number missing]. Figure 2 .

[0098] Depend on Figure 2 It can be seen that the optimal ratio of the four enzyme concentrations in the reaction system is BH:CG:habA:GDH = 3:4:10:8.

[0099] 2. Method for determining the optimal reaction time of recombinant highly active transferase mutants

[0100] The recombinant mutant with the greatest enzyme activity in Example 5 and the wild type were reacted in 100mM K2HPO4-KH2PO4 buffer at 30°C and pH 8. The reaction system was the same as in Example 4. Samples were taken every two hours for HPLC detection.

[0101] The results showed that the optimal reaction times for the wild-type transferase habA and the mutant transferase habA_M3 were 12 hours and 10 hours, respectively. Furthermore, the mutant transferase habA_M3 exhibited superior yields within a reaction time range of 8–18 hours.

[0102] 2. Comparison of yields in the reaction system with and without oxygen

[0103] Because a reduction reaction exists in the reaction system, to prevent the oxidation reaction from inhibiting the reductase in the system, one group of reactions was carried out in an oxygen-free environment by introducing sufficient nitrogen gas into the reaction apparatus, while the other group was carried out in an oxygen-rich environment. The reaction system was the same as in Example 4, and the results were as follows. Figure 3 .

[0104] Depend on Figure 3 It can be seen that the reaction system works best under oxygen-free conditions.

[0105] 3. Optimal pH determination method for recombinant highly active transferase mutants

[0106] The recombinant mutant with the greatest enzyme activity enhancement in Example 5 and the wild type were reacted at 30°C in an anaerobic environment with 100 mM K2HPO4-KH2PO4 buffer at pH 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0, respectively, to determine their optimal pH. The results are shown in [Figure number missing]. Figure 4 The reaction system is the same as in Example 4.

[0107] Depend on Figure 4 It is known that the optimal reaction pH for wild-type transferase habA and mutant transferase habA_M3 is 8.0 and 9.0, respectively.

[0108] 4. Method for determining the optimal temperature of recombinant highly active transferase mutants

[0109] The recombinant mutant with the greatest enzyme activity enhancement from Example 5 and the wild-type were subjected to enzymatic reactions in 100mM K2HPO4-KH2PO4 buffer at pH 8 and pH 9, respectively, under anaerobic conditions at different temperatures (10℃, 20℃, 30℃, 37℃, 40℃, 50℃, 60℃). The results are shown in [Figure number missing]. Figure 5 The reaction system is the same as in Example 4.

[0110] Depend on Figure 5 It is known that the optimal reaction temperature for wild-type transferase habA and mutant transferase habA_M3 is 30℃.

[0111] 5. Screening and optimization of co-solvents in the reaction system

[0112] The recombinant mutant with the greatest increased enzyme activity from Example 5 was subjected to enzymatic reactions in 100mM K2HPO4-KH2PO4 buffer at 30°C and pH 9 using different co-solvents (glycerol, Tween 20, Triton, DMSO). The co-solvent with the best effect was screened, and its concentration was optimized. The results are shown in […]. Figure 6 and Figure 7 The reaction system is the same as in Example 4.

[0113] Depend onFigure 6 and Figure 7 It can be seen that the best co-solvent in the reaction system is glycerol, and the amount added is 250 μL.

[0114] 6. Screening and optimization of protecting agents in the reaction system

[0115] The recombinant mutant with the greatest increased enzyme activity from Example 5 was subjected to enzymatic reactions in 100mM K2HPO4-KH2PO4 buffer at 30°C and pH 9 with different protective agents (ascorbic acid, hydrogen peroxide, sodium sulfite, dithiothreitol, L-cysteine, trehalose, and glutathione). The most effective protective agent was screened, and its concentration was optimized. The results are shown in […]. Figure 8 and 9 The reaction system is the same as in Example 4.

[0116] Depend on Figure 8 and Figure 9 It can be seen that the best protective agent in the reaction system is hydrogen peroxide, and the amount added is 40 μL.

[0117] 7. Scale-up of the reaction system

[0118] The reaction system was expanded to 500 mL, and nitrogen gas was introduced into the reaction flask. The reaction conditions were the optimal conditions selected in steps 1 to 6 above: temperature 30℃, pH 9.0, substrate 15 g / L m-nitroacetophenone, nitroreductase 4.8 g / L, NADK kinase 6.4 g / L, transferase 16 g / L and glucose dehydrogenase 12.8 g / L, 12.5 mL glycerol and 2 mL hydrogen peroxide were added, and the reaction time was 18 h. The transferase used was habA_M3, which had the highest enzyme activity in Example 5. After the reaction, samples were taken using the method in Example 4 and liquid chromatography was performed. The final yield of the high-activity transferase in the reaction system was 14 g / L, and the conversion rate reached 90%.

[0119] During the reaction, samples were taken every two hours for HPLC analysis, and the results are as follows: Figure 10 .Depend on Figure 10 It can be seen that the mutant transferase habA_M3 has a better yield of the target product within a reaction time of 8-18 hours.

[0120] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0121] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A transferase mutant, characterized in that: It is obtained by performing single-point or multi-point combination mutations at the following sites on the amino acid sequence shown in SEQ ID NO.1: The 24th amino acid, proline, is mutated to glutamine; The 24th amino acid, proline, is mutated to tyrosine; The 100th amino acid, glutamic acid, is mutated to serine; The amino acid at position 105, proline, is mutated to lysine. The 105th amino acid, proline, is mutated to glutamic acid.

2. The transferase mutant as described in claim 1, characterized in that: It is obtained by performing any of the following mutations on the amino acid sequence shown in SEQ ID NO.1: The 24th amino acid, proline, is mutated to glutamine; The 24th amino acid, proline, is mutated to tyrosine; The 100th amino acid, glutamic acid, is mutated to serine; The amino acid at position 105, proline, is mutated to lysine. The amino acid at position 105, proline, is mutated to glutamic acid. The 24th amino acid, proline, is mutated to tyrosine. At the same time, the 100th amino acid, glutamic acid, is mutated to serine, and the 105th amino acid, proline, is mutated to lysine. The 24th amino acid, proline, is mutated to tyrosine. At the same time, the 100th amino acid, glutamic acid, is mutated to serine, and the 105th amino acid, proline, is mutated to glutamic acid.

3. The encoding gene of the transferase mutant as described in any one of claims 1 to 2.

4. A recombinant vector, characterized in that: It includes the coding gene as described in claim 3.

5. A genetically engineered bacterium, characterized in that: It contains the coding gene as described in claim 3 or the recombinant vector as described in claim 4.

6. The use of the transferase mutant as described in claim 1 in the production of 3-amino-2-hydroxyacetophenone.

7. The application as described in claim 6, characterized in that: Using farnesyl pyrophosphate as a substrate and the aforementioned transferase mutant as a catalyst, 3-amino-2-hydroxyacetophenone was catalyzed for production.

8. A method for producing 3-amino-2-hydroxyacetophenone, characterized in that: Includes the following steps: The transferase mutant as described in any one of claims 1 to 2 is added to the reaction system to carry out the catalytic reaction; in: The reaction system comprises: substrate internitroacetophenone, nitro reductase, NADK kinase, transferase, glucose dehydrogenase, glycerol, and hydrogen peroxide; The reaction system has a pH of 8.0-9.0 and a reaction temperature of 20-35°C; the amount of glycerol added is 2-5% by volume, and the amount of hydrogen peroxide added is 0.5-0.8%. The catalytic reaction is carried out under anaerobic conditions.

9. The method as described in claim 8, characterized in that: The concentration ratio of nitroreductase, NADK kinase, transferase, and glucose dehydrogenase was 3:4:10:

8.

10. The method as described in claim 8, characterized in that: The reaction time is 8 to 18 hours.