Indel molecular marker for identifying Qingqing orange, Cheng solid sweet orange and filial generation of Qingqing orange and Cheng solid sweet orange and application of Indel molecular marker
By resequencing and screening InDel sites in Kiyomi mandarin oranges and Chenggu rock sugar tangerines, and designing specific PCR primers to identify hybrid offspring, the problem of hybrid identification in citrus hybridization breeding was solved, and efficient and accurate identification of hybrid offspring was achieved.
Patent Information
- Application Number
- CN202610128648.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-20
AI Technical Summary
In citrus hybridization breeding, since most cultivars are polyembryonic, the presence of nucellar embryos leads to a large number of asexual seedlings mixed in the hybrid offspring, which increases the difficulty of hybrid identification. Existing technologies make it difficult to achieve early and accurate identification of hybrid offspring.
Insertion-deletion (InDel) molecular markers were used to screen for significantly different genomic loci by resequencing Kiyomi oranges and Chenggu rock sugar oranges. Specific PCR primers were designed, and InDel-18-F and InDel-18-R primers were used to identify hybrid offspring. The PCR results were detected using fully automated capillary electrophoresis.
It has achieved 100% accurate identification of Kiyomi tangerines, Chenggu rock sugar tangerines and their hybrid offspring, shortening the testing time and improving identification efficiency.
Smart Images

Figure SMS_1 
Figure SMS_2
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular biology and genetic breeding, and particularly relates to an Indel molecular marker for identifying Citrus sinensis x Citrus unshiu Marc, Citrus reticulata and their hybrid offspring and application thereof. BACKGROUND
[0002] In citrus cross breeding, due to the obvious polyembryony of most cultivars, the existence of nucellar embryos will lead to a large number of clone seedlings in hybrid offspring, thereby significantly increasing the difficulty of hybrid identification. Therefore, single-embryo varieties are usually selected as female parents in production and research to reduce the proportion of nucellar embryos and increase the proportion of sexual offspring in hybrid seedlings. This strategy improves hybridization efficiency to some extent, but also poses new challenges to hybrid identification.
[0003] In the citrus cross breeding system with single-embryo varieties as female parents, it is particularly necessary to introduce molecular marker methods for early and accurate identification of hybrid offspring. Insertion-Deletion (InDel) molecular markers are a type of molecular markers developed based on short fragment insertion or deletion variation in the genome, and have the advantages of wide distribution, high genetic stability, clear co-dominant expression, and good repeatability. Compared with SSR markers, InDel markers have the characteristics of simple primer design, intuitive amplification result interpretation, and suitability for conventional PCR and gel electrophoresis detection, and have been widely used in crop genetic diversity analysis, germplasm identification and molecular breeding research in recent years. Therefore, using InDel molecular markers to identify citrus varieties and hybrid populations has important theoretical significance and practical application value for improving identification efficiency, shortening breeding period and promoting high-quality development of citrus industry.
[0004] The application takes Citrus sinensis x Citrus unshiu Marc and Citrus reticulata as materials, uses the resequencing results of the parents, and selects a region with Insertion / Deletion (Indel) variation as a potential molecular marker site. The site has a distinguishable length difference between the parents Citrus sinensis and Citrus reticulata. According to the 150bp sequence above and below the selected Indel site, specific primers are designed to ensure that the target fragment can be amplified and the fragment length can be clearly distinguished in capillary analysis. One pair of primers can be designed for each site, and two pairs of primers are designed for hybrid offspring identification in the application to ensure that the offspring are 100% identified. SUMMARY
[0005] The application aims to provide an Indel molecular marker for identifying Qingjian orange, Chengguo Tangcang orange and their hybrid offspring, which is a DNA fragment with the sequence shown in SEQ ID NO. 1.
[0006] The application also aims to provide an application of the above-mentioned molecular marker in identifying Qingjian orange, Chengguo Tangcang orange and their hybrid offspring.
[0007] To achieve the above-mentioned purposes, the application adopts the following technical measures:
[0008] After resequencing the parent plants Qingjian orange and Chengguo Tangcang orange, the obtained sequencing data is compared and analyzed to screen out the genomic sites with clear insertion / deletion (Indel) differences between the two parent plants. Specific PCR primers are designed for the 150bp sequences above and below the candidate Indel sites to ensure that the length of the amplification product can be distinguished in electrophoresis or capillary analysis. The parent DNA is extracted and then subjected to PCR verification to screen out effective primers that can stably and specifically amplify the target fragment, which are used for subsequent hybrid offspring identification. Finally, the sequence shown in SEQ ID NO. 1 is screened out by the applicant as the Indel molecular marker.
[0009] The application of the reagent for detecting the polynucleotide shown in SEQ ID NO. 1 in identifying Qingjian orange, Chengguo Tangcang orange and their hybrid offspring.
[0010] The application of the reagent for detecting the polynucleotide shown in SEQ ID NO. 1 in preparing a Qingjian orange, Chengguo Tangcang orange and their hybrid offspring detection kit.
[0011] In the above-mentioned application, if only the polynucleotide shown in SEQ ID NO. 1 is detected, it is determined to be Qingjian orange; if only the polynucleotide shown in SEQ ID NO. 2 is detected, it is determined to be Chengguo Tangcang orange; and if the polynucleotides shown in SEQ ID NO. 1 and SEQ ID NO. 2 are detected at the same time, it is determined to be the hybrid offspring of Qingjian orange and Chengguo Tangcang orange.
[0012] In the above-mentioned application, the reagent is preferably a primer.
[0013] In the above-mentioned application, the reagent is preferably InDel-18-F: CAAGGTCAGAGATTAGTTGGTTATG and InDel-18-R: TTCAACAACTCCAATAAACTGATCC.
[0014] A method for identifying Qingjian Citrus sinensis, Chenggu Tangsugar orange and their hybrid offspring, comprising detecting whether the DNA to be tested contains the polynucleotide shown in SEQ ID NO. 1 or SEQ ID NO. 2, wherein the method comprises sequencing, PCR, gene chip or FISH.
[0015] Compared with the prior art, the present application has the following advantages:
[0016] (1) The present application selects the Indel site that is obviously different between the parent Qingjian Citrus sinensis and Chenggu Tangsugar orange, and selects the DNA fragment shown in SEQ ID NO. 1 as a molecular marker, which can distinguish the hybrid offspring from the parent with 100% accuracy.
[0017] (2) The present application uses a pair of Indel primers to identify Qingjian Citrus sinensis and Chenggu Tangsugar orange, and their hybrid offspring, which greatly shortens the detection time compared with traditional morphological identification or multi-marker combination identification method. DETAILED DESCRIPTION
[0018] Unless otherwise specified, the technical solutions described in the present application are conventional techniques in the art; unless otherwise specified, the reagents or materials described are obtained from commercial channels.
[0019] Example 1:
[0020] Indel molecular marker for identifying Qingjian Citrus sinensis, Chenggu Tangsugar orange and their hybrid offspring is obtained:
[0021] After resequencing of the parent Qingjian Citrus sinensis and Chenggu Tangsugar orange, the obtained sequencing data is aligned and analyzed to screen out genomic sites with clear insertion / deletion (Indel) difference between the two parents. Specific PCR primers are designed for the 150bp sequences above and below the candidate Indel sites to ensure that the length of the amplified product can be distinguished in electrophoresis or capillary analysis. By extracting the parent DNA and then performing PCR verification, effective primers that can stably and specifically amplify the target fragment are screened out for subsequent hybrid offspring identification. Finally, the sequence shown in SEQ ID NO. 1 is selected as the Indel molecular marker, and the detection primers of the InDel-18 molecular marker are:
[0022] InDel-18-F: CAAGGTCAGAGATTAGTTGGTTATG
[0023] InDel-18-R: TTCAACAACTCCAATAAACTGATCC.
[0024] Example 2:
[0025] Method for identifying Qianjian Jucheng, Chenggu Bingtang orange and their hybrid offspring by using molecular marker InDel-18:
[0026] Total DNA of the sample to be tested is extracted, and PCR amplification is carried out by using primers, wherein InDel-18-F is CAAGGTCAGAGATTAGTTGGTTATG, and InDel-18-R is TTCAACAACTCCAATAAACTGATCC.
[0027] The reaction system is as follows:
[0028] The PCR reaction system is as follows:
[0029]
[0030] The PCR reaction program is as follows:
[0031]
[0032] The PCR result of the sample to be tested is detected, if only a characteristic peak of 292 bp (as shown in SEQ ID NO. 1) is detected, it is determined as Qianjian Jucheng; if only a characteristic peak of 240 bp (as shown in SEQ ID NO. 2) is detected, it is determined as Chenggu Bingtang orange; if 292 bp and 240 bp can be detected at the same time, it is determined as the hybrid offspring of Qianjian Jucheng and Chenggu Bingtang orange.
[0033] In the present application, the PCR result is detected by using a full-automatic capillary electrophoresis technology, and other DNA fragment size detection methods in the art, such as polyacrylamide gel electrophoresis, sequencing and the like, can also realize accurate determination.
[0034] Example 3:
[0035] Application of molecular marker InDel-18 in identification of Qianjian Jucheng, Chenggu Bingtang orange and their hybrid offspring:
[0036] Total DNA samples of Qianjian Jucheng, Chenggu Bingtang orange and 137 hybrid offspring are extracted by using a Simgen plant DNA kit, the DNA samples are identified by using the method in Example 2, and the amplified fragment peak of the PCR amplification product of Qianjian Jucheng, Chenggu Bingtang orange and 137 hybrid offspring is detected by using a full-automatic capillary electrophoresis technology.
[0037] The results are as follows:
[0038] InDel-18 primer orange peak at 292 bp bp characteristics, while Chengguo sugar orange in 240 bp characteristic peak; then continue to detect the fragment peak of offspring found that the use of InDel-18 detection of offspring in 137 (100%) can simultaneously amplify the characteristic peak of both parents, the detection results of primer, hybrid offspring identification efficiency and accuracy is 100%.
[0039] Finally, it is pointed out that the above examples are only used to illustrate the technical solutions of the present application rather than limiting, although the present application is described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should be covered in the scope of claims of the present application.
Claims
1. Application of reagents for detecting the polynucleotides shown in SEQ ID NO.1 in the identification of Kiyomi mandarin orange, Chenggu rock sugar mandarin orange and their hybrid offspring.
2. Application of the reagent for detecting the polynucleotide shown in SEQ ID NO.1 in the preparation of a detection kit for Kiyomi tangerine, Chenggu rock sugar tangerine and their hybrid offspring.
3. The application according to claim 1 or 2, wherein the determination method of the application is as follows: if only the polynucleotide shown in SEQ ID NO.1 is detected, it is determined to be Kiyomi tangerine; if only the polynucleotide shown in SEQ ID NO.2 is detected, it is determined to be Chenggu rock sugar tangerine; if both the polynucleotides shown in SEQ ID NO.1 and SEQ ID NO.2 are detected, it is determined to be a hybrid offspring of Kiyomi tangerine and Chenggu rock sugar tangerine.
4. The application according to claim 1 or 2, wherein the reagent is a primer.
5. The application according to claim 4, wherein the primers are InDel-18-F: CAAGGTCAGAGATTAGTTGGTTATG and InDel-18-R: TTCAACAACTCCAATAAACTGATCC.
6. A method for identifying Kiyomi tangerine, Chenggu rock sugar tangerine and their hybrid offspring, comprising detecting whether the DNA to be tested contains the polynucleotide shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the method is sequencing, PCR, gene chip or FISH.